ID: 1023266062

View in Genome Browser
Species Human (GRCh38)
Location 7:38407200-38407222
Sequence CTATAGATAGATATAGAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 724
Summary {0: 1, 1: 0, 2: 9, 3: 72, 4: 642}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023266062 Original CRISPR CTATAGATAGATATAGAGAG AGG (reversed) Intronic
900037052 1:422757-422779 ATATATATAGAAAGAGAGAGAGG + Intergenic
900058682 1:658498-658520 ATATATATAGAAAGAGAGAGAGG + Intergenic
900333257 1:2147372-2147394 CAATAGATGGATAGATAGAGAGG - Intronic
901628509 1:10636835-10636857 ATATATAGAGATATATAGAGAGG - Exonic
902306774 1:15546409-15546431 AGATAGATAGATATTGAAAGGGG + Intronic
904953993 1:34267765-34267787 GTATAGATAGATTTAGTGATGGG - Intergenic
905039608 1:34944948-34944970 ATACATATATATATAGAGAGAGG - Intergenic
906332187 1:44895511-44895533 ATATAGAGAGAGAGAGAGAGAGG - Intronic
906879053 1:49569774-49569796 ATACATATGGATATAGAGAGTGG - Intronic
907615028 1:55915075-55915097 CTATATATATATATATATAGTGG - Intergenic
907702135 1:56799144-56799166 TTATAGATAGACTAAGAGAGAGG + Intronic
908661531 1:66441906-66441928 ATATATATATATAGAGAGAGAGG + Intergenic
908694656 1:66825040-66825062 CAAGAGATAGATATAAAGATAGG + Intronic
908834806 1:68218298-68218320 ATATAAATAGATATTGAGAGGGG + Intronic
909257624 1:73444733-73444755 ATATATATATATATAGACAGTGG + Intergenic
909537864 1:76758651-76758673 ATAGAGATAGAGAGAGAGAGAGG - Intergenic
909658882 1:78060823-78060845 ATATAGATAGATAGATAGATAGG + Intronic
909696323 1:78471786-78471808 ATATAGAGAGAGAGAGAGAGAGG - Intronic
909745883 1:79096516-79096538 GGATAGATAGATAGAGATAGGGG - Intergenic
910465758 1:87497577-87497599 CTAGAGACAGAGAAAGAGAGTGG - Intergenic
910581255 1:88827671-88827693 TTATATATAGAGAGAGAGAGAGG - Intronic
911683092 1:100741275-100741297 ATATATATATATATGGAGAGAGG + Intergenic
911701993 1:100964401-100964423 GTATGTATATATATAGAGAGAGG + Intronic
912000625 1:104830231-104830253 ATATAGTGAGATATAGGGAGGGG - Intergenic
912067339 1:105759698-105759720 ATATATATATATAGAGAGAGAGG - Intergenic
912091313 1:106080296-106080318 ATATAGATAAATATATAGACAGG + Intergenic
912566941 1:110594276-110594298 ATATAGAGAGAGAGAGAGAGAGG - Intronic
913138954 1:115921388-115921410 ATATATATAGAGAGAGAGAGAGG - Intergenic
913595842 1:120375858-120375880 ATATATATAGACAGAGAGAGAGG + Intergenic
914091435 1:144503118-144503140 ATATATATAGACAGAGAGAGAGG - Intergenic
914307167 1:146431071-146431093 GTATATATAGACAGAGAGAGAGG + Intergenic
914388538 1:147196530-147196552 CTATATATAGATAGATAAAGAGG + Intronic
914594939 1:149142050-149142072 ATATATATAGACAGAGAGAGAGG - Intergenic
915879155 1:159647399-159647421 CTTTAGATAGATAAAGAAAAGGG - Intergenic
915966136 1:160310259-160310281 CTAGAGATATATATAGAAAAAGG + Intronic
916590693 1:166187199-166187221 ATATAGATAAATATAGATAGTGG - Intergenic
917140911 1:171834733-171834755 ATATAGATTGATATAGAAAGAGG + Intergenic
917254015 1:173095192-173095214 TTAAAGATAGATAAAGAGAATGG - Intergenic
917571115 1:176266447-176266469 AGATAGATAGATAGATAGAGTGG - Intergenic
918156106 1:181848741-181848763 GTATACATGGATATACAGAGTGG + Intergenic
918372246 1:183872314-183872336 ATAAAGTTATATATAGAGAGAGG - Intronic
918828329 1:189356186-189356208 CTAGAAATAGAAATAAAGAGTGG + Intergenic
918846157 1:189616924-189616946 CGATAGATTGATAGAGACAGAGG + Intergenic
918847464 1:189636776-189636798 ATATATATAGAGAGAGAGAGAGG + Intergenic
918869599 1:189951956-189951978 GTATACATGGACATAGAGAGTGG + Intergenic
919022128 1:192119757-192119779 CTATAGTTAAATTGAGAGAGAGG - Intergenic
919572470 1:199266181-199266203 CTATATATAGGTATAGACATAGG + Intergenic
920153380 1:203927984-203928006 CTACATAGAGATATAGACAGCGG + Intergenic
921050478 1:211507715-211507737 ATATATATAGAAATAGAGTGTGG + Intergenic
921298452 1:213726673-213726695 CAATAGATAGATACAGACATAGG - Intergenic
921543555 1:216448368-216448390 ACATAGATAGATACAGATAGTGG + Intergenic
921585860 1:216945525-216945547 AAATAAATAGGTATAGAGAGGGG - Intronic
921658902 1:217775682-217775704 CTATATATATATATATAGATCGG - Intronic
921950888 1:220928628-220928650 GTGTAGATAGAGAGAGAGAGAGG + Intergenic
922401658 1:225264743-225264765 CTAGAGATAGCTGTAGAAAGGGG + Intronic
923525975 1:234773163-234773185 ATATATATATATATAAAGAGTGG + Intergenic
924012320 1:239679047-239679069 AGATAGATAGATATAGACATAGG + Intronic
924466409 1:244302734-244302756 GTATATATATATAGAGAGAGAGG + Intergenic
1063090160 10:2858160-2858182 CTATAGGTAGATACTTAGAGGGG - Intergenic
1063606592 10:7527953-7527975 AGATAGATAGATATGGATAGAGG + Intergenic
1064414745 10:15139247-15139269 AGATAGATAGATAGATAGAGGGG - Intronic
1064997380 10:21308171-21308193 GTACACATGGATATAGAGAGTGG + Intergenic
1065125797 10:22572917-22572939 CTATAGACAGAATTAAAGAGGGG - Intronic
1065457154 10:25918713-25918735 GTATATACACATATAGAGAGAGG - Intergenic
1065751135 10:28888438-28888460 CTATATATATATATATAAAGAGG - Intergenic
1066018308 10:31270372-31270394 AGATAGATAGATATTGAGATGGG - Intergenic
1068344366 10:55754165-55754187 GTATAGATAGATATATACATAGG - Intergenic
1068881174 10:62050366-62050388 AGAGAGATAGCTATAGAGAGAGG - Intronic
1069226003 10:65945162-65945184 ATATATATATATATAGTGAGAGG + Intronic
1070177392 10:73983453-73983475 CTGTACACATATATAGAGAGAGG - Intergenic
1070247353 10:74744815-74744837 ATATATATAGAGAGAGAGAGAGG + Intergenic
1070434488 10:76376376-76376398 GTATAGATAGGTAGATAGAGAGG - Intronic
1070862178 10:79680143-79680165 ATATAGATAGATATATACATAGG + Intergenic
1070874958 10:79794311-79794333 ATATAGATAGATATATACATAGG - Intergenic
1071641882 10:87316478-87316500 ATATAGATAGATATATACATAGG - Intergenic
1071687137 10:87770774-87770796 CTTAGGATAGAAATAGAGAGTGG + Intronic
1071741906 10:88368799-88368821 CTTAAGATAGATATTGAAAGTGG + Intronic
1071925390 10:90402005-90402027 CTACAGATAGAGATAAAGAGAGG + Intergenic
1072147172 10:92651980-92652002 TTTTAAATATATATAGAGAGAGG + Intronic
1072299802 10:94048749-94048771 ATATATATAGAGAGAGAGAGAGG + Intronic
1073038885 10:100585460-100585482 CAATAGATAGACATGGAGAATGG - Intergenic
1073658235 10:105441678-105441700 ATAAAGATAGAGAGAGAGAGGGG - Intergenic
1073927869 10:108538000-108538022 CTATAGATAGATAGATAGTAGGG + Intergenic
1073964464 10:108972729-108972751 CTTTAGAGAGAGAGAGAGAGAGG + Intergenic
1074312583 10:112334837-112334859 TTACAGATAAATATATAGAGAGG - Intergenic
1074336806 10:112584845-112584867 CTATGGAGAGAGATAGTGAGGGG + Intronic
1074716923 10:116228389-116228411 CCATAGCCAGAAATAGAGAGTGG - Intronic
1075115710 10:119625671-119625693 TTATAGAGAGAGAGAGAGAGAGG + Intergenic
1075488112 10:122844022-122844044 ATATATATATATATAGAGAGAGG + Intronic
1076151439 10:128165148-128165170 CTAGAGATAGGGAGAGAGAGAGG + Intergenic
1076963778 11:60679-60701 ATATATATAGAAAGAGAGAGAGG + Intergenic
1077294964 11:1822137-1822159 AGATAGATAGATGCAGAGAGAGG + Intergenic
1077742440 11:4861489-4861511 ATGTATATATATATAGAGAGAGG + Intronic
1077831716 11:5879802-5879824 CTATAGTTAGAAATAGACTGAGG - Intronic
1078008519 11:7551022-7551044 CTATAGATATAGATATAAAGGGG - Intronic
1079514930 11:21256275-21256297 CTAAAGATAGACATAAAGATTGG + Intronic
1080124484 11:28716392-28716414 ATATATGTATATATAGAGAGAGG + Intergenic
1080194490 11:29592957-29592979 CTACACATAGACGTAGAGAGTGG + Intergenic
1080263025 11:30370875-30370897 ATATCTATAGATATAGAGAGAGG - Intergenic
1082271275 11:50171593-50171615 AGATAGATAGATATAGATATAGG - Intergenic
1082901125 11:58253655-58253677 GTACATATGGATATAGAGAGTGG - Intergenic
1083114308 11:60444503-60444525 AGAGAGATATATATAGAGAGAGG - Intronic
1084776094 11:71376816-71376838 TTCAAGATAGATATAGAGATAGG + Intergenic
1084876487 11:72137359-72137381 CTCTAGATAGATCCTGAGAGTGG - Intronic
1085236372 11:75018648-75018670 AAATAGATAGATATACAAAGGGG - Intronic
1086133835 11:83427075-83427097 CGATAGATAGATAGATAGATAGG - Intergenic
1086143088 11:83520721-83520743 AGATAGATAGATAGATAGAGTGG + Intronic
1086787214 11:90983654-90983676 CTATAGATATACATAGACATGGG + Intergenic
1087052715 11:93902827-93902849 CTATAGAGAGAGACAGAGAGTGG + Intergenic
1087206158 11:95397098-95397120 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
1087565899 11:99857009-99857031 ATAGAGATAGATAGAGAGAGAGG - Intronic
1087994989 11:104794543-104794565 CTAGAGAGAGAGAGAGAGAGGGG - Intergenic
1088176940 11:107064117-107064139 TTATATATACATATATAGAGAGG - Intergenic
1088329220 11:108633060-108633082 ATATAGATAGATATAAATATAGG - Intergenic
1088705471 11:112460015-112460037 CTATCTATAGATATATATAGGGG - Intergenic
1088910687 11:114189195-114189217 TTATAGCTAGAAATAGAAAGAGG + Intronic
1089175826 11:116548111-116548133 AAATAGATAGATAGATAGAGAGG - Intergenic
1090146268 11:124326282-124326304 CTCGTGATAGATATAAAGAGAGG + Intergenic
1090511566 11:127380954-127380976 ATATAGAAAGATAGAGAGAGAGG - Intergenic
1091882006 12:3986878-3986900 ATATAGATAGATATAGATGTAGG + Intergenic
1092701574 12:11237180-11237202 GTTTACATAGATGTAGAGAGTGG - Intergenic
1093005046 12:14042469-14042491 CAATTGATAGAGACAGAGAGTGG + Intergenic
1093238007 12:16635910-16635932 TTATATATAGACATATAGAGAGG - Intergenic
1093482804 12:19622704-19622726 CAATAGTTAAATATAGAGAATGG - Intronic
1093879767 12:24390609-24390631 GTATACATGGACATAGAGAGGGG - Intergenic
1094141913 12:27190072-27190094 CTCTACATACATATAGAGAAAGG - Intergenic
1094440045 12:30465198-30465220 AGATAGATAGATATAGATATAGG + Intergenic
1094461578 12:30702149-30702171 ATATATATAAATTTAGAGAGAGG + Intergenic
1095249859 12:39966131-39966153 ATATATATAGAGAGAGAGAGAGG + Intronic
1095580917 12:43796788-43796810 GTACAGATATATATAGAGATGGG + Intronic
1096297313 12:50394597-50394619 CTATAGAGAGAGAGAGACAGAGG + Intronic
1097032503 12:56099826-56099848 CTATCGATATAGAGAGAGAGTGG + Exonic
1097135881 12:56854804-56854826 ATATATATAGAGAGAGAGAGAGG - Intergenic
1097212330 12:57381776-57381798 ATATACATACATATAGAGAGAGG + Intronic
1097551812 12:61081223-61081245 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
1097671609 12:62546250-62546272 CTCTAGATATATTTGGAGAGAGG - Intronic
1098015636 12:66101318-66101340 ATATATATAGAGAGAGAGAGAGG + Intergenic
1098664385 12:73142676-73142698 ATATAGATAGATAGATAGATAGG - Intergenic
1098752506 12:74312795-74312817 CTATATATGAATATACAGAGTGG - Intergenic
1099146451 12:79051411-79051433 CTATATATGTATAAAGAGAGAGG + Intronic
1099896591 12:88655371-88655393 ATATATATAAATATATAGAGAGG - Intergenic
1099900292 12:88699324-88699346 GTATATATAGAGAGAGAGAGAGG - Intergenic
1100162499 12:91876469-91876491 CTATTAAGAGAAATAGAGAGAGG - Intergenic
1100523763 12:95401004-95401026 TCATAGATAGATATGGAGATAGG - Intergenic
1100569533 12:95834469-95834491 ATATATATAGAGAGAGAGAGAGG + Intergenic
1100840974 12:98611500-98611522 CTGTAGATAGAGATGGAGACAGG - Intergenic
1101169789 12:102079029-102079051 CTTTACAGAGATGTAGAGAGTGG - Intronic
1101244041 12:102867836-102867858 ATATACATAGAGAGAGAGAGGGG - Intronic
1101264487 12:103068868-103068890 CTATATATATATATAGAGAGAGG - Intergenic
1101557953 12:105828691-105828713 GTACACATAGACATAGAGAGTGG - Intergenic
1102242072 12:111330739-111330761 ATATATATATATAAAGAGAGAGG + Intronic
1102582065 12:113895982-113896004 CTATAGATATATATGTAGAGAGG + Intronic
1102639605 12:114355480-114355502 CTAGAGAAAGAGAGAGAGAGAGG - Exonic
1102671957 12:114627454-114627476 ATATAGATAGATATAGATCTAGG - Intergenic
1102671967 12:114627568-114627590 ATATAGATAGATATAGCTATAGG - Intergenic
1102671981 12:114627736-114627758 ATATAGATAGATATAGCTATAGG - Intergenic
1102671987 12:114627826-114627848 ATATAGATAGATATAGGTATAGG - Intergenic
1102869789 12:116404932-116404954 CCATAGATAGATATACTGATTGG + Intergenic
1103231839 12:119337934-119337956 CCATAGAGAGATGTAGAGAGTGG + Intronic
1104313591 12:127676593-127676615 GTATAGATGGATATAAATAGAGG + Intergenic
1104485129 12:129144652-129144674 CAATAGATAGGTCAAGAGAGAGG - Intronic
1104795323 12:131513067-131513089 ATATAGATAGATAGATAAAGGGG - Intergenic
1105883842 13:24625868-24625890 CAAGAGATAGAGAAAGAGAGAGG + Intergenic
1106361117 13:29031367-29031389 ATATAGATGTATATATAGAGAGG + Intronic
1107374790 13:39791165-39791187 CTAGATATACATATAGAAAGTGG - Intronic
1107605998 13:42057806-42057828 CTATAGAGAGAAATAGAGCATGG + Intronic
1107629778 13:42331655-42331677 ATATATATAGAGAGAGAGAGAGG + Intergenic
1108753962 13:53477613-53477635 GGACAGATAGATATAGAAAGGGG + Intergenic
1108785979 13:53901839-53901861 ATAAAGATAAATATAGAGATAGG - Intergenic
1109007437 13:56896604-56896626 ATATGTATATATATAGAGAGAGG - Intergenic
1109414422 13:62019217-62019239 ATATATATATATAGAGAGAGAGG - Intergenic
1109516222 13:63445152-63445174 ATGTATATATATATAGAGAGAGG + Intergenic
1109609884 13:64750900-64750922 CCCTAAATATATATAGAGAGAGG + Intergenic
1111275528 13:85940591-85940613 CTAGAGAGAGAGAGAGAGAGAGG - Intergenic
1111340392 13:86878130-86878152 ATATATATAGAAAGAGAGAGAGG - Intergenic
1111503651 13:89158549-89158571 CTAAAAATAGAGAAAGAGAGAGG - Intergenic
1111633995 13:90879992-90880014 ATATATATATATAGAGAGAGAGG + Intergenic
1112093642 13:96108952-96108974 ATAGAGATAGAGATAGAGATAGG - Intronic
1112241990 13:97691324-97691346 CTGGAGATAGATAGACAGAGGGG + Intergenic
1112856119 13:103771610-103771632 CAATAGAAAGACAAAGAGAGAGG - Intergenic
1112873867 13:104011335-104011357 CTATAGATAGATAGGGACATAGG + Intergenic
1112958306 13:105089081-105089103 ATATATATAGAGAGAGAGAGAGG - Intergenic
1113274264 13:108711064-108711086 CTATATATATATAGAGAGAAAGG + Intronic
1115125422 14:29987268-29987290 TTAGAGAAAGATATAAAGAGGGG + Intronic
1115305961 14:31933678-31933700 CTATAGATATATATACACAATGG - Intergenic
1115331109 14:32199565-32199587 ATTTATATATATATAGAGAGAGG + Intergenic
1115683063 14:35763790-35763812 ATATAGAGAGAGAGAGAGAGAGG + Intronic
1116260512 14:42618960-42618982 ATAGAGATAGAGAGAGAGAGAGG + Intergenic
1116530117 14:45960968-45960990 GTGTACATAGATATATAGAGAGG + Intergenic
1116598341 14:46883881-46883903 GTTTAGATACATATAGAAAGAGG - Intronic
1116706001 14:48301861-48301883 AGATATATAGATATAGAGAGAGG + Intergenic
1117250217 14:53929370-53929392 ATAGATATAGATATAGAGAGAGG + Intergenic
1118045373 14:61964519-61964541 CTATAGATAAACAAAGAAAGTGG + Intergenic
1118447699 14:65866834-65866856 CCATAGACAGAAATAGTGAGAGG - Intergenic
1118807248 14:69249056-69249078 ATATATATATATAGAGAGAGAGG - Intergenic
1119820412 14:77610896-77610918 ATATATATATATAAAGAGAGAGG - Intronic
1120090925 14:80332733-80332755 CTTTATATATATATGGAGAGTGG - Intronic
1120106393 14:80500400-80500422 CTGTATAGAGATATAGGGAGTGG - Intronic
1120895777 14:89530579-89530601 ATATATATACATATGGAGAGAGG - Intronic
1121974415 14:98389678-98389700 GTATATATAGAAAGAGAGAGTGG - Intergenic
1122014328 14:98781071-98781093 AGATAGATAGATATAAAAAGGGG - Intergenic
1123214997 14:106800566-106800588 ATATATATGGATAAAGAGAGAGG - Intergenic
1123483943 15:20666826-20666848 ATATAGATAGACAGATAGAGTGG + Intergenic
1124269820 15:28270184-28270206 CTATAAATAAATAAAAAGAGTGG - Intronic
1124269822 15:28270226-28270248 CTATAAATAAATAAAAAGAGTGG - Intronic
1125014847 15:34922179-34922201 CTACAGATAAATATACAGTGTGG - Intronic
1126512134 15:49489739-49489761 CTATAGATATATATAGAACAGGG - Intronic
1126587635 15:50305273-50305295 AGATAGATAGATAGAGAGATAGG - Intronic
1126609694 15:50516759-50516781 ATATATATATATATACAGAGTGG + Intronic
1126847427 15:52773906-52773928 CAACATATAGATAGAGAGAGAGG - Intronic
1127092962 15:55484641-55484663 GTATAGATAGATATATATAAAGG + Intronic
1129095295 15:73200520-73200542 CTCTAGAGAGAGAGAGAGAGAGG + Intronic
1129916377 15:79276573-79276595 AGATAGATAGATATAGATAGGGG + Intergenic
1130272110 15:82457330-82457352 ATATAGATAGATATATAAAGGGG - Intergenic
1130355134 15:83122405-83122427 AGATAGATAGATATAGATATAGG + Intronic
1130464462 15:84184719-84184741 ATATAGATAGATATATAAAGGGG - Intergenic
1130488225 15:84410103-84410125 ATATAGATAGATATATAAAGGGG + Intergenic
1130499805 15:84488818-84488840 ATATAGATAGATATATAAAGGGG + Intergenic
1130586754 15:85189352-85189374 ATATAGATAGATATATAAAGGGG - Intergenic
1130773913 15:86956289-86956311 ATATAGATAGATATAGATATAGG + Intronic
1130917268 15:88315024-88315046 CTTTAGATAGATATATAAACTGG + Intergenic
1131342507 15:91615831-91615853 TAATAAATAGATATAGACAGAGG + Intergenic
1131866058 15:96711205-96711227 GTCTAGATAGCTATAGGGAGGGG + Intergenic
1131875190 15:96798537-96798559 CTATAGATAGGAGAAGAGAGGGG - Intergenic
1131961020 15:97790469-97790491 GGATAGATAGATATAGATGGTGG - Intergenic
1131998503 15:98156750-98156772 TTATAGATAGATAGATAGATGGG + Intergenic
1132444777 15:101904496-101904518 ATATATATAGAAAGAGAGAGAGG - Intergenic
1133343915 16:5057531-5057553 ATATGTATATATATAGAGAGCGG + Intronic
1133554423 16:6891464-6891486 CTAGAGAGAGAGAGAGAGAGAGG + Intronic
1134176801 16:12013529-12013551 ATATATATATATATCGAGAGAGG + Intronic
1134347231 16:13402129-13402151 ATATACATAGATATAGAAAAGGG + Intergenic
1135012643 16:18895716-18895738 ATATAGATATATATAGAGAGGGG - Intronic
1135319557 16:21483278-21483300 ATATAGATATATGTAGAGAGGGG - Intergenic
1135372394 16:21914767-21914789 ATATAGATATATGTAGAGAGGGG - Intergenic
1135439392 16:22455937-22455959 ATATAGATATATGTAGAGAGGGG + Intergenic
1136329790 16:29564997-29565019 ATATAGATATATATATAGAGGGG - Intergenic
1136444418 16:30304701-30304723 ATATAGATATATATATAGAGGGG - Intergenic
1136531621 16:30873918-30873940 ATATATATGTATATAGAGAGAGG - Intronic
1137842759 16:51654976-51654998 ATATATATACATATAGAGAGAGG - Intergenic
1138102074 16:54260337-54260359 ATATAGAGAGAGAGAGAGAGAGG + Intronic
1138139586 16:54556882-54556904 CTTTAGATATATTTAGAGACAGG + Intergenic
1138405950 16:56794052-56794074 CTCTAGATAGATAGATAGATAGG + Intronic
1138684770 16:58715538-58715560 ATATAGATAGATAGATAGATTGG - Intronic
1138773975 16:59698103-59698125 CTATAGCTGGAAATAGAGGGAGG - Intergenic
1138810544 16:60144902-60144924 ATATATATATATATAGACAGTGG - Intergenic
1138920329 16:61520405-61520427 CTATATATAGATATATAGATAGG + Intergenic
1139216397 16:65127876-65127898 ATATAGAGAGAAAGAGAGAGAGG - Intergenic
1139699938 16:68702039-68702061 CTATAGATATATCTATAGATAGG + Intronic
1140335002 16:74096680-74096702 CTACAAATATATATATAGAGAGG - Intergenic
1142272838 16:89099786-89099808 AGATAGATAGATAGACAGAGCGG + Intronic
1142923082 17:3208173-3208195 ATATATATAGAGAGAGAGAGAGG + Intergenic
1143347960 17:6263865-6263887 TTAGAGATAGATATAGAAATAGG + Intergenic
1144060396 17:11578987-11579009 AAATATATATATATAGAGAGAGG - Intergenic
1144072474 17:11687109-11687131 CTCTACATATATATAGAGAGAGG - Intronic
1146081982 17:29788655-29788677 AGATAGATATATATAGAGAGAGG - Intronic
1146512777 17:33464670-33464692 ATATAGAGAGAGAGAGAGAGAGG - Intronic
1146532878 17:33625122-33625144 AGATAGATAGATAGACAGAGAGG - Intronic
1146836062 17:36111776-36111798 ATATATATAGAGAGAGAGAGGGG - Intergenic
1147351545 17:39851059-39851081 ATATATATATATAGAGAGAGAGG + Intronic
1147916966 17:43893869-43893891 GTATAGATATAGATAGAGATAGG - Intronic
1149141635 17:53438667-53438689 CTATAGGTAAATAAAGAGGGTGG - Intergenic
1149420235 17:56503515-56503537 ATATATATATATATAGACAGTGG + Intronic
1149702921 17:58670320-58670342 CTATAGATAGATGGATAGATAGG - Intronic
1150529649 17:65963653-65963675 ATAGATATAGATATAGATAGGGG + Intronic
1150918967 17:69463603-69463625 ATATATATAGAGAGAGAGAGAGG - Intronic
1150936436 17:69640848-69640870 CTATAGATATAGATAGATACAGG - Intergenic
1150936437 17:69640855-69640877 CTATCTATATCTATAGAGAGAGG + Intergenic
1151006646 17:70445370-70445392 CTATTGATACATATAAAAAGAGG + Intergenic
1151033396 17:70769802-70769824 ATATATATAGAGAGAGAGAGAGG + Intergenic
1151133186 17:71919664-71919686 ATAGAGATAGATAGAGATAGAGG + Intergenic
1151244215 17:72781965-72781987 GTATATGTATATATAGAGAGAGG - Intronic
1153236877 18:2996775-2996797 CAATAGATAGATAAAGATATTGG - Intronic
1153538078 18:6124382-6124404 CTATATATAGACATATATAGGGG + Intronic
1154068811 18:11133863-11133885 GTATATATATATAGAGAGAGAGG - Intronic
1154944456 18:21148027-21148049 AGATAGATAGAGATAGAGAGAGG - Intergenic
1155176323 18:23304550-23304572 TTATATATAGAAAGAGAGAGAGG + Intronic
1155318088 18:24592054-24592076 GGATAGATAGATATATAAAGTGG - Intergenic
1155538419 18:26841599-26841621 CTAGAGAGAGAGAGAGAGAGAGG + Intergenic
1156437919 18:37153523-37153545 CTATATATAGGTATATATAGAGG - Intronic
1156447089 18:37245140-37245162 TTATAAATATATATAGAGAGAGG + Exonic
1156586936 18:38441625-38441647 GTATATATATATATAGAGAGAGG + Intergenic
1156687456 18:39667206-39667228 AGATAGATAGATAAAGATAGAGG + Intergenic
1157636966 18:49168216-49168238 ATATATATATATAGAGAGAGAGG - Intronic
1158269231 18:55694965-55694987 AGATAGATAGAGAGAGAGAGAGG - Intergenic
1158657562 18:59352922-59352944 CTATAGATAGATAGATAGATAGG - Intronic
1159054943 18:63454059-63454081 CTATAGAGGGATATTGACAGTGG + Intergenic
1159120570 18:64164518-64164540 ATATATATAGAGAGAGAGAGAGG - Intergenic
1159153165 18:64546557-64546579 ATATAGATAGATATATATATAGG - Intergenic
1159208390 18:65283279-65283301 CTATAGATAGATAGATAGGTAGG + Intergenic
1159365320 18:67458503-67458525 ATATATATAGAGAGAGAGAGAGG - Intergenic
1159377097 18:67606086-67606108 ATATAGAGAGAGAGAGAGAGAGG - Intergenic
1159564264 18:70031385-70031407 GTTTAGATAGAAATGGAGAGAGG - Intronic
1160116998 18:76088387-76088409 ATATATATAGAAAGAGAGAGAGG + Intergenic
1160305360 18:77729089-77729111 GTATAGATAGACATAGAGATAGG - Intergenic
1160640581 19:130310-130332 ATATATATAGAAAGAGAGAGAGG + Intergenic
1161224029 19:3134395-3134417 ATATATATACATAGAGAGAGAGG + Intergenic
1162441726 19:10696429-10696451 ACATACATACATATAGAGAGAGG - Intergenic
1163016784 19:14460949-14460971 GGATAGATAGAGATAGAGAGAGG - Intronic
1163016816 19:14461343-14461365 TTACAGATAGAGAAAGAGAGAGG - Intronic
1163090366 19:15015221-15015243 ATATAGATAGAAACAGAGACAGG + Intronic
1163177017 19:15571531-15571553 CTAGAGAAAGACACAGAGAGAGG + Intergenic
1164483691 19:28636666-28636688 TTGTAGATAGAGATTGAGAGGGG + Intergenic
1164623384 19:29711014-29711036 CTAGATAGAGATATACAGAGAGG + Intronic
1164847047 19:31441384-31441406 CTCTAGATAGATACATAGACAGG - Intergenic
1166027273 19:40098681-40098703 ATATAGAAAGAGAGAGAGAGGGG + Intergenic
1166573614 19:43816029-43816051 AGATAGATAGATAGATAGAGTGG - Intronic
1166623623 19:44328913-44328935 CTATACACAGATATAGAGTATGG - Exonic
1166935976 19:46333001-46333023 ACATATATATATATAGAGAGAGG - Intronic
1168564128 19:57408914-57408936 ATATATATATATATGGAGAGAGG - Intronic
925583006 2:5433196-5433218 ATATATATAGAGAGAGAGAGAGG + Intergenic
926536837 2:14123440-14123462 CTCTATAGAGATATAGAGACTGG - Intergenic
927126253 2:20014288-20014310 ATACACATACATATAGAGAGAGG + Intergenic
927513729 2:23660030-23660052 CTAAAGATAGGTCTAGATAGGGG - Intronic
927624121 2:24695279-24695301 CTATATATATATAGAGAGAGAGG + Intronic
928504263 2:31933369-31933391 ATATATATATATATAGAAAGGGG + Intronic
928889172 2:36182112-36182134 CTATATATAGATATATATATAGG + Intergenic
928889175 2:36182148-36182170 CTATATATAGATATATATATAGG + Intergenic
928889178 2:36182184-36182206 CTATATATAGATATATATATAGG + Intergenic
928889181 2:36182220-36182242 CTATATATAGATATATATATAGG + Intergenic
928889184 2:36182256-36182278 CTATATATAGATATATATATAGG + Intergenic
929093870 2:38245821-38245843 CTAGAGATAGATAGAGGTAGAGG - Intergenic
929093872 2:38245855-38245877 CTAGAGATAGATAGAGGTAGAGG - Intergenic
929212399 2:39371802-39371824 ATATATATATATAGAGAGAGAGG - Intronic
930141423 2:47954671-47954693 TTATAGGTACATATAGAGACTGG + Intergenic
930156981 2:48115687-48115709 ATATAGATATATATATAAAGGGG - Intergenic
930245244 2:48977186-48977208 CTAAAGATAGGCTTAGAGAGAGG + Intronic
930437727 2:51366815-51366837 ATATAGATAGATATAGAGATAGG - Intergenic
930661910 2:54063316-54063338 ATATAGATACATATAGAGTTAGG + Intronic
930957645 2:57222559-57222581 CTATATATAGATATATATACTGG - Intergenic
932687176 2:73881567-73881589 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
933004894 2:76979562-76979584 CTATATATATATATAGAGAGAGG + Intronic
933048326 2:77568088-77568110 ATATAAATATATATAAAGAGAGG + Intronic
933679047 2:85082530-85082552 ATATAAATAGAAATAGAAAGGGG - Intergenic
934083728 2:88491683-88491705 ATATATATAGAGAGAGAGAGAGG - Intergenic
934600834 2:95656911-95656933 CTATACATGGAGAGAGAGAGAGG - Intergenic
934692668 2:96373637-96373659 CTATACATTGATATAAAGAATGG - Exonic
935489781 2:103703685-103703707 ATGTATATATATATAGAGAGAGG + Intergenic
936523617 2:113227994-113228016 CTATAGATAAACAGAGAGATTGG - Intronic
936588943 2:113784276-113784298 CTATAGATAGATAGATAGATAGG - Intergenic
937616571 2:123929862-123929884 ATACACATGGATATAGAGAGTGG - Intergenic
937759695 2:125586196-125586218 ATATATATAGAGAGAGAGAGAGG - Intergenic
937803722 2:126112360-126112382 ATTTAGATAAATATAGAGAAAGG + Intergenic
938047339 2:128133864-128133886 CTTTAGAGAGAGAGAGAGAGAGG + Intronic
938873468 2:135507337-135507359 CTATAGGGAGAGATAGAGAATGG + Intronic
938881099 2:135589903-135589925 ATATACATAGATATAAAAAGGGG + Intronic
939098061 2:137858802-137858824 GTTTATATAGACATAGAGAGTGG - Intergenic
939105510 2:137944183-137944205 ATATAGATAGATAAATAGAATGG - Intergenic
939297364 2:140285207-140285229 CTATGGATAGAGATATAGATAGG + Intronic
939333609 2:140796044-140796066 AGATAGATAGATATAGAGCAGGG - Intronic
939516195 2:143171366-143171388 CTCTAAATGGATATAGAAAGAGG - Intronic
939970248 2:148650270-148650292 ATATAGATAGATATTGGGGGAGG - Intronic
940171746 2:150836052-150836074 GGATAGATAGATATAAAAAGAGG + Intergenic
940500934 2:154493083-154493105 CTATATTCAGATGTAGAGAGAGG + Intergenic
941254055 2:163205715-163205737 CTATAGACAGAGAGAGAGAATGG - Intergenic
941511330 2:166414716-166414738 CTATATATATATATATATAGTGG - Intronic
941713326 2:168737966-168737988 CTGTACATATATATAGAGAGAGG + Intronic
941714780 2:168752317-168752339 GTATAGAGAGAGAGAGAGAGAGG + Intronic
941834338 2:169999741-169999763 CTATTTATAGATTTAGAGGGAGG + Intronic
943097208 2:183443829-183443851 CTATAGAAAGTTTTAGAAAGTGG - Intergenic
943227543 2:185198091-185198113 GTATAGATATATATAGAGAGAGG + Intergenic
943261682 2:185672661-185672683 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
943749030 2:191492018-191492040 ATATAGAGAGAGAGAGAGAGAGG - Intergenic
943965917 2:194332188-194332210 ATATATATAGAGAGAGAGAGAGG - Intergenic
944374436 2:199025441-199025463 CTCTAGACAGACATAGGGAGAGG + Intergenic
945130336 2:206564216-206564238 CGATATATCGATAGAGAGAGAGG + Intronic
945195779 2:207236539-207236561 CTAGAGAATGAAATAGAGAGAGG + Intergenic
945279147 2:208018882-208018904 TTATATGTAGATATAGAGTGGGG - Intronic
945793570 2:214334246-214334268 CTATAGATAGATCCTGAGGGGGG + Intronic
945834176 2:214819859-214819881 ATATAGGTAGATATAGATATAGG + Intergenic
946949794 2:224861220-224861242 CTATAGAAAGAGATAGAAAAGGG + Intronic
947977632 2:234380656-234380678 ATATATATATATAGAGAGAGAGG - Intergenic
948322780 2:237084111-237084133 ATATATATAGAGAGAGAGAGAGG + Intergenic
948441754 2:237996012-237996034 CTATAGATAAATGTAGTGAAGGG + Intronic
1169597739 20:7220139-7220161 ATATTGCTAGATATAGAGACTGG + Intergenic
1170501923 20:16982803-16982825 CTATAGAAAGAAACAGAGAAAGG - Intergenic
1170760599 20:19246784-19246806 ATAGAGATAGAGATAGAGAAAGG - Intronic
1170762333 20:19262101-19262123 CTATACACAGAAAGAGAGAGAGG + Intronic
1171318124 20:24213863-24213885 ATATAGATATAGATAGAGAATGG + Intergenic
1172345251 20:34193083-34193105 ATACAGATAGATAAAGAGAGGGG - Intergenic
1172459964 20:35110200-35110222 ATATACATATATATAGAGATAGG + Intergenic
1172594213 20:36138835-36138857 CTATAGACAGGTGGAGAGAGAGG - Intronic
1172869052 20:38123637-38123659 ATATATATAGAGAGAGAGAGAGG - Intronic
1172890686 20:38261560-38261582 GTATATATATATATAGAGAGAGG - Intronic
1173253877 20:41379233-41379255 GTATATGTATATATAGAGAGAGG - Intergenic
1173343334 20:42175026-42175048 CTATGGATAGGGAAAGAGAGGGG - Intronic
1174091796 20:48054859-48054881 ATATAGATTGAAATATAGAGGGG - Intergenic
1175568684 20:60001562-60001584 CTATAGATGGAAATAGAGTCGGG - Intronic
1176686997 21:9858138-9858160 ATATATATATATATGGAGAGAGG + Intergenic
1177286582 21:19059254-19059276 CAATAGACAGATATGGGGAGGGG - Intergenic
1177426457 21:20928847-20928869 TTATAAATAGAGATAGAGAGAGG + Intergenic
1177465891 21:21479721-21479743 ATATATATATATAGAGAGAGAGG - Intronic
1177957241 21:27613978-27614000 CTACACATAGATATAAAGATGGG - Intergenic
1178027082 21:28480080-28480102 ATATAGAGAGAGAGAGAGAGGGG - Intergenic
1178390533 21:32194357-32194379 AGATAGATAGATATAGATATAGG + Intergenic
1178430068 21:32511044-32511066 ATATAGATAGAGAGAGAGAGAGG - Intronic
1178463538 21:32825579-32825601 CTATATATAGATGTAAAGAAAGG + Intergenic
1178536669 21:33415543-33415565 ATATAAATACATATAGAAAGAGG + Intronic
1178604811 21:34026504-34026526 AGATAGATAGATATCGATAGAGG - Intergenic
1178728005 21:35072233-35072255 TTATTCATATATATAGAGAGGGG - Intronic
1179107305 21:38413893-38413915 CCAAAGATACATATGGAGAGAGG - Intronic
1179253128 21:39690844-39690866 CTATACATGGATAGGGAGAGGGG - Intergenic
1179363455 21:40733935-40733957 TAACAGAAAGATATAGAGAGGGG - Intronic
1180289671 22:10835534-10835556 ATATATATAGAGAGAGAGAGAGG + Intergenic
1181411512 22:22724751-22724773 ATATAGATATAGATAGATAGGGG + Intergenic
1181418451 22:22778425-22778447 ATATAGATATAGATAGATAGGGG + Intronic
1182262735 22:29086753-29086775 AAAAAGATATATATAGAGAGAGG - Intronic
1182341892 22:29629524-29629546 TTATAGATAAACATTGAGAGGGG + Intronic
1182792279 22:32963005-32963027 ATATACATTTATATAGAGAGAGG + Intronic
1182987063 22:34729992-34730014 CAATAGAGAGAGAGAGAGAGAGG + Intergenic
1183180506 22:36256991-36257013 CTATACACAGAAATAGAGATGGG - Intronic
1184380329 22:44141261-44141283 CGATAGATAGATATATATAAAGG + Intronic
1184959156 22:47916551-47916573 ATATAGATAGATATATAAAGGGG + Intergenic
1185151469 22:49166057-49166079 ATATATATATATAGAGAGAGAGG - Intergenic
949364157 3:3262387-3262409 CTTTAGAAAGATACAGAAAGAGG - Intergenic
949413378 3:3789535-3789557 ATATATATAGAGAGAGAGAGAGG + Intronic
949797436 3:7866158-7866180 CTATATATAGATATACATAATGG + Intergenic
951081634 3:18456780-18456802 CAATACATAGATATGCAGAGAGG - Intergenic
951156986 3:19367377-19367399 ATATAGAGAGAGAGAGAGAGTGG - Intronic
951756042 3:26092355-26092377 ATATAGAGAGACAGAGAGAGAGG + Intergenic
953628069 3:44587257-44587279 CTATTGAGAGAGAGAGAGAGAGG - Intronic
953710772 3:45268501-45268523 GGATAGATAGATATAGATATAGG - Intergenic
954240079 3:49286813-49286835 AGATAGATAGATAGATAGAGTGG - Intronic
954349968 3:50035069-50035091 AGATAGACAGATAAAGAGAGGGG - Intronic
955592583 3:60553513-60553535 ATATATATAGAGAGAGAGAGAGG + Intronic
955706678 3:61734845-61734867 ATATAAATAGATATTGAGAGGGG + Intronic
955931817 3:64065084-64065106 AAATAGATAGATAGAGAGATGGG + Intergenic
956072454 3:65468071-65468093 CTATACATATATATAAAAAGAGG - Intronic
956271674 3:67454510-67454532 CTATAGAGATAGATATAGAGAGG - Intronic
956307207 3:67838379-67838401 ATATAGATATATATAAAAAGGGG - Intergenic
956715298 3:72074348-72074370 ATATATATATATAGAGAGAGAGG + Intergenic
956715325 3:72074759-72074781 ATATATATATATAGAGAGAGAGG + Intergenic
957199199 3:77110693-77110715 ATATAGAGAGAGAGAGAGAGAGG + Intronic
957257347 3:77855619-77855641 GTAGAGATAGAGATAGAGATAGG - Intergenic
957503548 3:81090226-81090248 CTCTAGAGAGAGAGAGAGAGAGG - Intergenic
957836500 3:85598786-85598808 ATATAGATAAATATAGAGAATGG - Intronic
958572022 3:95897348-95897370 CTATACATAGATATGTACAGTGG - Intergenic
959768556 3:110064281-110064303 ATAGAGATAGAGAAAGAGAGAGG - Intergenic
960414958 3:117373280-117373302 GTACACATAGATACAGAGAGTGG - Intergenic
960649869 3:119935318-119935340 ATATAGTAAGATAAAGAGAGAGG + Intronic
960850704 3:122050710-122050732 GTAAAGATAGATATATAGACAGG - Intergenic
963202226 3:142597452-142597474 ATATATATATATAGAGAGAGAGG + Intronic
963206172 3:142637859-142637881 ATATATATAGAGAGAGAGAGGGG - Intronic
963495624 3:146056845-146056867 ATATATATAGAGAGAGAGAGAGG + Intergenic
964281682 3:155073785-155073807 CTATAGATAGATAGACAGATAGG - Intronic
964961421 3:162432552-162432574 TTATATATAGAAAGAGAGAGGGG - Intergenic
965129114 3:164671517-164671539 CTATCTATACATAGAGAGAGAGG - Intergenic
965306482 3:167070327-167070349 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
965377169 3:167939683-167939705 AGATAGATAGATAGATAGAGAGG + Intergenic
965564065 3:170092631-170092653 CTGTAGATTGTTATAAAGAGAGG - Exonic
965879144 3:173367475-173367497 ATATATATATATAGAGAGAGAGG + Intergenic
965879149 3:173367671-173367693 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
965883574 3:173415897-173415919 ATATATATAGAGAGAGAGAGAGG + Intronic
966173857 3:177114191-177114213 GTATGTATACATATAGAGAGAGG - Intronic
966367007 3:179199950-179199972 CTATACAAAGATATAGACACAGG - Intronic
966448225 3:180027485-180027507 GTATATATACATAGAGAGAGAGG - Intronic
966606836 3:181829754-181829776 ATATATATAGAGAGAGAGAGAGG + Intergenic
967002335 3:185348214-185348236 CTATAAGTAAATATAAAGAGAGG - Intronic
967060168 3:185865194-185865216 ATATAGATATATATAGAGAGAGG + Intergenic
968357280 3:198119265-198119287 ATATAGAGAGATATAGAAATTGG + Intergenic
969293082 4:6252958-6252980 CTATAAATAGAGATGGAAAGAGG - Intergenic
969964081 4:10976255-10976277 GTATACATAGATATAGATAGTGG + Intergenic
970174111 4:13321114-13321136 ATATATATATATATAGAGAGAGG - Intergenic
970360596 4:15305163-15305185 CTAATGATAGAAATAGAGATTGG - Intergenic
970520075 4:16874320-16874342 TTATAGATAAATATAGACACGGG - Intronic
970896720 4:21112016-21112038 AGATAGATAGATACAGAGAAAGG - Intronic
970928056 4:21476225-21476247 CAATAGATAGATAGATAGACAGG - Intronic
971687042 4:29784342-29784364 GTATAGATATATAAAGAAAGGGG + Intergenic
971702570 4:29997583-29997605 CTGTAGATAGATGGAGAGAAAGG - Intergenic
972830763 4:42811250-42811272 CTATAGAGAAATCTAGTGAGGGG + Intergenic
973655725 4:53045691-53045713 GCATAGATAGATAGATAGAGTGG + Intronic
974206972 4:58717415-58717437 ATATATATAGAGAGAGAGAGAGG + Intergenic
974358585 4:60845277-60845299 ATATATGTATATATAGAGAGAGG - Intergenic
974517186 4:62932498-62932520 CCAGAGAAAAATATAGAGAGAGG + Intergenic
974572535 4:63671855-63671877 ATATAGATAGACATAGATACAGG + Intergenic
974616905 4:64299171-64299193 CTAAAGATATGTAGAGAGAGAGG + Intronic
974620170 4:64344262-64344284 TTATAGATAGATATAGACATAGG - Intronic
974763228 4:66306590-66306612 GTATAGATAGCTCTAGAGATTGG - Intergenic
975010937 4:69350361-69350383 ATATAGATAGATATATATATAGG - Intronic
975160350 4:71117750-71117772 CTATATATATGTAGAGAGAGAGG - Intergenic
975546625 4:75567266-75567288 ACATAGATAGATATATAGATAGG + Intergenic
975856575 4:78631065-78631087 CTATATATAGATATATAGATAGG - Intergenic
975894965 4:79078291-79078313 TTAAAGATATATACAGAGAGAGG + Intergenic
975928279 4:79486632-79486654 ACATAGATAGATAGAGAGATGGG - Intergenic
976002707 4:80390478-80390500 ATATATATAGAGAGAGAGAGAGG - Intronic
976228259 4:82813886-82813908 CAATATATAGATATTGTGAGAGG + Intergenic
976521266 4:86030330-86030352 TTACATATATATATAGAGAGAGG + Intronic
977123030 4:93128345-93128367 CTAGAGAGAGAAAAAGAGAGAGG + Intronic
977349866 4:95869398-95869420 CTATATATAGAGAGAGAGAGAGG - Intergenic
977531112 4:98201277-98201299 CTATATATATATATAGACAATGG + Intergenic
977754105 4:100645489-100645511 ATATATATAGATATAGATATAGG + Intronic
977832884 4:101615100-101615122 GAATAGATATATATATAGAGGGG + Intronic
977872974 4:102115213-102115235 CTGAAGATAGATATCGAGACTGG - Intergenic
978533794 4:109739917-109739939 CTGTGGATAGGTTTAGAGAGAGG + Intergenic
979584105 4:122394601-122394623 CAATAGTTAGATATAGTGTGTGG + Intronic
979760792 4:124401263-124401285 GTACACATGGATATAGAGAGTGG - Intergenic
979813479 4:125068350-125068372 ATATAGATAGATAGATAGATAGG - Intergenic
979830958 4:125302321-125302343 ATATATATATATAGAGAGAGAGG - Intergenic
980736425 4:136895463-136895485 ATATAGAGAGAGAGAGAGAGAGG - Intergenic
982117683 4:152111519-152111541 ATATATATAGAGAGAGAGAGAGG - Intergenic
982471394 4:155794939-155794961 CTCTAGATAAATATTAAGAGAGG + Intronic
982972077 4:162001319-162001341 CTCTAGATAGATAGATAGATAGG - Intronic
983049147 4:163023658-163023680 GGATAGATAGATATATATAGGGG - Intergenic
983121133 4:163886225-163886247 ATATATATTGATATAGAGATAGG + Intronic
983484049 4:168312699-168312721 ATATAGATAGATATAGATGATGG + Intronic
984457070 4:179983543-179983565 ATATATATAGAGAGAGAGAGAGG + Intergenic
985314508 4:188642193-188642215 ATATAAATAGATACAGATAGAGG + Intergenic
985933141 5:3074739-3074761 TTAGAGATAGAGATAGAGATAGG - Intergenic
986226239 5:5817207-5817229 AGATAGATAGATAGATAGAGAGG + Intergenic
986520178 5:8607037-8607059 ATATAGATAGATAAAGTGAGGGG + Intergenic
986968976 5:13310101-13310123 ATATATATATATATAAAGAGGGG + Intergenic
987026606 5:13933156-13933178 ATATATATAGATATAGACATAGG + Intronic
987247602 5:16064186-16064208 ATATATATATATATAGAGAGAGG + Intergenic
987571368 5:19665636-19665658 TTATAGATGGATAGAGAGAATGG + Intronic
987920799 5:24277818-24277840 AGATAGATAGATATGGAGAGAGG + Intergenic
988229096 5:28450864-28450886 ATAAATATATATATAGAGAGAGG - Intergenic
988346875 5:30048062-30048084 ATATAGATAGATAAAGATATAGG + Intergenic
988644658 5:33081076-33081098 CTGAAGATGGTTATAGAGAGCGG - Intergenic
988702252 5:33686756-33686778 ATATATATATATAGAGAGAGAGG - Intronic
988702254 5:33686790-33686812 CTATATATATAGAGAGAGAGAGG + Intronic
988931077 5:36035975-36035997 CTGTTGAGAGAGATAGAGAGGGG + Intronic
989604539 5:43231323-43231345 AGATATATAGATATAGATAGAGG - Intronic
989826997 5:45869352-45869374 TTTAACATAGATATAGAGAGTGG + Intergenic
990056037 5:51579719-51579741 ATATACATAGCTATAGAGATAGG + Intergenic
990569537 5:57064324-57064346 ATATACATATATATAGTGAGTGG + Intergenic
990615402 5:57502568-57502590 CTATACATTGAGAGAGAGAGTGG + Intergenic
990780011 5:59349937-59349959 CTAGAAACAGAGATAGAGAGGGG - Intronic
991014624 5:61917670-61917692 CTATATCTAAACATAGAGAGAGG + Intergenic
991114614 5:62939700-62939722 CTACAGATAGATAAAGAAAGAGG + Intergenic
991943623 5:71879290-71879312 CCATAGTGAGATAAAGAGAGAGG - Intergenic
992094401 5:73348300-73348322 ATGTACATAGATATATAGAGGGG + Intergenic
992135832 5:73743798-73743820 CTACAGATAGATACGGTGAGGGG - Intronic
992519729 5:77538136-77538158 GTATAGATGGACATAGAGAGTGG - Intronic
992664340 5:78991743-78991765 ATATAGATATATATAGAGAGAGG + Intergenic
992952361 5:81872873-81872895 CTAAAGAGAAAGATAGAGAGAGG - Intergenic
993248957 5:85489984-85490006 ATATATATAGAGAGAGAGAGAGG - Intergenic
993415389 5:87622859-87622881 CTGTAAATAGATTTACAGAGGGG - Intergenic
993544194 5:89190899-89190921 CTAAAGGTGTATATAGAGAGTGG - Intergenic
994310238 5:98260693-98260715 ATATATATAGAGAGAGAGAGAGG + Intergenic
994675366 5:102814518-102814540 ATATATGTATATATAGAGAGAGG - Intronic
995295782 5:110520047-110520069 ATATAGAGAGAGAGAGAGAGAGG + Intronic
995794415 5:115926493-115926515 CTATATATATATATAGTGTGAGG - Intergenic
995978578 5:118073542-118073564 ATATATATATATAGAGAGAGAGG + Intergenic
996272667 5:121626167-121626189 CTCTAGAGATATAGAGAGAGAGG - Intergenic
996884609 5:128340818-128340840 ATATAGAGAGAGAGAGAGAGAGG - Intronic
997762748 5:136465192-136465214 CAAGAGACAGATATAGAGGGTGG + Intergenic
998947365 5:147354003-147354025 CTAGAGAGAGAGAGAGAGAGAGG + Intronic
999381520 5:151124566-151124588 AGACAGAAAGATATAGAGAGAGG + Intronic
1001286799 5:170429655-170429677 GTATACATGGATGTAGAGAGTGG - Intronic
1002736769 5:181396109-181396131 ATATATATAGAAAGAGAGAGAGG - Intergenic
1002747930 6:78713-78735 ATATATATAGAAAGAGAGAGAGG + Intergenic
1003106187 6:3217974-3217996 TTATAGAGGGATTTAGAGAGAGG + Intergenic
1003518225 6:6835286-6835308 CTATAGATACAGATAGAGTGGGG - Intergenic
1004108668 6:12691970-12691992 AGATAGATAGATGTAGAGAAAGG + Intergenic
1005631344 6:27711067-27711089 CTAAAGAGAGAGAGAGAGAGGGG - Intergenic
1007427248 6:41755562-41755584 ATATAGATAGATAGATAGACAGG + Intergenic
1007918264 6:45582783-45582805 CTGTAGTTAGAAATAGGGAGGGG + Intronic
1008352231 6:50505510-50505532 CTATATATATATATACAAAGTGG + Intergenic
1008412889 6:51202197-51202219 ATATATATATATACAGAGAGAGG + Intergenic
1008744203 6:54648816-54648838 TTTTGGATATATATAGAGAGAGG + Intergenic
1008747823 6:54694124-54694146 CCATATATAGATAGATAGAGAGG + Intergenic
1008892905 6:56516110-56516132 ATATATATAGAAAGAGAGAGAGG + Intronic
1010274116 6:73949203-73949225 GCATGGATAGATGTAGAGAGAGG + Intergenic
1010275241 6:73961539-73961561 CAACAGATAGTTTTAGAGAGAGG - Intergenic
1010634910 6:78246511-78246533 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
1010739877 6:79488391-79488413 ATATATATAGAGAGAGAGAGAGG - Intronic
1010830728 6:80525320-80525342 ATATAGATAGATATATATATGGG + Intergenic
1011547210 6:88494266-88494288 ATACATATATATATAGAGAGAGG - Intergenic
1011741654 6:90367007-90367029 ATACACATATATATAGAGAGAGG - Intergenic
1011741656 6:90367071-90367093 ATGTACATATATATAGAGAGAGG + Intergenic
1011875237 6:91951549-91951571 ATATATATAGAGAGAGAGAGAGG - Intergenic
1011946112 6:92905430-92905452 TCATAGATAGATATGGAGATAGG - Intergenic
1012069157 6:94589988-94590010 CTATATATATATAGAGAGAGAGG - Intergenic
1012776394 6:103498861-103498883 ATATATATATATAGAGAGAGAGG + Intergenic
1013240018 6:108236325-108236347 ATATATATATATATAAAGAGAGG - Intronic
1013711256 6:112902371-112902393 ATATATATAGAGAGAGAGAGAGG + Intergenic
1013826178 6:114213893-114213915 CAATTTATAGGTATAGAGAGAGG - Intronic
1013898202 6:115119214-115119236 ACATAGATAGATATAGAGTTAGG + Intergenic
1013918846 6:115375490-115375512 CTATACATAGATATGAAGACTGG + Intergenic
1013936573 6:115603396-115603418 CTATAGTTATATGGAGAGAGAGG + Intergenic
1014456613 6:121642416-121642438 ATAGATATAGATATATAGAGAGG + Intergenic
1015020047 6:128462502-128462524 CTCAAAATAGATCTAGAGAGTGG + Intronic
1015285928 6:131486314-131486336 ATAGAGATAGATGGAGAGAGAGG + Intergenic
1015858403 6:137650058-137650080 GTATAGATAGATAGATAGATAGG - Intergenic
1016499172 6:144699593-144699615 CTATACATGGAGAGAGAGAGAGG - Intronic
1017518749 6:155182687-155182709 GTATACATATATATAGACAGAGG + Intronic
1017577676 6:155823298-155823320 ATATAGATAGATAGATAGATAGG - Intergenic
1018116981 6:160596008-160596030 CTGTAGAGAGACATACAGAGAGG - Intronic
1018266929 6:162035165-162035187 ATATATATATATATAGAGAGAGG + Intronic
1019140971 6:169942403-169942425 GTATAAATAGAGATAGAGATAGG + Intergenic
1019241868 6:170671638-170671660 ATATATATAGAAAGAGAGAGAGG - Intergenic
1019544798 7:1568946-1568968 CAAAATATATATATAGAGAGAGG - Intronic
1019841058 7:3444637-3444659 ATATACATAGCTAGAGAGAGGGG - Intronic
1020521940 7:9201355-9201377 GGATGGATAGATAGAGAGAGGGG + Intergenic
1020866206 7:13566448-13566470 ATATATATAGAGAGAGAGAGAGG + Intergenic
1021175289 7:17442895-17442917 ATATAGATAGGTATAGACACAGG - Intergenic
1021915066 7:25423105-25423127 ATATATATAGAGAGAGAGAGAGG + Intergenic
1023266062 7:38407200-38407222 CTATAGATAGATATAGAGAGAGG - Intronic
1023479180 7:40614533-40614555 CTATAGATGGAAATAGGGAAAGG + Intronic
1024081171 7:45856836-45856858 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
1024350231 7:48355986-48356008 GTATAGATAGAAAAATAGAGAGG + Intronic
1024572499 7:50734774-50734796 CTATAGTTAGATACAGTAAGAGG + Intronic
1024756796 7:52542692-52542714 TGATAGATAGATAGATAGAGTGG + Intergenic
1025800108 7:64778869-64778891 CTATACAAAAATATAGAGTGGGG - Intergenic
1026226792 7:68448974-68448996 GTATAGAGAGAAAGAGAGAGAGG - Intergenic
1027937498 7:84628468-84628490 ATATAGATAGATATACACAATGG - Intergenic
1028244899 7:88465352-88465374 GTATATCTATATATAGAGAGAGG + Intergenic
1028954791 7:96676300-96676322 CTATATATAGGTAGAGAGAAAGG - Intronic
1028985498 7:97005752-97005774 ATATAAAGAGATATAGTGAGCGG - Exonic
1030373028 7:108721740-108721762 CAATGGATAGTTACAGAGAGTGG - Intergenic
1030562957 7:111114014-111114036 CTATTGATAGAAATAAAGAGTGG + Intronic
1030789983 7:113712656-113712678 ATATAGCTAGATATAGATAGAGG + Intergenic
1030943573 7:115686975-115686997 AGATAGATAGAAATAGAGATAGG - Intergenic
1031239262 7:119217438-119217460 CTATAGATAGATAGAGAGATAGG - Intergenic
1031429496 7:121650205-121650227 ATATAGATATATATATAAAGGGG + Intergenic
1031504518 7:122565022-122565044 GTATACATAGATATATGGAGAGG + Intronic
1031509503 7:122631879-122631901 ATATACATAGATATAAAGATGGG - Intronic
1032899515 7:136291015-136291037 ATATAGATAGATACAGATATAGG - Intergenic
1035069831 7:156135725-156135747 CTATAGATACAACTAGAAAGAGG - Intergenic
1035506250 8:136458-136480 ATATATATAGAAAGAGAGAGAGG + Intergenic
1035777239 8:2197723-2197745 TTATAAATAGATATACAGATAGG - Intergenic
1035845165 8:2855929-2855951 ATATAAATAGATATACACAGAGG + Intergenic
1035935940 8:3839162-3839184 ATATATAAATATATAGAGAGAGG - Intronic
1036686071 8:10911171-10911193 GTATATATACATATAGAGAGAGG + Intronic
1036686073 8:10911261-10911283 ATATGTATATATATAGAGAGAGG + Intronic
1036686081 8:10911477-10911499 ATATATATATATAGAGAGAGAGG + Intronic
1036686141 8:10912529-10912551 GTATATATAGAGAAAGAGAGAGG + Intronic
1036698633 8:10996068-10996090 ATATAGATATAAATGGAGAGAGG + Intronic
1037396353 8:18447892-18447914 AGATAGATAGATAGAGAGACAGG - Intergenic
1037404861 8:18531469-18531491 TTATTGATAGCAATAGAGAGGGG - Exonic
1037405076 8:18533587-18533609 ATATACATAGATATAGACTGTGG + Exonic
1038262178 8:26005558-26005580 ATATAGAGAGAGAGAGAGAGAGG + Intronic
1038321250 8:26529333-26529355 CTATATATATATTTAGAGACAGG + Intronic
1038752515 8:30309230-30309252 AGATAGATAGATATAGATATGGG - Intergenic
1038939660 8:32290349-32290371 ATATACATATATATAGAGAGAGG + Intronic
1039842189 8:41302088-41302110 CTATAGATACAGATTGAGGGTGG - Intronic
1040666278 8:49637956-49637978 ATATATCTATATATAGAGAGAGG + Intergenic
1041395139 8:57382848-57382870 ATATATATATATATAAAGAGAGG + Intergenic
1041514292 8:58683255-58683277 CTCTAGATACATAAAGAGTGTGG + Intergenic
1041724188 8:61003064-61003086 AGATAGGTAGATAGAGAGAGCGG + Intergenic
1041986560 8:63929015-63929037 CTATAGAGAGAGAGAGAGAGAGG + Intergenic
1043207401 8:77463638-77463660 AGATAGATAGATATAGATATAGG - Intergenic
1043257603 8:78156084-78156106 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
1043269311 8:78309869-78309891 GTACATGTAGATATAGAGAGTGG - Intergenic
1043786470 8:84407001-84407023 ATATAGAGAGAGAGAGAGAGAGG - Intronic
1044708445 8:95031333-95031355 ATATAGACAGATATACAGAAAGG - Intronic
1044716978 8:95108937-95108959 AAATAGATAGATAAATAGAGTGG + Intronic
1045549725 8:103160629-103160651 CTATACATATATATATAAAGGGG + Intronic
1045734907 8:105283767-105283789 ATAGAGATAGAGATAGAGATAGG + Intronic
1045791027 8:105984610-105984632 CTATATATATATATATAAAGAGG + Intergenic
1046409564 8:113822248-113822270 GTATATATATATAAAGAGAGAGG + Intergenic
1046627072 8:116586313-116586335 TTATAGAGAGAGAGAGAGAGAGG + Intergenic
1047116843 8:121852237-121852259 ATATAGATAGATAGATAGATAGG + Intergenic
1047560381 8:125981112-125981134 AGATAGATAGATATAGATATAGG + Intergenic
1048968885 8:139633295-139633317 CTATAGTTAGATAAGGAGTGAGG - Intronic
1050742108 9:8833687-8833709 ATATATATAGAGAGAGAGAGAGG - Intronic
1050823747 9:9916516-9916538 GTATATATATATATAGAGAGAGG - Intronic
1050940240 9:11449381-11449403 CTATGGAAAGTTATAGAGATGGG + Intergenic
1051669757 9:19497614-19497636 CTGTAGAGAGATACAGAGTGTGG + Intergenic
1051776283 9:20637651-20637673 CTATAAAAAGACATAGAGAGAGG + Intergenic
1051896889 9:21996291-21996313 ATCTAGATAGATATTTAGAGTGG - Intronic
1052200363 9:25771197-25771219 GAATAGATATAAATAGAGAGGGG - Intergenic
1052488828 9:29136937-29136959 ATATAGTTATATACAGAGAGAGG + Intergenic
1052819546 9:33128096-33128118 CTAGAGAGAGAGAGAGAGAGAGG - Intronic
1053037494 9:34837787-34837809 ATACAGATAGATATATAGAAAGG - Intergenic
1053531599 9:38887492-38887514 GTATAGATGGATGTAGAGAGTGG + Intergenic
1054170274 9:61833615-61833637 ATATATATATATATGGAGAGAGG - Intergenic
1054203823 9:62111920-62111942 GTATAGATGGATGTAGAGAGTGG + Intergenic
1054634539 9:67476445-67476467 GTATAGATGGATGTAGAGAGTGG - Intergenic
1054667264 9:67747200-67747222 ATATATATATATATGGAGAGAGG + Intergenic
1055936203 9:81606791-81606813 ATATATATATATAGAGAGAGAGG + Intronic
1056080485 9:83088267-83088289 CTATATATAAATATAGACATAGG + Intergenic
1057120416 9:92567392-92567414 ATATAGATATATATATAAAGTGG + Intronic
1057762367 9:97887294-97887316 ATATACATAGAGAGAGAGAGAGG + Intergenic
1057997915 9:99836633-99836655 CCAAAGACAGATCTAGAGAGAGG + Intronic
1058037374 9:100267309-100267331 CTATAGATAAAAAGAGACAGTGG + Intronic
1058549928 9:106103803-106103825 GGATAGATAGATATATAAAGGGG - Intergenic
1059539333 9:115115097-115115119 CTATAGAAATCTAGAGAGAGAGG + Intronic
1059597513 9:115738276-115738298 CTATAGACAGCTTTAGAAAGAGG - Intergenic
1059637617 9:116186288-116186310 ATATATATAGACAGAGAGAGAGG + Intronic
1059980641 9:119768023-119768045 TTATACATAGATATAAAGACAGG + Intergenic
1061067353 9:128286774-128286796 CTATAGATGGATGAAAAGAGCGG + Intronic
1062540152 9:137038258-137038280 ATATAGAGAGAGAGAGAGAGGGG - Intergenic
1203602059 Un_KI270748v1:20872-20894 ATATATATAGAAAGAGAGAGAGG - Intergenic
1185769466 X:2754559-2754581 ATAGAAATATATATAGAGAGAGG + Intronic
1185770037 X:2758835-2758857 CGATAGATAGATCTAGAGATAGG - Intronic
1185835007 X:3337466-3337488 AGATAGATAGATACAGACAGAGG - Intronic
1186004517 X:5053993-5054015 AGATAGATAGATAGATAGAGTGG + Intergenic
1186140222 X:6564116-6564138 AGATAGATAGATGTAGAGATAGG - Intergenic
1186549610 X:10488964-10488986 ATATATATATATAGAGAGAGAGG - Intronic
1188174285 X:26969508-26969530 ATATATATATATAGAGAGAGAGG + Intergenic
1188205497 X:27351965-27351987 ATATATATATATAGAGAGAGAGG + Intergenic
1188890527 X:35606388-35606410 ATAAAGATAAACATAGAGAGAGG - Intergenic
1188925336 X:36034971-36034993 ATATATATATATAGAGAGAGAGG - Intergenic
1188925669 X:36039953-36039975 CTATAAATATATATAGTGGGAGG + Intronic
1188953802 X:36409954-36409976 CTATATATAGAGAGAGACAGAGG + Intergenic
1188997326 X:36901924-36901946 ATATATATAGAGAGAGAGAGAGG + Intergenic
1189607002 X:42689389-42689411 GTATAGAGAGAGAGAGAGAGAGG - Intergenic
1190871401 X:54427498-54427520 CTAGAGAGAGACAGAGAGAGAGG - Intergenic
1190932092 X:54957521-54957543 CAATAGATAGATAGATAGATGGG + Intronic
1192110283 X:68356713-68356735 CTATATATATATACAGAAAGAGG - Intronic
1192252776 X:69426712-69426734 CAATAGATAGATAAATAGATAGG + Intergenic
1192746700 X:73946115-73946137 ATATATATAGAGAGAGAGAGAGG + Intergenic
1193099625 X:77594047-77594069 CTCTAGATAGAAAAAGAGAAAGG + Intronic
1193504790 X:82328894-82328916 CTATATATAGAGAGAGAGATAGG - Intergenic
1193649847 X:84117630-84117652 ATATATATAGAGAGAGAGAGTGG - Intronic
1194112068 X:89846508-89846530 ATATATATAGAGAGAGAGAGAGG - Intergenic
1194626384 X:96230928-96230950 ATATATATAGAGAGAGAGAGAGG + Intergenic
1194833445 X:98654625-98654647 ATATAGAGAGAGAGAGAGAGAGG + Intergenic
1194873194 X:99158641-99158663 GTATACATGGATATAAAGAGGGG + Intergenic
1195229714 X:102833782-102833804 ATATATATATATATGGAGAGAGG + Intergenic
1196084140 X:111665994-111666016 CTATATATATATATATATAGGGG - Intronic
1196902142 X:120395479-120395501 CTATACATATATATGGAGATGGG + Intergenic
1196904917 X:120421573-120421595 ATATAGAGAGATAGAGAGATAGG + Intergenic
1197424382 X:126277321-126277343 AAATACATAGACATAGAGAGTGG + Intergenic
1197550240 X:127884002-127884024 GTATACATAGATATAAAGTGTGG + Intergenic
1197956297 X:131952084-131952106 CTATATATATATATAGAGAGAGG + Intergenic
1198517376 X:137423432-137423454 CTACAGATACAAAGAGAGAGGGG - Intergenic
1198971611 X:142287085-142287107 ATATATATATATATGGAGAGAGG - Intergenic
1199181296 X:144856997-144857019 TTATACATGGATATAGAGAGTGG + Intergenic
1199326726 X:146507396-146507418 GTATGCAAAGATATAGAGAGTGG + Intergenic
1199429096 X:147738574-147738596 CTATAGACAGAGAAAGAAAGAGG + Intergenic
1200502283 Y:3965715-3965737 TGATAGATAGAGAGAGAGAGAGG + Intergenic
1201300485 Y:12500797-12500819 TGATAGATAGATCTAGAGATAGG + Intergenic
1201714231 Y:17026452-17026474 ATATAGAGAGAGAGAGAGAGAGG - Intergenic