ID: 1023262865

View in Genome Browser
Species Human (GRCh38)
Location 7:38375640-38375662
Sequence CTGGAGAAGAAGGCTGCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023262857_1023262865 20 Left 1023262857 7:38375597-38375619 CCTGAGTGCAGAGCATCTTTGCT No data
Right 1023262865 7:38375640-38375662 CTGGAGAAGAAGGCTGCTGCGGG No data
1023262856_1023262865 28 Left 1023262856 7:38375589-38375611 CCAGTGTTCCTGAGTGCAGAGCA No data
Right 1023262865 7:38375640-38375662 CTGGAGAAGAAGGCTGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023262865 Original CRISPR CTGGAGAAGAAGGCTGCTGC GGG Intergenic
No off target data available for this crispr