ID: 1023262857

View in Genome Browser
Species Human (GRCh38)
Location 7:38375597-38375619
Sequence AGCAAAGATGCTCTGCACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023262857_1023262867 22 Left 1023262857 7:38375597-38375619 CCTGAGTGCAGAGCATCTTTGCT No data
Right 1023262867 7:38375642-38375664 GGAGAAGAAGGCTGCTGCGGGGG No data
1023262857_1023262866 21 Left 1023262857 7:38375597-38375619 CCTGAGTGCAGAGCATCTTTGCT No data
Right 1023262866 7:38375641-38375663 TGGAGAAGAAGGCTGCTGCGGGG No data
1023262857_1023262869 26 Left 1023262857 7:38375597-38375619 CCTGAGTGCAGAGCATCTTTGCT No data
Right 1023262869 7:38375646-38375668 AAGAAGGCTGCTGCGGGGGTGGG No data
1023262857_1023262865 20 Left 1023262857 7:38375597-38375619 CCTGAGTGCAGAGCATCTTTGCT No data
Right 1023262865 7:38375640-38375662 CTGGAGAAGAAGGCTGCTGCGGG No data
1023262857_1023262860 1 Left 1023262857 7:38375597-38375619 CCTGAGTGCAGAGCATCTTTGCT No data
Right 1023262860 7:38375621-38375643 TGGGTGAGCTTTGACCATCCTGG No data
1023262857_1023262868 25 Left 1023262857 7:38375597-38375619 CCTGAGTGCAGAGCATCTTTGCT No data
Right 1023262868 7:38375645-38375667 GAAGAAGGCTGCTGCGGGGGTGG No data
1023262857_1023262861 10 Left 1023262857 7:38375597-38375619 CCTGAGTGCAGAGCATCTTTGCT No data
Right 1023262861 7:38375630-38375652 TTTGACCATCCTGGAGAAGAAGG No data
1023262857_1023262864 19 Left 1023262857 7:38375597-38375619 CCTGAGTGCAGAGCATCTTTGCT No data
Right 1023262864 7:38375639-38375661 CCTGGAGAAGAAGGCTGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023262857 Original CRISPR AGCAAAGATGCTCTGCACTC AGG (reversed) Intergenic
No off target data available for this crispr