ID: 1023264807

View in Genome Browser
Species Human (GRCh38)
Location 7:38393560-38393582
Sequence GGGGCCTGATGGTGAATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023264800_1023264807 0 Left 1023264800 7:38393537-38393559 CCAGTGGTGGGCTCTTGGTAAAA No data
Right 1023264807 7:38393560-38393582 GGGGCCTGATGGTGAATTTGGGG No data
1023264799_1023264807 1 Left 1023264799 7:38393536-38393558 CCCAGTGGTGGGCTCTTGGTAAA 0: 1
1: 0
2: 0
3: 7
4: 111
Right 1023264807 7:38393560-38393582 GGGGCCTGATGGTGAATTTGGGG No data
1023264792_1023264807 18 Left 1023264792 7:38393519-38393541 CCCTTCTCAAAGTGCCACCCAGT 0: 1
1: 0
2: 2
3: 16
4: 199
Right 1023264807 7:38393560-38393582 GGGGCCTGATGGTGAATTTGGGG No data
1023264793_1023264807 17 Left 1023264793 7:38393520-38393542 CCTTCTCAAAGTGCCACCCAGTG No data
Right 1023264807 7:38393560-38393582 GGGGCCTGATGGTGAATTTGGGG No data
1023264791_1023264807 27 Left 1023264791 7:38393510-38393532 CCTTTGTTTCCCTTCTCAAAGTG No data
Right 1023264807 7:38393560-38393582 GGGGCCTGATGGTGAATTTGGGG No data
1023264790_1023264807 28 Left 1023264790 7:38393509-38393531 CCCTTTGTTTCCCTTCTCAAAGT No data
Right 1023264807 7:38393560-38393582 GGGGCCTGATGGTGAATTTGGGG No data
1023264798_1023264807 4 Left 1023264798 7:38393533-38393555 CCACCCAGTGGTGGGCTCTTGGT No data
Right 1023264807 7:38393560-38393582 GGGGCCTGATGGTGAATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023264807 Original CRISPR GGGGCCTGATGGTGAATTTG GGG Intronic