ID: 1023263660

View in Genome Browser
Species Human (GRCh38)
Location 7:38382499-38382521
Sequence TTGAAAATGAAGGAGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023263660_1023263665 -5 Left 1023263660 7:38382499-38382521 CCCTCCATCTCCTTCATTTTCAA No data
Right 1023263665 7:38382517-38382539 TTCAATGCATTAGGAATTCTTGG No data
1023263660_1023263666 2 Left 1023263660 7:38382499-38382521 CCCTCCATCTCCTTCATTTTCAA No data
Right 1023263666 7:38382524-38382546 CATTAGGAATTCTTGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023263660 Original CRISPR TTGAAAATGAAGGAGATGGA GGG (reversed) Intergenic
No off target data available for this crispr