ID: 1023260306

View in Genome Browser
Species Human (GRCh38)
Location 7:38351799-38351821
Sequence GTATTATTTCACAACTTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023260306_1023260310 -2 Left 1023260306 7:38351799-38351821 CCTATAAAGTTGTGAAATAATAC No data
Right 1023260310 7:38351820-38351842 ACTAGTACTCCCAAAGATGGGGG No data
1023260306_1023260308 -4 Left 1023260306 7:38351799-38351821 CCTATAAAGTTGTGAAATAATAC No data
Right 1023260308 7:38351818-38351840 ATACTAGTACTCCCAAAGATGGG No data
1023260306_1023260307 -5 Left 1023260306 7:38351799-38351821 CCTATAAAGTTGTGAAATAATAC No data
Right 1023260307 7:38351817-38351839 AATACTAGTACTCCCAAAGATGG No data
1023260306_1023260309 -3 Left 1023260306 7:38351799-38351821 CCTATAAAGTTGTGAAATAATAC No data
Right 1023260309 7:38351819-38351841 TACTAGTACTCCCAAAGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023260306 Original CRISPR GTATTATTTCACAACTTTAT AGG (reversed) Intergenic
No off target data available for this crispr