ID: 1023266364

View in Genome Browser
Species Human (GRCh38)
Location 7:38410366-38410388
Sequence CAGGCCCCACACTGCCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 46, 4: 263}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023266364_1023266369 -8 Left 1023266364 7:38410366-38410388 CCCAGATGGCAGTGTGGGGCCTG 0: 1
1: 0
2: 1
3: 46
4: 263
Right 1023266369 7:38410381-38410403 GGGGCCTGAAGCTTGAGGAGGGG 0: 1
1: 1
2: 4
3: 39
4: 357
1023266364_1023266371 -4 Left 1023266364 7:38410366-38410388 CCCAGATGGCAGTGTGGGGCCTG 0: 1
1: 0
2: 1
3: 46
4: 263
Right 1023266371 7:38410385-38410407 CCTGAAGCTTGAGGAGGGGCAGG 0: 1
1: 1
2: 5
3: 57
4: 496
1023266364_1023266368 -9 Left 1023266364 7:38410366-38410388 CCCAGATGGCAGTGTGGGGCCTG 0: 1
1: 0
2: 1
3: 46
4: 263
Right 1023266368 7:38410380-38410402 TGGGGCCTGAAGCTTGAGGAGGG 0: 1
1: 0
2: 3
3: 28
4: 408
1023266364_1023266373 20 Left 1023266364 7:38410366-38410388 CCCAGATGGCAGTGTGGGGCCTG 0: 1
1: 0
2: 1
3: 46
4: 263
Right 1023266373 7:38410409-38410431 AGCTGAAAGTCACACTTGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 173
1023266364_1023266367 -10 Left 1023266364 7:38410366-38410388 CCCAGATGGCAGTGTGGGGCCTG 0: 1
1: 0
2: 1
3: 46
4: 263
Right 1023266367 7:38410379-38410401 GTGGGGCCTGAAGCTTGAGGAGG 0: 1
1: 0
2: 1
3: 36
4: 325
1023266364_1023266372 16 Left 1023266364 7:38410366-38410388 CCCAGATGGCAGTGTGGGGCCTG 0: 1
1: 0
2: 1
3: 46
4: 263
Right 1023266372 7:38410405-38410427 AGGCAGCTGAAAGTCACACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023266364 Original CRISPR CAGGCCCCACACTGCCATCT GGG (reversed) Intronic
900035283 1:402652-402674 ATGGCTCCACACTGCCATCTTGG + Intergenic
900056904 1:638405-638427 ATGGCTCCACACTGCCATCTTGG + Intergenic
900673608 1:3870606-3870628 CAGGACTCACCCTGCCATCAGGG - Intronic
903019280 1:20382650-20382672 CAGGTCCCACACTGGCTCCTTGG + Intergenic
903045865 1:20563762-20563784 CAGGGCCCAGCCAGCCATCTGGG - Intergenic
903174617 1:21573554-21573576 CAGGCTCCCCACAGCCAGCTTGG - Intronic
903213467 1:21830981-21831003 CAGGCCCTGCACTGCCATCCAGG - Exonic
903676591 1:25068287-25068309 CAGGCCCTACACTGGCTTTTGGG + Intergenic
904000403 1:27335550-27335572 CAGGCCCAACCCTGCCTTTTGGG - Exonic
904261364 1:29289588-29289610 CAGGCCCCACCCTGCTGCCTGGG + Intronic
906059211 1:42937437-42937459 GAGACCACACACTGCCAGCTAGG + Intronic
906818149 1:48900222-48900244 CAGACCCCACACAGCCTTCTAGG + Intronic
907308290 1:53525616-53525638 CAGGCCCCACCCTGCCCTCCAGG + Intronic
907709109 1:56861532-56861554 CAGGCCCAACACTGCCACATCGG + Intronic
913659851 1:120997219-120997241 GATGCCACACACTGCCATTTTGG - Intergenic
914011209 1:143780357-143780379 GATGCCACACACTGCCATTTTGG - Intergenic
914166625 1:145180779-145180801 GATGCCACACACTGCCATTTTGG + Intergenic
914649832 1:149688996-149689018 GATGCCACACACTGCCATTTTGG - Intergenic
914870346 1:151468427-151468449 CAGGTCTCACACTGCCACCCAGG - Intergenic
915005437 1:152630667-152630689 CAGGCCCCAGAATGCCATGCAGG - Intergenic
915087187 1:153396820-153396842 CAGGCTCCCCACTGCCCACTGGG + Intergenic
915229266 1:154433503-154433525 GAGGCCCCACCCTGCCTTCAAGG - Intronic
916384302 1:164249977-164249999 CCGGCCCCACAGTGGCATCTAGG - Intergenic
917848771 1:179042646-179042668 CATGCCCCACGCTGACAACTGGG + Intronic
920021945 1:202962951-202962973 CTTGCCTCACACTGCCAACTCGG - Intronic
920112749 1:203598654-203598676 CTGGCCCCACACAGCCAGCAGGG - Intergenic
920309521 1:205040611-205040633 CAGGCCTCACTCTGTCATCTAGG + Intergenic
920499983 1:206479948-206479970 CATGCCCCTCCCTGCCACCTGGG - Intronic
921632933 1:217456261-217456283 CTGGCCCCACAGTAGCATCTAGG - Intronic
922150818 1:223002564-223002586 CTGGCCCCAGAGTGCCATTTTGG - Exonic
922257813 1:223908212-223908234 ATGGCTCCACACTGCCATCTTGG + Intergenic
923104669 1:230844768-230844790 CAGGCCCTGCCCTGCCCTCTGGG - Intronic
923506920 1:234611951-234611973 CAGGCCCCATTCTCCCAGCTTGG - Intergenic
924339011 1:243010991-243011013 ATGGCTCCACACTGCCATCTTGG + Intergenic
1065304324 10:24354389-24354411 CTGGCCCCACAGTAGCATCTAGG + Intronic
1065732389 10:28721489-28721511 CAGGCACCCCACTGTCACCTGGG - Intergenic
1067987635 10:51167641-51167663 CATCTCCCACACTGCCATCTTGG - Intronic
1071571934 10:86701983-86702005 CAGGGCCCACATTGCCATTGTGG - Intronic
1072740661 10:97907197-97907219 CAGGCTCCACATTGCCATCATGG - Intronic
1073225823 10:101917914-101917936 CAGCCCCCACACTGGCATTTAGG + Intronic
1073415598 10:103379131-103379153 AAGGCTCCACAGTGCCATCAAGG + Intronic
1073445348 10:103576972-103576994 CGAGGACCACACTGCCATCTGGG + Intronic
1075238348 10:120753323-120753345 AAGCCTCCACAGTGCCATCTTGG + Intergenic
1075698421 10:124452268-124452290 GAGGCCACATACTTCCATCTGGG - Intergenic
1076538516 10:131198640-131198662 CAGGCCTAAGACTGCCACCTGGG - Intronic
1076747481 10:132521701-132521723 CAGACCACACTCTGCCAGCTGGG + Intergenic
1076787678 10:132759225-132759247 CAGGCCCCTCAGTGCCAGCTTGG + Intronic
1077406584 11:2385106-2385128 AAGACCCCAGGCTGCCATCTTGG - Intronic
1077441636 11:2571734-2571756 CAGTCCCCAGACTGCCTTCTGGG - Intronic
1077456112 11:2681859-2681881 GAGGCCCAGCACTACCATCTAGG + Intronic
1078904956 11:15675346-15675368 CAGGTCCCACCATGCCACCTGGG + Intergenic
1083365063 11:62137508-62137530 CAGGCCCCAAACTCCCAGCATGG - Intronic
1083702808 11:64490839-64490861 CAGTCCCCACGCTGCCCACTGGG + Intergenic
1084729237 11:71062580-71062602 CAGGCCACTCTCAGCCATCTGGG - Intronic
1085461537 11:76696874-76696896 CAGCCCCCACACCACCATGTAGG + Intergenic
1087196265 11:95307102-95307124 CAGTCTCTACTCTGCCATCTAGG - Intergenic
1088009490 11:104982620-104982642 CATGCTCCACACTTCCATTTAGG + Intergenic
1088777557 11:113100310-113100332 CTGGCCCCACAGTAGCATCTAGG + Intronic
1089338863 11:117744379-117744401 CAGGCCCCACCCTGCCCTGCAGG - Intronic
1089443231 11:118532826-118532848 CAGGCCCCTGGCTCCCATCTGGG + Intronic
1091665180 12:2413769-2413791 AAGGCCCTCCACTGCCATTTAGG + Intronic
1092283596 12:7115599-7115621 CAGTCCCCAGCCTGCCACCTAGG - Intergenic
1096189728 12:49608527-49608549 CAGCCCCAAATCTGCCATCTTGG - Intronic
1097003604 12:55899387-55899409 TTTGCCCCACAATGCCATCTTGG + Intergenic
1097167512 12:57093641-57093663 CAGGCCCCACACAGCAATTCTGG + Intronic
1098308332 12:69123487-69123509 CAGCCCACAGTCTGCCATCTTGG - Intergenic
1098875214 12:75859961-75859983 TAGGCCACACTCTGCCAACTTGG - Intergenic
1099086383 12:78251683-78251705 CTGGAGCCACACTGCCAGCTTGG + Intergenic
1104144447 12:126019076-126019098 CAGGCCCCACTCAGCCATGCTGG - Intergenic
1104739880 12:131164625-131164647 GAGGCCCCACACTGGGAACTGGG + Intergenic
1111104622 13:83629328-83629350 CAGGCCCCACAGCAGCATCTAGG + Intergenic
1112120989 13:96411274-96411296 CAGGGCCCACACTGGCAGCCTGG + Intronic
1114077049 14:19166838-19166860 CAGGCCCCACATTGACACCAGGG + Intergenic
1114085108 14:19232726-19232748 CAGGCCCCACATTGACACCAGGG - Intergenic
1118319669 14:64745803-64745825 CAGTCCTTACACGGCCATCTAGG + Exonic
1118901455 14:69989736-69989758 CAGGCCCCACACTGGGCACTGGG - Intronic
1119478932 14:74947876-74947898 CAGGCCTGGCACTGCCAGCTAGG - Intronic
1119543119 14:75453330-75453352 CAGGCCTCACACAGCCAGCCAGG - Intronic
1119645746 14:76347023-76347045 CAGCCCCCATAGTGGCATCTGGG - Intronic
1119821801 14:77622772-77622794 CACACCCCACACTGCCACCCTGG + Intergenic
1121253438 14:92515302-92515324 CCGGCTTCACCCTGCCATCTTGG - Intronic
1122106814 14:99464161-99464183 CTGGCCCCACAGTGGAATCTTGG - Intronic
1122309507 14:100785648-100785670 CAGGCCCCCCATTGGCATGTGGG + Intergenic
1122758718 14:104003833-104003855 CAGGCCCTACAATGCCATCGAGG - Intronic
1122928560 14:104922770-104922792 CAGGCCCCACCCTGAGGTCTAGG - Intergenic
1123761859 15:23439716-23439738 CAGGCTCCACACTGCCAGTGTGG + Exonic
1124103836 15:26719072-26719094 CATGCACCACACTGACCTCTGGG + Intronic
1124260164 15:28182440-28182462 CAGGCCCCACACAAACACCTTGG + Exonic
1124375183 15:29125163-29125185 CAGGCCCAACAAAGCCATCAGGG + Intronic
1125349352 15:38751659-38751681 CTTGCCCCACCCTGCCCTCTGGG + Intergenic
1125491480 15:40151929-40151951 CAGGCCACACACTGACAACCTGG - Intergenic
1126697872 15:51341268-51341290 CTACCCCCACACTGCCCTCTTGG - Intergenic
1128158687 15:65408973-65408995 CAGGCACCACACTGCCACACTGG + Intronic
1128797795 15:70477999-70478021 CAGGCCCTGCCCTGCCATGTGGG - Intergenic
1129518215 15:76169896-76169918 AAGCCCCCACTCTGCCATCCTGG + Intronic
1131536899 15:93245209-93245231 CAGCCCCCACACTGCCTGCGGGG + Intergenic
1131550874 15:93355773-93355795 CAGAGCCCAAGCTGCCATCTTGG - Intergenic
1133270687 16:4609644-4609666 CAGGGCCCACCCTGCCATGGAGG - Exonic
1135648074 16:24180979-24181001 CAGCTCTCACACAGCCATCTGGG - Intronic
1136278330 16:29192365-29192387 AAGGCCACATCCTGCCATCTGGG + Intergenic
1136407834 16:30059084-30059106 TAGGCCCCACACTGAGGTCTGGG + Intronic
1136476257 16:30515521-30515543 CAGGCCCCATAGTGTGATCTTGG + Intronic
1137483560 16:48872917-48872939 CAGGCCCCATACTGAGCTCTTGG + Intergenic
1137571196 16:49567507-49567529 CAGACCCAGCCCTGCCATCTCGG + Intronic
1137688045 16:50400600-50400622 CAGGCCCCTCACCGCCAAATGGG - Intergenic
1137840371 16:51635903-51635925 CAGACCCTACCCTGCCATCCTGG + Intergenic
1138650856 16:58460525-58460547 CAGGCCTGACACTGCTATGTTGG - Intergenic
1139973638 16:70791850-70791872 AAGACCCCACACTGCCATATTGG + Intronic
1140476561 16:75242091-75242113 CAGGCTCCCCTGTGCCATCTGGG - Intronic
1140545301 16:75802209-75802231 CAGGTTACACACTGCCATGTCGG - Intergenic
1141785064 16:86193930-86193952 CACACCCCAGACTGCCAACTGGG - Intergenic
1142086305 16:88184267-88184289 CAAGCCCCACACTGCCAGGCTGG - Intergenic
1142124496 16:88403453-88403475 CAGAGCTCACACCGCCATCTCGG + Intergenic
1142223133 16:88865006-88865028 CAGGCCCCACACTGACCCCTTGG + Exonic
1143091091 17:4449525-4449547 CAGGCCTCCTGCTGCCATCTGGG - Intronic
1143385913 17:6530454-6530476 CAGGCCCCAGCCTCCCACCTTGG + Intronic
1144789777 17:17850981-17851003 CAGCCCCCACACAGCCAGCGAGG + Intronic
1145237747 17:21221071-21221093 AGGGCTCCACACTGCCATCTGGG + Intergenic
1146490367 17:33277153-33277175 GAGGGCCCACAGTGCCACCTGGG - Intronic
1146965634 17:37026797-37026819 CAGGCACCAGAATGACATCTTGG + Intronic
1147400792 17:40178862-40178884 CAGGCCCCAAGCTGCCTTTTAGG + Intronic
1147555500 17:41476488-41476510 CTGGCACCACACTGGAATCTTGG + Intergenic
1148240936 17:45998954-45998976 CAGCACCCAGACTGCCATCCAGG + Intronic
1148747484 17:49926888-49926910 GAGGCCCCAAAGGGCCATCTGGG - Intergenic
1149545574 17:57501139-57501161 CAGGAACCACACGGCGATCTTGG - Intronic
1150287742 17:63963530-63963552 CAGGCCCCACCCTGACCTCAGGG + Intronic
1151479295 17:74361000-74361022 CAGGCCCAGCCCTGCCCTCTTGG + Intronic
1151664976 17:75540545-75540567 CAGGCCCCAGACTGCCGGGTCGG + Intronic
1152237036 17:79144070-79144092 CAGGCCCGGCACTGGCATCGAGG + Intronic
1152531930 17:80923779-80923801 CAGGACCCACCCTGCCGTCCTGG + Intronic
1152762241 17:82114924-82114946 TTGGCCCCACACTGCCATGGAGG + Intronic
1155292586 18:24356630-24356652 CAACCCTCACATTGCCATCTTGG + Intronic
1155394948 18:25377200-25377222 CTGGCCCCACAGTAGCATCTAGG - Intergenic
1157220677 18:45826658-45826680 CAGGCCACACACTGACATCATGG + Intronic
1157535200 18:48452651-48452673 AAAGCCCCACACTGCCAGCCTGG + Intergenic
1158600648 18:58853213-58853235 CACCCACCACACTGCTATCTGGG + Intergenic
1159119981 18:64157613-64157635 GAGGCCCCAGTCTGCCCTCTAGG - Intergenic
1159662486 18:71115571-71115593 CAGGCCACACAATCCCAACTTGG - Intergenic
1161013579 19:1971667-1971689 CAGGACCCACATAGCCATCTGGG - Intronic
1161404182 19:4082492-4082514 GAGGGCCCTCAGTGCCATCTTGG + Intergenic
1162184623 19:8895247-8895269 CAGGATCCACCCTGCCATTTTGG - Intronic
1163117930 19:15199819-15199841 CAAGCCCCACACTGGCGTCTGGG + Intronic
1163144445 19:15371191-15371213 CAGGCCCTACACCTCCAACTTGG + Intronic
1163385927 19:17000559-17000581 CTGGGCCCTCCCTGCCATCTTGG - Intronic
1164905400 19:31963459-31963481 CAAGCCCCATGCTGCCATATAGG - Intergenic
1165723085 19:38093477-38093499 CAGGTCCCCCACTGCCTGCTTGG - Intronic
1165900430 19:39167046-39167068 CAGACCCCATGCTGCCAGCTGGG + Intronic
1166122363 19:40693258-40693280 CAGGCCCCACATTGCCCTCTAGG - Intronic
1166909428 19:46141388-46141410 CAGGCCCCACTCTGTGATCCTGG - Intergenic
1166923893 19:46252181-46252203 CAGGCCCCACTCTGTGATCCTGG + Intergenic
1167312166 19:48743348-48743370 CTGCCCCCACACCCCCATCTAGG + Intronic
1167499925 19:49840155-49840177 GAGGCCTGACACTGACATCTCGG + Intergenic
1168079331 19:53998059-53998081 CTGCGACCACACTGCCATCTAGG - Intronic
925258037 2:2506688-2506710 TTGGACACACACTGCCATCTTGG - Intergenic
925386295 2:3464017-3464039 CAGGCCCCACAGCTGCATCTGGG + Intronic
929568885 2:43007218-43007240 GAGGACCCACACTGCTTTCTAGG + Intergenic
932930270 2:76027937-76027959 GAGGCCCAACACAGCTATCTAGG - Intergenic
933750401 2:85599426-85599448 GAGGCCTAACACTGCCATGTGGG - Intronic
936797433 2:116224213-116224235 CAGGTCCCACACTGGAGTCTGGG - Intergenic
938291964 2:130155267-130155289 CTGGCCCCAACCTGCCACCTCGG - Intronic
938951172 2:136256205-136256227 CAGGCCCCACACTGCCAGTCTGG - Intergenic
940258126 2:151753862-151753884 CAGGGCCCATCATGCCATCTTGG - Intergenic
942165003 2:173233112-173233134 CAGGCACCACACTGCCTTTGTGG - Intronic
943713699 2:191126616-191126638 CTGGCCACAGACTGCCCTCTGGG + Intronic
943749149 2:191493841-191493863 CCGGCCCCACAGTAGCATCTAGG + Intergenic
944760453 2:202808487-202808509 CAGATCCCAGAATGCCATCTGGG - Intronic
946544112 2:220717489-220717511 CAGGCCCCTCCCTGACATGTGGG + Intergenic
947111251 2:226721634-226721656 CCAGCCCCCCACTGCCATCTGGG - Intergenic
947747443 2:232516170-232516192 CAGGTCCCACCCTCCCATCTAGG + Intergenic
948556770 2:238817312-238817334 CAGGCTCCGCACTGTCCTCTCGG + Intergenic
1170664900 20:18378365-18378387 CTGGGCCCACAGAGCCATCTGGG - Intergenic
1172364378 20:34337743-34337765 TAGTCCCTACACTGCCTTCTAGG - Intergenic
1173297523 20:41772611-41772633 CCTGCCCCACACTGCCCCCTTGG + Intergenic
1173549691 20:43923945-43923967 CAGTCCCCTCACCTCCATCTGGG - Intronic
1173656353 20:44702904-44702926 CAGGCCTCAAAGTGCCAGCTTGG - Intergenic
1175893813 20:62327240-62327262 CAGGCCCCACCCTCCTACCTGGG - Exonic
1175962249 20:62642946-62642968 CAGGCCCCACAGATCCAGCTGGG + Intronic
1176093263 20:63328368-63328390 CAGGCCCCCCATGCCCATCTTGG + Exonic
1176616371 21:9030430-9030452 CAGGCCCCAGATTGACATCAGGG - Intergenic
1180969297 22:19806713-19806735 CAGGGCGCACACTGACGTCTTGG + Exonic
1183955598 22:41378930-41378952 CAGGCACCACACTAACCTCTGGG + Intronic
1184096716 22:42320028-42320050 CATTCCCACCACTGCCATCTCGG + Intronic
1184290888 22:43497660-43497682 CTGGCCCCACCCTCCCAGCTGGG + Intronic
1184473265 22:44707613-44707635 CAGGCCCCAAAATGCCATGAGGG + Intronic
1184511308 22:44934883-44934905 CAGGCCCCACCAGGCCATCCTGG + Intronic
1184528555 22:45040129-45040151 CAGGCCCAACACTGCTCTCTGGG + Intergenic
1184722347 22:46322338-46322360 CAGGCCCCACCCTTCCCTCTTGG + Intronic
1184834381 22:47012446-47012468 CAGGCCCCTCACTGTCGTCCTGG + Intronic
1185219534 22:49622516-49622538 CAGGCCCCCTTCTGCCATCAGGG - Intronic
949880075 3:8654700-8654722 AAGGCCACACACTGTGATCTTGG - Intronic
949880106 3:8654853-8654875 GAGGCCACACACTGAGATCTGGG - Intronic
949943815 3:9174706-9174728 CAGCCCCCTCACTCCCGTCTGGG - Intronic
950437675 3:12990415-12990437 CAGGCCCCACTCTGCCCTCAGGG + Intronic
953912256 3:46899058-46899080 CACGCCCCGCGCTGCCATCAAGG + Intronic
961450257 3:126999423-126999445 CAGGCCCCTGGCTGCCATCATGG + Intronic
962237064 3:133715698-133715720 CAGGCCCCAAACTGCCAACATGG + Intergenic
962289940 3:134126337-134126359 CAGGACCCAGACTGCCCACTGGG + Intronic
962293073 3:134153888-134153910 CACTCCCCACACTGCCGCCTTGG - Intronic
967100221 3:186210090-186210112 CAGGCCCCACAGTCCCCTCTGGG - Intronic
973156551 4:46962149-46962171 CAGGCCCCACCCTGCCCCATGGG + Intronic
974766158 4:66348939-66348961 CATGCCCAATACTGCCACCTGGG + Intergenic
974991246 4:69093384-69093406 GAGGCCCAACACTGCTATCACGG + Intronic
975947343 4:79723759-79723781 CAGGCCCCACGGCACCATCTGGG + Intergenic
979238110 4:118424247-118424269 ATGGCTCCACACTGCCATCTTGG - Intergenic
979584870 4:122403981-122404003 CAGCCCCCACACAGCCAACAAGG + Intronic
981548791 4:145921403-145921425 CAGTCTCCACACTGCCACCATGG - Intronic
981638956 4:146913072-146913094 CACCCCCCAAACTGCCTTCTAGG - Intronic
983197993 4:164829073-164829095 CAGGCACCACAGAGCCTTCTTGG + Intergenic
983795254 4:171854199-171854221 CAGGCCAGACACTGGTATCTGGG - Intronic
984817923 4:183855839-183855861 CAGGCCCTTCACTTCCATCCTGG + Intronic
986317569 5:6600797-6600819 CAGGGCTCAGACTGCCATGTGGG - Intronic
986457292 5:7932028-7932050 CTGGCCCCACAGTAGCATCTGGG - Intergenic
993188144 5:84646219-84646241 CCGACCCCACAGTGGCATCTGGG - Intergenic
993346256 5:86787062-86787084 CAGGCTCCTCAGTGCCCTCTGGG - Intergenic
993613674 5:90084581-90084603 CAGCTCCCACATTGCCAGCTGGG - Intergenic
994089232 5:95794112-95794134 CAGGGCCTCCACTGCCACCTTGG + Exonic
994533164 5:100992604-100992626 CTGGCCCCACAATAGCATCTAGG + Intergenic
995710610 5:115031720-115031742 CAGGGCACTCACTGCCATCTGGG + Intergenic
997786019 5:136714787-136714809 CAGGACCCTCATTGCCATCCAGG + Intergenic
998542367 5:142994573-142994595 CAGTCCCAACAGTCCCATCTGGG - Intronic
998570190 5:143250198-143250220 CAGGCCCCTCATTGCCAGGTAGG - Intergenic
1000233510 5:159336552-159336574 CAGGCCCCACAGCAGCATCTAGG - Intergenic
1000334967 5:160235448-160235470 CAGGTCCCACACACACATCTGGG + Intronic
1001020400 5:168178011-168178033 AATGCCCCAGACTGCCAGCTGGG - Intronic
1001042793 5:168348797-168348819 CAGCCCCCACACTGCAGCCTGGG + Intronic
1002181599 5:177433742-177433764 CAGGCCCCACCCTCCCATGTGGG + Intronic
1002359947 5:178662436-178662458 CTGGCCCCTCACTGCCCTCCAGG - Intergenic
1002397729 5:178971209-178971231 CAGGCCACACAGGGCCATGTGGG + Intergenic
1002738536 5:181416219-181416241 ATGGCTCCACACTGCCATCTTGG - Intergenic
1002991895 6:2245818-2245840 CAGGCCCCCCACGGCCAGCCAGG - Intergenic
1003567051 6:7230667-7230689 CAAGCCCCTCACTGCCTTCCTGG + Exonic
1005418984 6:25629808-25629830 CAGGTCCCCCAATGCCATCCTGG - Intergenic
1006213118 6:32414364-32414386 CAGGCCCCCCACTCACATCTGGG - Intergenic
1006278879 6:33030117-33030139 CAGGCACCTGACTGCCACCTGGG - Intergenic
1006423363 6:33949136-33949158 CTGGCCCCACGCTGCTCTCTGGG + Intergenic
1007479617 6:42141805-42141827 CAGGCCCCTCTCTGCCACGTGGG + Intronic
1010388141 6:75305848-75305870 CAGGCCCCACCCTGAAATCTTGG - Intronic
1010975888 6:82313193-82313215 CAGCTCCCACACAGCCATCAAGG - Intergenic
1011798318 6:90982241-90982263 CAGGCCCCAGACTGGCCACTGGG - Intergenic
1013888188 6:114996703-114996725 CCGGCCCCACATTCCCATCATGG + Intergenic
1016569048 6:145492339-145492361 CGGCCCCCACAGTACCATCTAGG + Intergenic
1019243639 6:170691771-170691793 ATGGCTCCACACTGCCATCTTGG - Intergenic
1019429101 7:990572-990594 CAGGCCTCACACTCCCAGGTGGG + Intergenic
1022236538 7:28467110-28467132 AAGGCCCTACACTGCCTGCTGGG - Intronic
1022251739 7:28615277-28615299 CAGGGGCTACACTGCCACCTAGG - Intronic
1023091751 7:36624406-36624428 CAGGCTCCAGGCTGCCATTTAGG - Intronic
1023266364 7:38410366-38410388 CAGGCCCCACACTGCCATCTGGG - Intronic
1023779659 7:43643997-43644019 CAGGGGCCACAGTGTCATCTTGG - Intronic
1023789043 7:43737489-43737511 GAGTTCCCACCCTGCCATCTTGG - Intergenic
1024042360 7:45565277-45565299 CAGGACCCACCCTGCCCTCCAGG - Intergenic
1024055613 7:45658297-45658319 CAAGCTCCACACAGCCATCTAGG + Intronic
1024234458 7:47387471-47387493 CTGGCCCCATTCGGCCATCTGGG - Intronic
1024454927 7:49594617-49594639 CTGTCCCAATACTGCCATCTGGG - Intergenic
1024558961 7:50627859-50627881 CAGGCTCCACACAGCCAGCCTGG - Intronic
1026955518 7:74374007-74374029 CAGGCCCCACAGTCCCCTCCAGG + Intronic
1029485289 7:100836421-100836443 CAGGCCCCACTCTTCCAGCCTGG + Intronic
1030151427 7:106409397-106409419 CAGGTCTCACTCTGCCACCTAGG - Intergenic
1033290534 7:140079176-140079198 CAGGCTGCACGCAGCCATCTGGG + Intergenic
1035504483 8:116389-116411 ATGGCTCCACACTGCCATCTTGG + Intergenic
1037521219 8:19682139-19682161 CAGGTCCTATACTGCCATCCTGG - Intronic
1037822162 8:22140263-22140285 CAGGCCCCATGCTGACCTCTGGG - Intronic
1038339235 8:26670419-26670441 CACGCCCCACCCTGCCATGAGGG + Intergenic
1040392524 8:46962031-46962053 GAGGCCCCTCACTGCCAGCAAGG + Intergenic
1040465755 8:47693572-47693594 CAGGCACCAGTCTGTCATCTAGG + Intronic
1044061638 8:87644529-87644551 CTGCCCCCACACTGCCACCTCGG - Intergenic
1044744675 8:95360959-95360981 CAATCCCCACACTGGCTTCTAGG + Intergenic
1045489951 8:102660567-102660589 AAGGACCCACACTTCCACCTAGG - Intergenic
1047352406 8:124088419-124088441 CAGGTCCAAAAATGCCATCTGGG + Intronic
1048047351 8:130785398-130785420 CAGGCCTGACACGGCCATGTAGG + Exonic
1048233240 8:132664283-132664305 CTGGCCTCATACTGCCATGTGGG + Intronic
1048587070 8:135784018-135784040 CATCCCCCACCCTGCCCTCTTGG + Intergenic
1053357119 9:37455557-37455579 CTGGCCCCACGGTGGCATCTAGG - Intronic
1055105157 9:72504621-72504643 CAGGCCCCACAAGGCCACCTCGG - Intergenic
1057287762 9:93774223-93774245 CAGCACAGACACTGCCATCTTGG + Intergenic
1057304320 9:93903544-93903566 TGGGCTCCACACTCCCATCTTGG - Intergenic
1057703935 9:97384621-97384643 CAGACCCCACACTCCCATACTGG - Intergenic
1059266454 9:113036663-113036685 AGGGCCCCACTCTGTCATCTAGG + Intergenic
1060048282 9:120358476-120358498 CAGGCCCCACACCCACATGTAGG + Intergenic
1060560655 9:124540032-124540054 CAGGCTCCACACTGTCTTCCAGG - Exonic
1061062397 9:128257243-128257265 CAGGCTCCACACTGCCGGCGAGG + Exonic
1061137111 9:128741335-128741357 GAGGCCCCACCAGGCCATCTGGG + Intronic
1061160058 9:128888571-128888593 GAGGGCCCACCCTGCCACCTGGG + Intronic
1061217485 9:129230166-129230188 CAGGCCCCACACTGGGGCCTGGG - Intergenic
1061422976 9:130482120-130482142 CAGGACCAGGACTGCCATCTGGG + Intronic
1061879435 9:133561386-133561408 CAGCCCCCAAACTGCCCTCGGGG + Intronic
1061985381 9:134127404-134127426 CAGGCACCACACAGGCCTCTGGG - Intergenic
1062149013 9:135007864-135007886 CAGGCCGCACGCTGGAATCTGGG - Intergenic
1062617179 9:137403157-137403179 CAGTCCCCACACTGCCATGGAGG - Intronic
1203603828 Un_KI270748v1:40994-41016 ATGGCTCCACACTGCCATCTTGG - Intergenic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619889 X:1447400-1447422 TTGGACACACACTGCCATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185620008 X:1448223-1448245 TTGGACACACACTGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1185620045 X:1448476-1448498 TTGGACACACACTGCCATCTTGG + Intronic
1185620053 X:1448533-1448555 TTGGACACACACTGCCATCTTGG + Intronic
1185620074 X:1448679-1448701 TTGGACACACACTGCCATCTTGG + Intronic
1187460968 X:19486288-19486310 CAGGCCCCACTCAGCCATTGAGG - Intronic
1191670185 X:63741499-63741521 CATGCTCCACACAGCCATGTGGG - Intronic
1193067462 X:77275101-77275123 CAGCCAACACACTCCCATCTGGG + Intergenic
1196812752 X:119641692-119641714 TAGGCCCCATACTGCCAAGTCGG - Intronic
1199142584 X:144331175-144331197 CTGGCCCCACATTTGCATCTGGG + Intergenic
1199380696 X:147168713-147168735 CCGGCCCCACAGTGGCATCTAGG - Intergenic
1199676832 X:150196344-150196366 AAGGCCTCCCAGTGCCATCTGGG + Intergenic
1200977968 Y:9232899-9232921 CACCCACCACACTGCCACCTGGG + Intergenic
1201149746 Y:11089155-11089177 CAGGCCCCAGATTGACATCGGGG - Intergenic
1202385888 Y:24326039-24326061 ATGGCTCCACACTGCCATCTTGG - Intergenic
1202484898 Y:25344089-25344111 ATGGCTCCACACTGCCATCTTGG + Intergenic