ID: 1023265268

View in Genome Browser
Species Human (GRCh38)
Location 7:38398534-38398556
Sequence TCACTACCCTTCCCAGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4956
Summary {0: 57, 1: 516, 2: 1053, 3: 1544, 4: 1786}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023265268_1023265274 -10 Left 1023265268 7:38398534-38398556 CCAGAGGCTGGGAAGGGTAGTGA 0: 57
1: 516
2: 1053
3: 1544
4: 1786
Right 1023265274 7:38398547-38398569 AGGGTAGTGAGGAAGTAGGGGGG 0: 1
1: 0
2: 1
3: 72
4: 832
1023265268_1023265276 1 Left 1023265268 7:38398534-38398556 CCAGAGGCTGGGAAGGGTAGTGA 0: 57
1: 516
2: 1053
3: 1544
4: 1786
Right 1023265276 7:38398558-38398580 GAAGTAGGGGGGATGGTTAATGG No data
1023265268_1023265275 -6 Left 1023265268 7:38398534-38398556 CCAGAGGCTGGGAAGGGTAGTGA 0: 57
1: 516
2: 1053
3: 1544
4: 1786
Right 1023265275 7:38398551-38398573 TAGTGAGGAAGTAGGGGGGATGG No data
1023265268_1023265277 2 Left 1023265268 7:38398534-38398556 CCAGAGGCTGGGAAGGGTAGTGA 0: 57
1: 516
2: 1053
3: 1544
4: 1786
Right 1023265277 7:38398559-38398581 AAGTAGGGGGGATGGTTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023265268 Original CRISPR TCACTACCCTTCCCAGCCTC TGG (reversed) Intronic
Too many off-targets to display for this crispr