ID: 1023265275

View in Genome Browser
Species Human (GRCh38)
Location 7:38398551-38398573
Sequence TAGTGAGGAAGTAGGGGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023265268_1023265275 -6 Left 1023265268 7:38398534-38398556 CCAGAGGCTGGGAAGGGTAGTGA 0: 57
1: 516
2: 1053
3: 1544
4: 1786
Right 1023265275 7:38398551-38398573 TAGTGAGGAAGTAGGGGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023265275 Original CRISPR TAGTGAGGAAGTAGGGGGGA TGG Intronic
No off target data available for this crispr