ID: 1023265275 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:38398551-38398573 |
Sequence | TAGTGAGGAAGTAGGGGGGA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1023265268_1023265275 | -6 | Left | 1023265268 | 7:38398534-38398556 | CCAGAGGCTGGGAAGGGTAGTGA | 0: 57 1: 516 2: 1053 3: 1544 4: 1786 |
||
Right | 1023265275 | 7:38398551-38398573 | TAGTGAGGAAGTAGGGGGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1023265275 | Original CRISPR | TAGTGAGGAAGTAGGGGGGA TGG | Intronic | ||
No off target data available for this crispr |