ID: 1023262856

View in Genome Browser
Species Human (GRCh38)
Location 7:38375589-38375611
Sequence TGCTCTGCACTCAGGAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023262856_1023262865 28 Left 1023262856 7:38375589-38375611 CCAGTGTTCCTGAGTGCAGAGCA No data
Right 1023262865 7:38375640-38375662 CTGGAGAAGAAGGCTGCTGCGGG No data
1023262856_1023262867 30 Left 1023262856 7:38375589-38375611 CCAGTGTTCCTGAGTGCAGAGCA No data
Right 1023262867 7:38375642-38375664 GGAGAAGAAGGCTGCTGCGGGGG No data
1023262856_1023262859 -10 Left 1023262856 7:38375589-38375611 CCAGTGTTCCTGAGTGCAGAGCA No data
Right 1023262859 7:38375602-38375624 GTGCAGAGCATCTTTGCTCTGGG No data
1023262856_1023262866 29 Left 1023262856 7:38375589-38375611 CCAGTGTTCCTGAGTGCAGAGCA No data
Right 1023262866 7:38375641-38375663 TGGAGAAGAAGGCTGCTGCGGGG No data
1023262856_1023262864 27 Left 1023262856 7:38375589-38375611 CCAGTGTTCCTGAGTGCAGAGCA No data
Right 1023262864 7:38375639-38375661 CCTGGAGAAGAAGGCTGCTGCGG No data
1023262856_1023262861 18 Left 1023262856 7:38375589-38375611 CCAGTGTTCCTGAGTGCAGAGCA No data
Right 1023262861 7:38375630-38375652 TTTGACCATCCTGGAGAAGAAGG No data
1023262856_1023262860 9 Left 1023262856 7:38375589-38375611 CCAGTGTTCCTGAGTGCAGAGCA No data
Right 1023262860 7:38375621-38375643 TGGGTGAGCTTTGACCATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023262856 Original CRISPR TGCTCTGCACTCAGGAACAC TGG (reversed) Intergenic
No off target data available for this crispr