ID: 1023267061

View in Genome Browser
Species Human (GRCh38)
Location 7:38417824-38417846
Sequence GGAGCCAGTGGAGGAGGCAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1822
Summary {0: 1, 1: 0, 2: 15, 3: 181, 4: 1625}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023267061_1023267072 18 Left 1023267061 7:38417824-38417846 CCACTGCCTCCTCCACTGGCTCC 0: 1
1: 0
2: 15
3: 181
4: 1625
Right 1023267072 7:38417865-38417887 CCAAGGTCCAGACCAACGGCAGG 0: 1
1: 0
2: 0
3: 7
4: 103
1023267061_1023267070 14 Left 1023267061 7:38417824-38417846 CCACTGCCTCCTCCACTGGCTCC 0: 1
1: 0
2: 15
3: 181
4: 1625
Right 1023267070 7:38417861-38417883 CATTCCAAGGTCCAGACCAACGG 0: 1
1: 0
2: 0
3: 14
4: 127
1023267061_1023267066 1 Left 1023267061 7:38417824-38417846 CCACTGCCTCCTCCACTGGCTCC 0: 1
1: 0
2: 15
3: 181
4: 1625
Right 1023267066 7:38417848-38417870 CAGCCCGAGTGTCCATTCCAAGG 0: 1
1: 0
2: 1
3: 3
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023267061 Original CRISPR GGAGCCAGTGGAGGAGGCAG TGG (reversed) Exonic
900029309 1:359325-359347 GGGGTAAGTGGAGGAGGGAGGGG - Intergenic
900049909 1:588097-588119 GGGGTAAGTGGAGGAGGGAGGGG - Intergenic
900271968 1:1795245-1795267 GAAGCCAGTGGAGGAGGGCTCGG - Intronic
900309065 1:2024726-2024748 AGGGCCAGTGGAAGAGGCTGAGG + Intronic
900323032 1:2094331-2094353 GTGGGCAGTGGCGGAGGCAGTGG + Intronic
900372973 1:2340425-2340447 GGAGCGAGGGGAGGAGTCAGTGG - Intronic
900538096 1:3188820-3188842 GGAGAGAGAGGAGGAAGCAGGGG + Intronic
900803496 1:4752183-4752205 GGAGAGAGAGGAGGAGGGAGAGG + Intronic
901154099 1:7123887-7123909 GCAGCCAGGGGAGGTGGCTGTGG + Intronic
901183184 1:7355786-7355808 GGAGCCAAGGGAGGAGCAAGAGG - Intronic
901246111 1:7732549-7732571 GGCAGCAGTGGAGGCGGCAGCGG + Exonic
901745825 1:11372885-11372907 GGAGACAGAGAAGGAGCCAGTGG - Intergenic
901811306 1:11768134-11768156 GGAGCCAGCGGCGGCGGCAGTGG + Exonic
901958770 1:12808234-12808256 GCAGACAGTGGAGCAAGCAGGGG - Intergenic
901987845 1:13090395-13090417 GCAGACAGTGGAGCAAGCAGGGG + Intergenic
901993967 1:13136372-13136394 GCAGACAGTGGAGCAAGCAGGGG - Intergenic
902195419 1:14794523-14794545 GGGGCCAGGGTAGGAGGCAGCGG + Intronic
902313194 1:15597664-15597686 GGAGCCAGTGGAGAAGGAAATGG + Intergenic
902332453 1:15737085-15737107 TGAGCCAGGGGAGGGGGCAGAGG + Intronic
902372197 1:16013864-16013886 GGAGCCCACGGAGGAGGCCGAGG + Intergenic
902377988 1:16039197-16039219 GCAGGCAGCGGGGGAGGCAGAGG - Intergenic
902383077 1:16061693-16061715 GCAGGCAGCGGGGGAGGCAGAGG - Intronic
902438280 1:16412096-16412118 GGAGCCAGCACCGGAGGCAGGGG - Intronic
902479727 1:16705111-16705133 GGAGCCATAGGAGGTGGCATGGG + Intergenic
902614911 1:17618493-17618515 GGAGACAGAGGAGGAGGAGGAGG - Intronic
902694780 1:18132909-18132931 GGAGGGAGTGGGGGAGGGAGGGG + Intronic
902797131 1:18807219-18807241 ACAGCCAGGGGAAGAGGCAGGGG + Intergenic
903181295 1:21606208-21606230 GGTGGCAGTGGAGGAGGCACAGG + Intronic
903306112 1:22414473-22414495 GGAGCCAGGGGATGGGACAGTGG - Intergenic
903353132 1:22730215-22730237 AGAGCCAGGGGCGGAGGCGGGGG + Intronic
903369434 1:22825746-22825768 GGAACTAGCTGAGGAGGCAGTGG + Intronic
903950765 1:26994591-26994613 GGGCCCAGTAGAGGAGGCTGAGG + Exonic
903968152 1:27102390-27102412 GGAGACGGTGGAGACGGCAGAGG + Exonic
904005439 1:27360941-27360963 GGCGCCCGCGGAGGAGGCGGAGG - Exonic
904081668 1:27876327-27876349 GAACTCAGTGGAGGAGGCACGGG + Intronic
904116195 1:28163732-28163754 GGAGCCAGGGGAGGGGACTGTGG + Intronic
904311191 1:29630703-29630725 GGAGGAGGAGGAGGAGGCAGAGG - Intergenic
904376512 1:30085532-30085554 GGAGCCAGGGGAAGAGGCTCAGG + Intergenic
904413738 1:30342354-30342376 GGAGCCGGGGAAGGAGGCAGAGG - Intergenic
904572454 1:31477188-31477210 TGCTCCAGTGGAGGTGGCAGGGG + Intergenic
904634649 1:31870507-31870529 GGAGACAGAGGTGAAGGCAGGGG - Intergenic
904692496 1:32304262-32304284 GGAGCCAGTGGAGGCAACTGGGG + Intronic
904818346 1:33221966-33221988 GAAGCAGGTGGAGGAGGAAGAGG + Intergenic
904935440 1:34126661-34126683 GGAGACACTGCAGGAGGGAGTGG + Intronic
905198687 1:36301559-36301581 CGAGCCAGAGGAAGAGGCTGGGG + Exonic
905226268 1:36481212-36481234 GGAGCCAGTGGAGGCGGATAGGG - Intronic
905319054 1:37102865-37102887 GGAGGAAGAGGAGGAGGAAGAGG + Intergenic
905319068 1:37102917-37102939 GGAGGAAGAGGAGGAGGTAGAGG + Intergenic
905340396 1:37273914-37273936 GGAGCTAGTGGTGGGGGCGGGGG - Intergenic
905396512 1:37669913-37669935 GGAGCCAAGGAAGGAGACAGAGG - Intergenic
905510575 1:38516681-38516703 AGAGCCTCTGGGGGAGGCAGGGG - Intergenic
905511993 1:38529281-38529303 GGAGCCAGGGAAGGGGTCAGGGG - Intergenic
905677824 1:39841687-39841709 GGATCCAGTTCAGGAGGGAGGGG - Exonic
905888886 1:41507611-41507633 GGAAGCAGCAGAGGAGGCAGTGG - Exonic
906070821 1:43015215-43015237 GGGGCTAGTGGAGGACGCATAGG - Intergenic
906220138 1:44071955-44071977 GGAGGAAGAGGAGGAGGCAAAGG - Intergenic
906291724 1:44623750-44623772 GGAGGCAGGGAAGGAGACAGAGG + Intronic
906376886 1:45303563-45303585 GAATCCTGTGGGGGAGGCAGGGG + Intronic
906471264 1:46132967-46132989 CGAGCCAGGCGAGGAGGGAGTGG + Intronic
906476235 1:46171431-46171453 AGAGCCAGTGGAGGAACCAGGGG + Intronic
906578826 1:46917545-46917567 TGCTCCAGTGGAGGTGGCAGGGG + Intergenic
907010717 1:50960220-50960242 GGAGGAAGCGGAGGAGGCGGAGG - Exonic
907431477 1:54414576-54414598 GGAGCCAGTGAAGGAGACCAAGG + Intergenic
907444433 1:54498928-54498950 GGAGTCAGTGGAGTTGGTAGGGG + Intergenic
907456895 1:54581849-54581871 GCAGCCAGTCTGGGAGGCAGGGG - Intronic
907459891 1:54599281-54599303 AGAGCCGGCTGAGGAGGCAGGGG - Exonic
907514397 1:54984288-54984310 TGAGCCAGTGAAGCAGGCAGCGG - Intronic
907517823 1:55004442-55004464 GGAGGCAGTGGGTGAGGGAGAGG - Intronic
907568962 1:55465546-55465568 GGAGACTGGGGAGGAGACAGAGG + Intergenic
907682779 1:56579472-56579494 GGAGCCGGAGGAGGAGGAGGAGG - Exonic
907971925 1:59391342-59391364 GGAGGCAGTGGGGGAGTCGGAGG + Intronic
908264605 1:62365915-62365937 GGAAGCAGAGGAGGAGGAAGAGG + Intergenic
908796237 1:67833421-67833443 GGAGCAAGAGGAGGAGGAGGAGG - Exonic
909012876 1:70354318-70354340 GGAGCCCGGGGATGAGGAAGCGG - Exonic
909183320 1:72451189-72451211 GGTCCCAGTGGTGGTGGCAGTGG - Intergenic
909753630 1:79195326-79195348 GGATGCAGAGGAGTAGGCAGAGG - Intergenic
910158199 1:84244414-84244436 GGAGCATGTGGAGGAGAAAGAGG + Intergenic
910312059 1:85835201-85835223 GGAGGCAGAGGCAGAGGCAGAGG - Intronic
910350085 1:86286779-86286801 GGTGGCAGAGGAGGAGGAAGAGG - Intergenic
910596201 1:88983465-88983487 GGAGGAAGTGGAGGAACCAGGGG - Exonic
910838293 1:91537300-91537322 AGAGGCACAGGAGGAGGCAGAGG - Intergenic
911064639 1:93777398-93777420 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
911064642 1:93777410-93777432 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
911288732 1:96028960-96028982 GGAGGGGGTCGAGGAGGCAGGGG + Intergenic
911678857 1:100691430-100691452 TGTTCCAGTGGAGGTGGCAGTGG + Intergenic
912228682 1:107766728-107766750 GGAGGAAGGGGAGGAAGCAGCGG + Intronic
912326592 1:108769298-108769320 AGAGGCAGAGGAGGTGGCAGGGG + Intronic
912334835 1:108852690-108852712 GCAGCCAGCTCAGGAGGCAGAGG - Exonic
912471219 1:109908254-109908276 GGAGCAAGTGGAGGAGACTCAGG + Intergenic
912490023 1:110057664-110057686 TGAGCCTGTGGAGGAGGCTGGGG + Intronic
912662370 1:111543716-111543738 GGAGAAAGAGGAGGAGGAAGAGG + Intronic
912675515 1:111676718-111676740 GGGGCCAGTGGTGGTGGCACAGG - Intronic
912716926 1:111989730-111989752 GGCGGCAGTGGCGGCGGCAGTGG - Intergenic
912716929 1:111989742-111989764 GGCGGCAGTGGCGGCGGCAGTGG - Intergenic
913071526 1:115303383-115303405 GGAGGCAGTGGTGGCGGTAGGGG - Intronic
913130929 1:115838237-115838259 GGAGCCGGTGGAGGAGGCCGAGG - Exonic
913143179 1:115962168-115962190 TGTTCCAGTGGAGGTGGCAGGGG - Intergenic
913186384 1:116373609-116373631 GGAGGCGGCGGAGGAGGAAGCGG + Intronic
913186847 1:116376266-116376288 GGTTCCAGTGAAGGTGGCAGGGG + Intronic
913518407 1:119623844-119623866 GGAGCCGGTGGAAGCGGCGGTGG + Exonic
913540117 1:119811435-119811457 GGAGACACTGAAGAAGGCAGGGG - Exonic
914250474 1:145918071-145918093 GGGGCCAGTGCAGGCCGCAGGGG + Intronic
914686113 1:149981088-149981110 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
915461078 1:156070854-156070876 GGGGCAAGGGGAGGAGGCAGCGG + Intergenic
915462213 1:156076898-156076920 GGAGGAGGAGGAGGAGGCAGAGG + Exonic
915514009 1:156402217-156402239 GAGGCCAGGAGAGGAGGCAGAGG + Intergenic
915556924 1:156665860-156665882 GGAGACAGTGGTGGTGGCAGTGG - Intergenic
915987812 1:160483704-160483726 TGGTCCTGTGGAGGAGGCAGTGG + Intergenic
916569431 1:166012282-166012304 GGAGACACTGTAGGAGGCAGTGG - Intergenic
916573281 1:166045763-166045785 GGAGGCGGAGGAGGAGGAAGAGG - Intergenic
916599227 1:166276114-166276136 GGAGGCCGTGGAGGAGATAGAGG - Intergenic
916662432 1:166935082-166935104 GGAGTCTAGGGAGGAGGCAGGGG + Intronic
916725455 1:167518493-167518515 GGAGGCAGAGGCTGAGGCAGCGG + Exonic
916827045 1:168452475-168452497 GGAACTAGTGAAGGTGGCAGGGG + Intergenic
917109517 1:171531192-171531214 GGGGCCACAGGGGGAGGCAGAGG + Intronic
917214024 1:172659373-172659395 GGAGGCAGTGGTGGCGGCGGCGG - Exonic
917345231 1:174022363-174022385 GGAGCCTGAGGAAGAGGAAGGGG - Intergenic
917461626 1:175235169-175235191 TGTTCCAGTGGAGGTGGCAGAGG - Intergenic
917792050 1:178505332-178505354 TGGGCCAGTGGAGCAGACAGAGG + Intergenic
917804109 1:178598128-178598150 GAAGCCAGTGGCCCAGGCAGAGG - Intergenic
918021991 1:180703158-180703180 GGCACCAGTGGTGGTGGCAGTGG + Intronic
918559450 1:185847062-185847084 GGAGACAGTGTAGGGGTCAGTGG - Intronic
919277950 1:195445260-195445282 TGTTCCAGTGGAGGTGGCAGTGG - Intergenic
919297740 1:195722998-195723020 GGAGCCCGTGGAGCAGGGGGAGG + Intergenic
919451325 1:197775563-197775585 GGAGACTGTGGAGGAGGCGGGGG + Intronic
919866965 1:201789767-201789789 GGAGTAGGTGGAGGAGGCACTGG - Exonic
920047076 1:203140267-203140289 GCAGGGAGTGGAGGAGGCTGTGG + Intronic
920059541 1:203217879-203217901 GGATGCAGTGGAGGAGCCCGGGG + Intronic
920176055 1:204102615-204102637 GGAGCAGATGGAGGAGGAAGAGG + Intronic
920177022 1:204108432-204108454 GGAGCTGATGGTGGAGGCAGAGG - Intronic
920309055 1:205037856-205037878 TTGGACAGTGGAGGAGGCAGCGG - Intergenic
920404793 1:205701250-205701272 GGACACAGTGGGGGAGGCAGGGG - Intergenic
920560749 1:206936744-206936766 GGGGCCAGGGGAGGGGACAGAGG + Intronic
920563911 1:206958868-206958890 GCAGCAAGTGGAGGAGGCTAAGG - Intronic
920912550 1:210232557-210232579 GGAAGCAGGGAAGGAGGCAGGGG + Intergenic
920976648 1:210792083-210792105 AGGGCCAGAGGAGGAGGAAGTGG - Intronic
921052885 1:211523708-211523730 GGGGTCAGCGGAGGGGGCAGCGG - Intergenic
921089466 1:211830104-211830126 GGAGCCGGTGGAGCCTGCAGCGG + Intronic
921251283 1:213300771-213300793 GGAGGCAGAGGAGGAGGCAGAGG + Intergenic
922213244 1:223501150-223501172 GGAGGAAGCGGAGGAGGGAGAGG - Intergenic
922427967 1:225517414-225517436 GAAGGCAGTGGAGGCGGCGGCGG + Intronic
922585927 1:226735635-226735657 GAAGCCCGTGGAGGAGGCCGAGG + Exonic
922677309 1:227560872-227560894 GAAGCCTGTGCAGGAGACAGAGG + Intergenic
922800634 1:228363171-228363193 GGAGGAGGTGGAGGAGGGAGGGG + Intronic
923135104 1:231110457-231110479 GGAGCCAGTGCATGAGACATAGG + Intergenic
923146474 1:231202160-231202182 GGAGGTAGTGGAGGAGGAGGTGG + Intronic
923174100 1:231446447-231446469 TGCTCCAGTGGAGGTGGCAGGGG - Intergenic
923338045 1:232986690-232986712 GGAGGGAGTGGGTGAGGCAGTGG - Intronic
923482367 1:234397287-234397309 GGAGGCAGAGGAGGGGGAAGGGG + Intronic
924012331 1:239679291-239679313 GGGGGCAGGGGAGGAGGCAGAGG - Intronic
924359217 1:243218370-243218392 GGCCCCAGTGGAGGAGGCAGGGG + Intronic
924383416 1:243483193-243483215 GGAGCCCGGGGAGGAGGCGGCGG + Intronic
924383500 1:243483509-243483531 GGAGGCACTGGAGGAGAGAGGGG - Intronic
924453805 1:244201884-244201906 GTAGGCAGTGGAGGAGACCGTGG - Intergenic
924483939 1:244461608-244461630 GGAGCCAGGAGACGAGGCAGTGG - Intronic
924581851 1:245330425-245330447 GGAGGGAGTGGGGGAGGGAGCGG + Intronic
924581978 1:245330745-245330767 GGAGGGAGTGGGGGAGGGAGTGG + Intronic
924644282 1:245862968-245862990 AGAGCCAGAGAAGGAGGTAGAGG - Intronic
924855326 1:247869724-247869746 GGAGACAGTGTAGGGGGCAAGGG + Intronic
1062767954 10:79929-79951 GGGGCCAGAGGAGGAGTGAGGGG - Intergenic
1062787398 10:277182-277204 GGAGGAAGAGGAGGAGGAAGAGG - Exonic
1062787401 10:277194-277216 GGTGAGAGTGGAGGAGGAAGAGG - Exonic
1062802468 10:390232-390254 AGGGCCAGTGGAGGAGGCCAAGG + Intronic
1062814161 10:487428-487450 GGAGGCAGCCGTGGAGGCAGAGG - Intronic
1062881114 10:979166-979188 GGAGCAAGGGAAGGAGGCAATGG - Intergenic
1063150583 10:3332906-3332928 GGAGGCAGTAGAGGGGGCTGTGG + Intergenic
1063311572 10:4957395-4957417 GGAGGCTGTGGAAGAGGCTGAGG - Intronic
1063316226 10:5009075-5009097 GGAGGCTGTGGAGGAGGCTGAGG + Intronic
1063353050 10:5373973-5373995 GGGGCCAGGGGTGGAGCCAGAGG + Exonic
1063803671 10:9612084-9612106 GGAGGAAGAGGAGGAGGAAGAGG + Intergenic
1063925399 10:10972677-10972699 GCAGCCAGGTGAGGAGGCAGAGG - Intergenic
1064003512 10:11682619-11682641 GGAGAAGGAGGAGGAGGCAGAGG - Intergenic
1064190124 10:13198588-13198610 GTAGGCAGAGGAGGAGGGAGTGG + Intronic
1064723722 10:18256575-18256597 CAAGCCTGTGGAGGAGGCGGGGG - Intronic
1064834026 10:19505090-19505112 AGAGGCAGAGGAGGAGGAAGAGG + Intronic
1065043115 10:21717649-21717671 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1065043118 10:21717661-21717683 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1065043138 10:21717733-21717755 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1065200403 10:23307718-23307740 GGAGGCAGAGGTGGAGGCAGAGG - Intronic
1065264079 10:23957027-23957049 GGAGCCTGGTGAGGAGCCAGTGG - Intronic
1065339741 10:24693703-24693725 GGAGCCAGTGAATGGGGGAGAGG - Intronic
1065551087 10:26869163-26869185 GGAGAAGGAGGAGGAGGCAGTGG - Intergenic
1065704854 10:28463376-28463398 GGAACCAGGGGAGGAGGAATGGG + Intergenic
1065827394 10:29584618-29584640 AGAGCCAGTGAACGAGGCACGGG - Intronic
1065838462 10:29680358-29680380 GCAGCCAGTTGAGAAGGAAGAGG + Intronic
1065950459 10:30646539-30646561 AGAGCCAGTGAACGAGGCACGGG + Intergenic
1066030570 10:31419236-31419258 GTAGACAGTGGTGTAGGCAGAGG + Intronic
1066037001 10:31501266-31501288 GGAGCCAGTGGAGGAAATGGAGG + Intronic
1066429150 10:35336255-35336277 CGGGGGAGTGGAGGAGGCAGAGG + Intronic
1067195769 10:44116715-44116737 GAAGGCAAGGGAGGAGGCAGAGG + Intergenic
1067297821 10:44984811-44984833 AGGGCCCCTGGAGGAGGCAGAGG + Exonic
1067408546 10:46045065-46045087 GGAGCCAAGGGAGGTGGGAGAGG - Intronic
1067431879 10:46250607-46250629 GGAGCCGGGGGCAGAGGCAGTGG + Intergenic
1067472352 10:46546328-46546350 GGAGCCCCTGGAGCAGACAGAGG + Intergenic
1067794335 10:49309895-49309917 GAAGACAGTGGAGATGGCAGGGG - Intronic
1068705510 10:60071244-60071266 GGAGTCAGAGGAGGAGGAACAGG - Exonic
1068969034 10:62943943-62943965 GGAGGCAGAGGAGGAGGAGGAGG + Intergenic
1069361751 10:67650953-67650975 GGAGGCAGTGGGGGAGGGGGTGG - Intronic
1069408282 10:68125975-68125997 GGAGTCTGTAGAGGAGGCAGTGG + Intronic
1069526903 10:69180428-69180450 GGAGGCAGAGGAGGAGGCGGTGG - Exonic
1069544500 10:69318828-69318850 GGAGCCGGGGGAGGAGGAGGAGG + Intronic
1069596205 10:69672700-69672722 GGAGCCAGCAGAGGAGGCTGTGG + Intergenic
1069614583 10:69798843-69798865 AGAGGCAGTGGAAGAGGCAGTGG + Intergenic
1069816245 10:71196384-71196406 GGAGCCAGCAAAGGAGGCATGGG + Intergenic
1069988091 10:72297848-72297870 GGAGGCCGTGCAGGAGGCGGAGG - Intergenic
1070300213 10:75198139-75198161 GGGGCCAGTGTGGGAGGCAATGG - Intergenic
1070513515 10:77182515-77182537 GGAGGCAGTGATGGAGGCAAGGG + Intronic
1070558212 10:77546279-77546301 GAATTCAGTGGAGGAGGGAGAGG - Intronic
1070663567 10:78327936-78327958 GGTGCCAGTGGTGGTGGCAGAGG + Intergenic
1070692069 10:78534243-78534265 GGAGACAGAGGAGGAGGAGGGGG - Intergenic
1070973419 10:80586151-80586173 GGAGCCCATGGAGGAGGGGGAGG - Intronic
1071241036 10:83705353-83705375 GGATCCAGGGGAGGGGGCAATGG - Intergenic
1072710628 10:97713755-97713777 GGAGCAAGGCGAGGAGGCCGCGG + Exonic
1072781457 10:98254691-98254713 GTAGGCAGTGGAGCAGGGAGGGG + Intronic
1072893634 10:99347034-99347056 GCAGGCACTGGAGGAGGGAGAGG + Intronic
1073026039 10:100487982-100488004 GGTGGAAGTGTAGGAGGCAGTGG + Intronic
1073049058 10:100656257-100656279 GGAGGCAGGGGAGGCCGCAGAGG - Intergenic
1073156916 10:101354404-101354426 GGACCCAGGGGTGGGGGCAGCGG + Intronic
1073215236 10:101832614-101832636 GGAGGCAGTGGGCCAGGCAGGGG + Intronic
1073460256 10:103661807-103661829 GGAGCCGGGGGTGGAGGCAGGGG + Intronic
1073513467 10:104057121-104057143 GGTGGCAGTGGAGGAGGTGGCGG - Exonic
1074139520 10:110659772-110659794 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1074429594 10:113382605-113382627 GGAGAAGGTGGAGGAGGTAGGGG - Intergenic
1074687231 10:115972158-115972180 TGAGCCGTGGGAGGAGGCAGAGG + Intergenic
1074744196 10:116515091-116515113 AGGGCCAGGGGAGGGGGCAGCGG + Intergenic
1074815705 10:117139806-117139828 GGAGGCAGGGGAGGTGGCGGCGG - Intergenic
1075066474 10:119292145-119292167 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1075352332 10:121734896-121734918 GGATCTAGTGGAGGAGACACTGG - Intergenic
1075705051 10:124495471-124495493 GCAGGCAGTGGAGGACGCACAGG + Intronic
1075724815 10:124605833-124605855 AGAGCCAGTGGAGGGGGAGGGGG + Intronic
1075744237 10:124715494-124715516 GGTGGCAGTGGGGGAGGCATAGG - Intronic
1075828015 10:125377186-125377208 GGTGCCAGTGATGGAGACAGAGG - Intergenic
1075895900 10:125994198-125994220 GGAGGCAGTGTAGGGTGCAGTGG + Intronic
1076057710 10:127389179-127389201 GTGGCCAGTGCAGGAGGAAGGGG + Intronic
1076293038 10:129362173-129362195 GGAGCCTCGGGAGGAGGCACTGG + Intergenic
1076329599 10:129654657-129654679 GGAGAGACAGGAGGAGGCAGGGG + Intronic
1076375923 10:129984636-129984658 TGCTCCAGTGGAGGTGGCAGGGG - Intergenic
1076412624 10:130262724-130262746 GCAGTGAGAGGAGGAGGCAGAGG - Intergenic
1076412847 10:130264165-130264187 GCAGTGAGAGGAGGAGGCAGAGG - Intergenic
1076500207 10:130930805-130930827 GGAGCCACAGGAGGAGGAGGAGG - Intergenic
1076688302 10:132208066-132208088 GGAGCCTGTGGAGGACGAGGCGG - Exonic
1076696858 10:132251256-132251278 GGGGCCCGTGGAGGGGGCAGAGG + Intronic
1076749196 10:132533818-132533840 GGAGCCAGCAGAGGAGACTGGGG + Intergenic
1076830560 10:132992320-132992342 GGAGGCAGAGGAGGCAGCAGCGG + Intergenic
1076852504 10:133099965-133099987 GGAGCCTGTGGGGGAGTCTGGGG - Intronic
1076992255 11:281546-281568 AGAGCCAGAGGAGGAGGAGGAGG + Exonic
1077064831 11:636563-636585 GGAGGGAATGGAGGAGGGAGCGG + Intergenic
1077104435 11:836036-836058 GGAGGCAGGGGAGGGGTCAGCGG - Intronic
1077154970 11:1087171-1087193 GGACCCAGAGGAGGACCCAGAGG - Intergenic
1077155029 11:1087337-1087359 GGACCCAGAGGAGGACCCAGAGG - Intergenic
1077155054 11:1087426-1087448 GGACCCAGAGGAGGACCCAGAGG - Intergenic
1077242426 11:1517595-1517617 GGAGCCAGAGGTGGGGGTAGCGG - Intergenic
1077311760 11:1891913-1891935 GGAGCAAAAGGAGGTGGCAGCGG - Exonic
1077321850 11:1946385-1946407 GAAACCAGGGGAGGAGGGAGAGG + Intergenic
1077486179 11:2839308-2839330 GGAGTCAGTGGCAGAGCCAGGGG - Intronic
1077602393 11:3582453-3582475 GGAGGCAGTGGAGGCAGGAGAGG + Intergenic
1078631872 11:13010452-13010474 GGAGCCAGAAGAGGTGGCGGCGG + Intergenic
1078786452 11:14499434-14499456 GGAGGAAGGGGAGGAGGAAGCGG - Intronic
1079216636 11:18519082-18519104 GGAGGCAGTCCAGGAGGCAGAGG - Intronic
1079230180 11:18643022-18643044 GGAGGAAGAGGAGGAGGGAGAGG + Intergenic
1079283710 11:19110016-19110038 GGAGGCAGAGGCAGAGGCAGAGG + Intergenic
1079325990 11:19493159-19493181 GGAGAGAGGGGAGGGGGCAGGGG - Intronic
1079531919 11:21464438-21464460 AGAGCCAGTTGAGGAGGCTCAGG + Intronic
1080203296 11:29699262-29699284 TGCTCCAGTGGAGGTGGCAGGGG + Intergenic
1080585835 11:33682214-33682236 TGTTCCAGTGGAGGTGGCAGAGG + Intergenic
1080950321 11:37024781-37024803 GGAGGCAGAGGAGGAGGAGGCGG + Intergenic
1081611343 11:44565260-44565282 GGAGAAAGTGAAGGAGGCGGGGG + Intronic
1081809025 11:45905056-45905078 GATGGCAGTGGAGGAGGCACGGG + Intronic
1081814485 11:45930843-45930865 GAAGCAAGTGGAGGTGGCTGGGG + Intronic
1081933590 11:46889442-46889464 GAAGCCAGTGGGGCAGGCACAGG + Exonic
1082215237 11:49560771-49560793 GGAGAGAGCGGAGGAGGGAGGGG - Intergenic
1082913786 11:58408218-58408240 GGAGGCAGAGGCGGAGGCAGAGG + Intergenic
1082953301 11:58841315-58841337 ATAGCCAGAGGAGGAGCCAGGGG - Intronic
1083307620 11:61769388-61769410 GGAGGTAGGGGAGGAGGGAGGGG + Intronic
1083332672 11:61906219-61906241 GGAGTCAGTGGGGCAGGGAGGGG + Intronic
1083442339 11:62685408-62685430 GGAGGCCGAGGAGGAGGCTGAGG - Intergenic
1083571373 11:63763749-63763771 GGAGGCGGGGGAGGAGGCGGCGG + Exonic
1083571450 11:63764044-63764066 GGAGCCAGAGGAGGAGGAGGAGG - Exonic
1083629634 11:64088955-64088977 GGAGGCTGGGGAGGAGGCAGAGG + Intronic
1083759180 11:64806492-64806514 GCAGCGAGTGGAGGTGGGAGTGG - Intronic
1083801862 11:65051199-65051221 GAAGCCAGGGGTGGAGGGAGTGG - Intronic
1083805659 11:65072373-65072395 GGACCCAGGCGAGGAGGGAGGGG + Intronic
1083887266 11:65578986-65579008 GGAGCTGGGGGAGGAGGAAGAGG + Intronic
1083949334 11:65945451-65945473 GGAGCCTGTGGATGAGGCAGAGG + Exonic
1083986029 11:66216093-66216115 GGAGCCAGGGGAGGTGGTGGAGG - Intronic
1084258287 11:67957000-67957022 GGAGGCAGTGGAGGCAGGAGAGG + Intergenic
1084431052 11:69111463-69111485 AGAGGCTGTGGAGGAGGCGGGGG + Intergenic
1084460276 11:69293213-69293235 GGAGCCAGCGGAGGGGAGAGAGG - Intergenic
1084482278 11:69428880-69428902 TGAGCGAGTGGAGGAGGGAGTGG - Intergenic
1084700490 11:70783665-70783687 GGAGGGAGCTGAGGAGGCAGAGG + Intronic
1084814459 11:71638210-71638232 GGAGGCAGTGGAGGCAGGAGAGG - Intergenic
1084957619 11:72699609-72699631 GGAGCCCCGGGAGGATGCAGAGG - Intronic
1085040802 11:73325227-73325249 GGAGACAGGGCAGGAGGCTGGGG - Intronic
1085278206 11:75313454-75313476 AGAGTCTGAGGAGGAGGCAGCGG + Intronic
1085317590 11:75554864-75554886 AGAGCCACTGGTGGGGGCAGGGG - Intergenic
1085460289 11:76689330-76689352 GGTGCCAGAGGAGGAGGCCAGGG + Intergenic
1085513675 11:77100350-77100372 AGAGGGAGGGGAGGAGGCAGAGG - Intronic
1085544833 11:77308470-77308492 GGAGGGAGTGGGGGAAGCAGGGG + Intergenic
1085594274 11:77793727-77793749 GGAGCCAGTGAGGGAGGTAGGGG - Intronic
1085747872 11:79129989-79130011 TGTTCCAGTGGAGGTGGCAGGGG - Intronic
1086413844 11:86569381-86569403 GGAAGCAGGGGAGGAGGAAGGGG - Intronic
1086478369 11:87204745-87204767 GGAGGCTGAGGAGGAGGAAGAGG + Intronic
1086634333 11:89063706-89063728 GGAGAGAGCGGAGGAGGGAGGGG + Intronic
1086790257 11:91028551-91028573 AGAGGCAGTGGAGGAGTGAGAGG - Intergenic
1086825382 11:91489590-91489612 TGTTCCAGTGGAGGTGGCAGGGG + Intergenic
1086998909 11:93392952-93392974 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1087175011 11:95088719-95088741 GGGGCTAAAGGAGGAGGCAGGGG - Intergenic
1087264574 11:96046133-96046155 GGAGAGAGGGGAGCAGGCAGGGG + Intronic
1087365085 11:97208580-97208602 GCAGCCAGGAGAGGAGGCGGGGG + Intergenic
1087380675 11:97400742-97400764 GGAGGAGGAGGAGGAGGCAGAGG + Intergenic
1087615980 11:100487013-100487035 TGCTCCAGTGGAGGTGGCAGGGG - Intergenic
1088137663 11:106577691-106577713 TGTTCCAGTGGAGGTGGCAGAGG + Intergenic
1088239582 11:107759303-107759325 TGTTCCAGTGGAGGTGGCAGGGG - Intergenic
1088638659 11:111849630-111849652 GGGGCCTGTGGAGGGGGCGGAGG - Intronic
1088711145 11:112509901-112509923 GGAGAAAGAGGAGGAGGAAGAGG - Intergenic
1088812825 11:113403054-113403076 GAAGGAAGTGGAGGAAGCAGGGG - Intergenic
1088853882 11:113728907-113728929 AGAGCAAGTGGCTGAGGCAGAGG + Intergenic
1088903931 11:114139832-114139854 GGCGGCTGTGGAGGAGGCCGGGG + Intronic
1089129068 11:116198403-116198425 GGAGTCAGAGGAGGAGGAGGAGG + Intergenic
1089130456 11:116208120-116208142 GCAGCCAGGGGAAGAAGCAGGGG + Intergenic
1089136392 11:116252645-116252667 TGAGTTAGTGGTGGAGGCAGTGG + Intergenic
1089289385 11:117428586-117428608 GGTGGCTGTGGAGGCGGCAGCGG + Exonic
1089489206 11:118871376-118871398 GGAGCCAGTGGAGGGTGGGGTGG - Intergenic
1089497232 11:118913935-118913957 GGAGCCAGTAGGGCAGGCAGTGG + Intronic
1089532302 11:119138262-119138284 GGAGGCAGAGGCAGAGGCAGAGG + Intergenic
1089607925 11:119652355-119652377 GGAGTCAGAGGAGGAGGGGGAGG - Intronic
1089621597 11:119725876-119725898 GGAGCCCTAGGAGGAGGCAGAGG - Intronic
1089626012 11:119751544-119751566 GGAGGCCTGGGAGGAGGCAGAGG - Intergenic
1089628211 11:119765139-119765161 GGTGGCAGTGGAGGTGGGAGGGG - Intergenic
1089712398 11:120325268-120325290 GGAGCCAGAGGCGGAGGACGAGG - Intronic
1089851059 11:121496922-121496944 GAAGACAGTGGAGTAGCCAGAGG - Exonic
1090028608 11:123188415-123188437 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1090028611 11:123188427-123188449 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1090044014 11:123315330-123315352 GGAGGGAGGGGAGGAGGGAGGGG - Intergenic
1090201510 11:124861242-124861264 GGTTCCAGTGGAGGAGACTGTGG - Intergenic
1090252587 11:125262199-125262221 TGAGACAGTGGAGGCGGCGGTGG + Intronic
1090642244 11:128739601-128739623 GGAGGCAGTGGTGTGGGCAGGGG + Intronic
1090662340 11:128891153-128891175 GGAGCCGGGGGAGGGCGCAGGGG + Intergenic
1090765383 11:129871720-129871742 GGAACCCCTGTAGGAGGCAGTGG - Intronic
1090846197 11:130532118-130532140 GGAGACAGAGCCGGAGGCAGGGG - Intergenic
1091210480 11:133854197-133854219 TGTTCCAGTGGAGGTGGCAGAGG + Intergenic
1202804867 11_KI270721v1_random:1698-1720 GAAACCAGGGGAGGAGGGAGAGG + Intergenic
1091454248 12:593764-593786 GGAGGAAGAGGAGGAGGAAGTGG + Intronic
1091526774 12:1310308-1310330 GGAGGCTGAGGAAGAGGCAGAGG - Intronic
1091635557 12:2194112-2194134 GGAGCCAGAGGAGGAGCAGGAGG - Intronic
1091635589 12:2194245-2194267 GGAGGAGGAGGAGGAGGCAGTGG - Intronic
1091635606 12:2194305-2194327 GGAGGAACGGGAGGAGGCAGAGG - Intronic
1091687326 12:2572699-2572721 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1091703682 12:2679855-2679877 GGAGACAGTGGAGGAGACGGAGG + Intronic
1091715184 12:2771810-2771832 GGAGGCAGGGGAGGAGGAAATGG + Intergenic
1092065880 12:5589347-5589369 GGAGACAGGGAAGGAGGAAGAGG + Intronic
1092087015 12:5770915-5770937 GGAGCAGATGGAGGAGGTAGGGG - Intronic
1092200748 12:6581086-6581108 GGAGAAAGTGGAAAAGGCAGAGG - Exonic
1092810400 12:12266963-12266985 GGCGCCGGGGGAGGAGGCGGCGG - Intronic
1093002000 12:14007502-14007524 TGTTCCAGTGGAGGTGGCAGCGG + Intergenic
1093125251 12:15321711-15321733 GCAGGCAGAGGAGGAGGAAGAGG + Intronic
1093720628 12:22437702-22437724 TGTTCCAGTGGAGGTGGCAGAGG - Intergenic
1094042663 12:26133867-26133889 GGACAGAGTGGAGAAGGCAGTGG + Intronic
1094494776 12:30982507-30982529 GGAGGCAGAGGCAGAGGCAGAGG - Intronic
1094555705 12:31497828-31497850 GGGGCAAGGGGAGGGGGCAGGGG + Intronic
1095296145 12:40529860-40529882 GAAGCAAGAGGAGGAGGCAGAGG - Intronic
1095793959 12:46196809-46196831 GGAGACAGTGAGGGAAGCAGGGG - Intronic
1095850485 12:46798430-46798452 GGATGGAGTGGAGGAGGGAGGGG - Intronic
1096003131 12:48145852-48145874 GGAGCTGGAGGAGCAGGCAGTGG + Exonic
1096115070 12:49050766-49050788 GGTGAGAGTGGAGGAGGAAGGGG + Exonic
1096156028 12:49342102-49342124 GGAGGGAGTGCAGGAGGGAGGGG - Intergenic
1096196481 12:49651965-49651987 GGAGCTGGTGGTGGAGGAAGAGG + Exonic
1096226126 12:49867904-49867926 GGACCCAGAGTAGGAGGCTGCGG + Exonic
1096338091 12:50772920-50772942 GGGGCCTGTGGAGGAGGGTGCGG - Intronic
1096499061 12:52054564-52054586 GGAGGCCGAGGAGGAGGCTGAGG - Exonic
1096539634 12:52298286-52298308 GGAGCCAGTCCAAGGGGCAGAGG - Intronic
1096566669 12:52487898-52487920 GGTGCCAGTGGTGTCGGCAGTGG - Exonic
1097192858 12:57227758-57227780 GGAAGAAGAGGAGGAGGCAGAGG - Intergenic
1097295540 12:57958488-57958510 TGTTCCAGTGGAGGTGGCAGGGG - Intergenic
1097502414 12:60421941-60421963 GCTGCCATGGGAGGAGGCAGGGG - Intergenic
1097548071 12:61029861-61029883 GGAGAAAGAGGAGGAGGAAGAGG - Intergenic
1098500652 12:71187801-71187823 TGCTCCAGTGGAGGTGGCAGGGG - Intronic
1099144137 12:79017640-79017662 GGAGCCAATGTTGGAGGAAGAGG + Intronic
1099186164 12:79517471-79517493 GGAGACGGAGGAGGAGGAAGAGG + Intergenic
1099955013 12:89345022-89345044 TGAGGAAGTGGAGGAAGCAGAGG - Intergenic
1101650622 12:106674096-106674118 AGAGCCAGTGGGCGAGGGAGTGG - Intronic
1101755819 12:107619949-107619971 GGAGCCAGGGAAGGTGGCAGGGG - Intronic
1101909145 12:108849821-108849843 GGAGCCAGGGGAGGAGGCATGGG + Intronic
1102089143 12:110172291-110172313 GGAGGCAGAGGCAGAGGCAGAGG - Intronic
1102200872 12:111056858-111056880 GGAGCCAGTGCGGCAGGAAGTGG + Intronic
1102230277 12:111257340-111257362 GGAGGAAGCGGAGGAGGAAGAGG - Intronic
1102240206 12:111320432-111320454 GTAGCCAGAGGAGGAGGAGGAGG - Exonic
1102298907 12:111757333-111757355 GGAGCAGGTGGAGGCTGCAGGGG - Intronic
1102394243 12:112574190-112574212 AGAGGTGGTGGAGGAGGCAGGGG + Intronic
1102409704 12:112707026-112707048 AGAGGCAGTGGAGTGGGCAGGGG + Intronic
1102465257 12:113127137-113127159 GGAGGCAGAGGCAGAGGCAGAGG - Intronic
1102500503 12:113348999-113349021 GGAGCAAGGGAAGGAGGGAGGGG - Intronic
1102521032 12:113477455-113477477 GGAGCAGGTGGAGAGGGCAGTGG + Intergenic
1102548763 12:113675485-113675507 GACTCCAGTGGAGGCGGCAGAGG - Intergenic
1103005638 12:117418110-117418132 GGAGGAAGGGGAGGAGGGAGAGG + Intronic
1103074112 12:117968616-117968638 GGAGAGAGAGGAGGAGGGAGAGG + Intronic
1103447782 12:121005491-121005513 GGAGCCAGTGGAGGGCGCGCTGG + Intronic
1103737627 12:123070577-123070599 GCAGCCAGTGGAGCTGGGAGGGG - Intronic
1103841601 12:123869704-123869726 GGAGCCTGAGAAGGAGGAAGGGG - Intronic
1103896678 12:124277904-124277926 GGAGGCAGAAGAGGAGGAAGAGG - Intronic
1103909586 12:124344907-124344929 GGAGCCAGTGGTGGACGCGCCGG + Exonic
1104262113 12:127194014-127194036 GGGGCCTGTGGAGGAGGAGGAGG - Intergenic
1104382907 12:128323605-128323627 GGAGCCTGGGGAGGCGACAGAGG - Intronic
1104399293 12:128462391-128462413 GGAGACAGTGGAGGTATCAGCGG + Intronic
1104504461 12:129318531-129318553 TGTTCCAGTGGAGGTGGCAGGGG + Intronic
1104673381 12:130695722-130695744 GAGGCCAGGGGACGAGGCAGAGG + Intronic
1104710502 12:130982468-130982490 GGAGGCAGATGAGGAGGAAGAGG - Intronic
1104789195 12:131471355-131471377 GGAGTCAGGAGAGGAGACAGTGG + Intergenic
1104941325 12:132396834-132396856 GGATCGAGTGGGGCAGGCAGAGG - Intergenic
1104975202 12:132549063-132549085 GGAGTCAGTGGCGGTGGCCGGGG + Intronic
1105012737 12:132766523-132766545 GCAGCCAGTGGTGGAGCCGGGGG + Intergenic
1105558198 13:21465658-21465680 GGAGCCGGTTCAGGAAGCAGAGG + Intergenic
1105674483 13:22655703-22655725 GGAGCATGTGGAAGTGGCAGGGG + Intergenic
1106006435 13:25774398-25774420 GGGGCCTGTTGGGGAGGCAGGGG + Intronic
1106102645 13:26708057-26708079 GGAGGCAGTGGCAGGGGCAGGGG - Intergenic
1106512238 13:30421898-30421920 GGAGGAAGGGGAGGAGGGAGAGG + Intergenic
1106765841 13:32913405-32913427 GGAGGAAGAGGAGAAGGCAGAGG - Intergenic
1107324263 13:39224105-39224127 GGAGCCTGTCGAGGGGGCGGGGG + Intergenic
1107890911 13:44913583-44913605 GGTGCGAGTGGAGGAGAAAGAGG + Intergenic
1108437518 13:50415241-50415263 TAGGCCAGTGGAGGAGACAGGGG - Intronic
1108459159 13:50647761-50647783 GGAGCCAGGGGAGGGGGAAATGG - Intronic
1109241601 13:59896585-59896607 GGAGGCGGGGGTGGAGGCAGGGG + Intronic
1109246979 13:59966944-59966966 CAAGCCAGTGCAGGAGGTAGAGG - Intronic
1109302238 13:60601136-60601158 GGAGGCAGTGGAGGCAGCGGAGG - Intergenic
1109515222 13:63435487-63435509 TGGGCCAGTGGAGGATGCAAGGG - Intergenic
1109606327 13:64702857-64702879 GGAGGCAGAGGCTGAGGCAGGGG - Intergenic
1109687729 13:65843600-65843622 GGAGGGGGTGGAGGAGGCAGGGG - Intergenic
1110337045 13:74345217-74345239 GGAGCCAGCTGAGGTGGTAGTGG + Intergenic
1111396156 13:87672135-87672157 GGAGCCAGAGGAGGCTGGAGGGG + Intergenic
1112008531 13:95274737-95274759 GTGGCCACAGGAGGAGGCAGAGG - Intronic
1112290039 13:98138264-98138286 GGAGAGAGTGGGGGAGGTAGAGG - Intergenic
1112333116 13:98492249-98492271 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1112453401 13:99533772-99533794 GGAGGCGGAGGTGGAGGCAGAGG - Intronic
1112860018 13:103818973-103818995 GGAGCCAGTGGAGAGGGGAGAGG + Intergenic
1112945368 13:104920582-104920604 TGTTCCAGTGGAGGTGGCAGGGG - Intergenic
1113298889 13:108994966-108994988 GGAGCTACTGGAGGAGACTGAGG - Intronic
1113412266 13:110100822-110100844 GGAGACAGTAGAGCAGGCAGTGG - Intergenic
1113445083 13:110359691-110359713 GGACACAGGAGAGGAGGCAGCGG - Intronic
1113730531 13:112638181-112638203 GTGGCCAGTGGGGCAGGCAGGGG - Intergenic
1113866427 13:113528653-113528675 GCAGCCGCTGGTGGAGGCAGTGG + Intronic
1113965083 13:114148008-114148030 CCAGCAAGTGGAGGAGGCCGGGG - Intergenic
1114142613 14:19932341-19932363 GGAGCAAGAGGAGGAGGAGGAGG - Intergenic
1114455104 14:22848981-22849003 GGAGCCAGTGGAGGAGCCTGGGG + Intronic
1114640580 14:24217025-24217047 GCATCCAGGGGAGGGGGCAGTGG + Exonic
1114640708 14:24218179-24218201 GGAGCGTGTGGAGGAGAAAGAGG - Exonic
1114648384 14:24268292-24268314 GCAGCCAGGGCAGGAGGCTGGGG - Intronic
1114675557 14:24437779-24437801 TGAGCTAGTGAAGAAGGCAGAGG + Exonic
1114702999 14:24697492-24697514 TGAGCGAGTGGAGGAGTAAGTGG + Intergenic
1114866136 14:26597733-26597755 GGAGAGAGTGGAGAAGGGAGAGG + Exonic
1115299301 14:31865899-31865921 TGTTCCAGTGGAGGTGGCAGGGG - Intergenic
1115399426 14:32939835-32939857 GGAGCAGGAGGAGGAGGCCGGGG + Intronic
1115405077 14:33006029-33006051 CGAGTCAGGGGAGGAGGCTGAGG - Intronic
1115755743 14:36524920-36524942 GGAGTCGGTGGAGAAGGTAGGGG - Intergenic
1115757914 14:36548197-36548219 CAAGCCAGAGGAGGTGGCAGTGG + Intergenic
1115886523 14:37977974-37977996 GGAGAAAGTGGGGTAGGCAGAGG + Intronic
1116081730 14:40182529-40182551 GGAGGAACAGGAGGAGGCAGTGG + Intergenic
1116335591 14:43652033-43652055 TGTTCCAGTGGAGGTGGCAGGGG - Intergenic
1117043771 14:51791841-51791863 GGATCCAGTGCAGGAGGCTCAGG + Intergenic
1117062096 14:51973574-51973596 GGAGCCAGTAGAGGTTGGAGGGG - Intronic
1117119648 14:52553396-52553418 GGAGACAGAGGAAGAGGCAGAGG - Exonic
1117397588 14:55326249-55326271 GGAGAAAGGGGAGGAGACAGAGG - Intronic
1117590316 14:57261486-57261508 GGAGACAGTGGTAGAGGTAGAGG - Intronic
1117667859 14:58076117-58076139 GGAGGAGGAGGAGGAGGCAGCGG + Intronic
1118002838 14:61539561-61539583 TGAGCCAGTGATGGAGGAAGTGG - Intronic
1118167809 14:63355403-63355425 GCAGCCGGTGGAGGAGCCGGAGG - Intergenic
1118213607 14:63788054-63788076 GGAGGCAGCAGAGGCGGCAGAGG + Intergenic
1118764516 14:68900829-68900851 GGGGAGAGTGGAGGAGGCCGAGG + Intronic
1118979120 14:70701770-70701792 GGAGGAAGAGGAGGAGGAAGGGG + Intergenic
1119084558 14:71727904-71727926 GGAGGCAGGGCAGGAAGCAGAGG - Intronic
1119330902 14:73792747-73792769 GGAACCAGTGTTGGAGGGAGAGG + Intergenic
1119397992 14:74342129-74342151 GGAGGCAGAGGCGGAGGCAGAGG + Intronic
1119401999 14:74369097-74369119 GGAGCGAGAGGAGGAGGCAGAGG + Intergenic
1119596379 14:75938370-75938392 GGAGCCAGTGGGGGAGCCCATGG + Intronic
1119761529 14:77155334-77155356 AGGGCAAGTGGAGCAGGCAGTGG - Intronic
1119920091 14:78438743-78438765 GGAGCTAGTGAAAGAGGCATAGG + Intronic
1120034240 14:79678140-79678162 GGGGCCAGTGGAGTAGGGGGAGG - Intronic
1120188581 14:81419685-81419707 TGGGCCAGTGGAGGTGGAAGAGG - Intronic
1120759837 14:88275245-88275267 GTAGGAAGTGGAGGAGCCAGAGG - Intronic
1120869174 14:89322008-89322030 AGGGCCAGTGGAGTAGGGAGTGG - Intronic
1121118054 14:91357536-91357558 GGAGACAGTGGAGGAGCAAAAGG - Intronic
1121118065 14:91357584-91357606 GGAGACAGTGGAGGAGCAAAAGG - Intronic
1121208951 14:92192134-92192156 TGAGGCAGGAGAGGAGGCAGAGG - Intergenic
1121242439 14:92440318-92440340 GAAGCCAGGGGAGGAGGGTGAGG + Intronic
1121249310 14:92487982-92488004 GGAGCGAGAGGAGGAGGAGGAGG - Intronic
1121506717 14:94483321-94483343 GGTGCCAGTGGCGCTGGCAGGGG - Intergenic
1121512139 14:94520251-94520273 GGAGGCAGTGGTGGTGACAGTGG + Intergenic
1121619102 14:95333808-95333830 GGTCCCAGGGGAGAAGGCAGGGG + Intergenic
1121819110 14:96951523-96951545 GGAGGCACGGGAGGAGGCTGGGG + Intergenic
1121956551 14:98218584-98218606 GGAGCAAAGGGAGTAGGCAGAGG + Intergenic
1122193321 14:100065521-100065543 GGAACCAGTGCAGGGGACAGAGG + Intronic
1122198453 14:100107391-100107413 GGAGCCAGGGAAGGAGGCTTGGG + Intronic
1122246988 14:100410310-100410332 GGAGACGGTGGAGGATACAGAGG + Intronic
1122315792 14:100825455-100825477 GGACCCAGTGGAAGAGGAAGGGG + Intergenic
1122322222 14:100861974-100861996 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1122322225 14:100861986-100862008 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1122426216 14:101607635-101607657 GGAGGAAGTGGAGGAGGAGGAGG - Intergenic
1122426307 14:101607981-101608003 GGAGGAAGTGGAGGAGGAGGAGG - Intergenic
1122429462 14:101630603-101630625 GGGGCCCGGGCAGGAGGCAGGGG - Intergenic
1122630138 14:103103984-103104006 GGCGCCAGGAGCGGAGGCAGCGG - Exonic
1122803944 14:104247412-104247434 GGAGCCGCTGGAGGTGCCAGGGG - Intergenic
1123218864 14:106838450-106838472 GGAACCGGTGGAGCAAGCAGGGG + Intergenic
1124372188 15:29110225-29110247 GGGGACAGTGGAGGAAGCTGGGG + Intronic
1124609799 15:31200745-31200767 GGAGGAAGAGGAGGAGGTAGCGG + Intergenic
1124632213 15:31344403-31344425 GGCTCCAGGGGAGGTGGCAGGGG + Intronic
1124667956 15:31609824-31609846 TGTTCCAGTGGAGGTGGCAGGGG - Intronic
1124720251 15:32105448-32105470 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1124813907 15:32968966-32968988 GGTGGCGGTGGAGGAGGCGGAGG + Exonic
1124950779 15:34318627-34318649 GGACCCAGAGGAGGGGGCAGCGG - Intronic
1125442912 15:39722539-39722561 GGAACTAGGGAAGGAGGCAGAGG - Intronic
1125453333 15:39831796-39831818 GGAGCCAGTGGAGGATACGGAGG - Intronic
1125544669 15:40494317-40494339 AGAGCCAGAAGAGTAGGCAGGGG - Intergenic
1125591436 15:40856899-40856921 GGAGACAGTGGAGCTGGCAGGGG - Exonic
1125604112 15:40930384-40930406 AGAGCCACTGGAGGAGGGGGTGG - Intronic
1125820517 15:42626263-42626285 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1126361089 15:47846689-47846711 GGAGGAAGAGGAGGAGGAAGAGG + Intergenic
1126456351 15:48866249-48866271 GGAACCAGTGAATGGGGCAGTGG - Intronic
1127298109 15:57627581-57627603 TGGGCCAGTGGAAGAGGCTGGGG - Intronic
1127789917 15:62390561-62390583 GGAGCCAGCGGCGGCGGCAGCGG + Intronic
1127968302 15:63940166-63940188 GGAGAAAGTGGGTGAGGCAGAGG - Intronic
1128199457 15:65792226-65792248 GGAGAAAGAGGCGGAGGCAGTGG - Intronic
1128376522 15:67080413-67080435 GGAGCAGGTGGGGGTGGCAGTGG + Intronic
1128535359 15:68486153-68486175 GAAGCCAGAGGACAAGGCAGTGG + Intergenic
1128541483 15:68537646-68537668 GGGGCCTGTGGGGGAGGCGGTGG - Intergenic
1128724386 15:69977066-69977088 AGAGCCAGTGTTGGAGGCACTGG + Intergenic
1128749739 15:70140437-70140459 GGAGCCACTGGAGGTGGAAGAGG - Intergenic
1128812127 15:70580392-70580414 GGAGCCAGTGGCTGAGCCGGTGG + Intergenic
1128869811 15:71145831-71145853 GGAGGGAGTGGAGGAAGGAGAGG + Intronic
1128972387 15:72118626-72118648 GGGGACAATGGAGGGGGCAGTGG - Intronic
1128992577 15:72272833-72272855 GGAGGCAGTGGAGAAGGAAGAGG + Intronic
1129097553 15:73225191-73225213 TGTTCCAGTGGAGGTGGCAGGGG + Intronic
1129206809 15:74042140-74042162 GGAGCCAGAGGATGAGGGAAGGG - Intronic
1129247452 15:74288152-74288174 GGAGCTAGTAGAGGATGGAGAGG - Intronic
1129360257 15:75019959-75019981 GGGGCATGGGGAGGAGGCAGAGG - Exonic
1129654503 15:77515057-77515079 GGGGACAGTGGAGGAGGATGTGG + Intergenic
1129660750 15:77551504-77551526 GGCGACAGAGCAGGAGGCAGGGG + Intergenic
1129683592 15:77671995-77672017 GGAGGAGGAGGAGGAGGCAGAGG - Intronic
1129752709 15:78077225-78077247 CAAGCCAGTGGCGGAGGCAGGGG + Intronic
1129797925 15:78392090-78392112 GGAGGTAGGAGAGGAGGCAGAGG - Intergenic
1130053455 15:80502965-80502987 AGACCCAGTGGATGAGGCTGGGG + Intronic
1130113988 15:80989986-80990008 GGACCAAGAGGAGGAGCCAGTGG - Intergenic
1130192534 15:81750427-81750449 GGAGGCAGAGGCGGAAGCAGAGG + Intergenic
1130546313 15:84859405-84859427 GGAGCCAGGTCAGGTGGCAGTGG - Intronic
1130673884 15:85935658-85935680 GGGGCCAGTGGGGGTGGGAGGGG - Intergenic
1130959921 15:88652609-88652631 GGGGACAGGGGAGGAGGAAGGGG - Intronic
1131043257 15:89292762-89292784 GGAGGAAGAGGAGGAGGAAGAGG + Exonic
1131087343 15:89588206-89588228 GGAGAGAGGGGAGGAGGAAGTGG + Intronic
1131367639 15:91853651-91853673 GGAGCCGGAGGAGGAGGCCAGGG + Intergenic
1131473307 15:92714737-92714759 GGAGCCGCTGGAGAAGGAAGGGG - Intronic
1131990293 15:98086499-98086521 GGAGGAAGAGGAGGAGGAAGAGG + Intergenic
1132127583 15:99241790-99241812 GGAGCCTGAGGAAGGGGCAGGGG + Intronic
1132398453 15:101490276-101490298 GGAGCCCATGGCGGAGGCCGCGG + Intronic
1132456852 16:28881-28903 GGGGCCAGAGGAGGAGTGAGGGG - Intergenic
1132598146 16:762486-762508 GGAGCCAGTCCAGGGGACAGAGG + Intronic
1132726115 16:1339054-1339076 GGAGCGAGGGCAGGAGGGAGCGG - Intronic
1132806130 16:1775992-1776014 GGAGGGCTTGGAGGAGGCAGGGG - Intronic
1132865283 16:2090132-2090154 GGAGCCCCTGGAGGAGCGAGAGG + Exonic
1132975727 16:2710210-2710232 GGGGGCAGAAGAGGAGGCAGGGG + Intergenic
1133018540 16:2955824-2955846 GGGGCCCGTGGAGGAGGGGGTGG + Intergenic
1133294506 16:4744744-4744766 GGGGGCAGTGGAGGAGCCTGAGG + Intronic
1133304285 16:4800104-4800126 GGGGGCAGGGGAGGAGGCTGGGG + Intronic
1133369683 16:5238561-5238583 GGAGACAGTGGAGGCAGGAGAGG - Intergenic
1133370997 16:5245435-5245457 GTAGCCAGTGGTTGAGGCTGTGG + Intergenic
1133392385 16:5420890-5420912 GGAGGCAGAGGAGGAGGGAGAGG - Intergenic
1133412878 16:5582743-5582765 CGAGGCAGGGCAGGAGGCAGAGG - Intergenic
1133754930 16:8755320-8755342 GGACTCTGTGTAGGAGGCAGAGG + Intronic
1133901381 16:9978507-9978529 GGAGGAAGTAGAGGAGGAAGGGG - Intronic
1133945663 16:10346024-10346046 GGAGGCAGGAGAGGAGGCAAGGG + Intronic
1134061967 16:11204765-11204787 GGGGTCTGTGGGGGAGGCAGTGG + Intergenic
1134066768 16:11233346-11233368 GGAGGCAGCGGAGGAGGAAGGGG - Intergenic
1134201079 16:12199528-12199550 GGACCCACAGGAGGGGGCAGGGG - Intronic
1134355843 16:13481503-13481525 GGAGGCTGTGGTGGAAGCAGAGG - Intergenic
1134385749 16:13770689-13770711 GGAGGAAGAGGAGGAGGAAGAGG + Intergenic
1134523165 16:14927736-14927758 GGGGCTGGGGGAGGAGGCAGGGG - Intronic
1134710832 16:16326387-16326409 GGGGCTGGGGGAGGAGGCAGGGG - Intergenic
1134948769 16:18342258-18342280 GGGGCTGGGGGAGGAGGCAGGGG + Intergenic
1134955754 16:18381483-18381505 GGGGCTAGGGGAGGAGGCAGGGG + Intergenic
1135078067 16:19410992-19411014 GGAGCACGTGGAGGGGGCAGCGG + Exonic
1135259016 16:20965147-20965169 GGAGCGACTGAGGGAGGCAGAGG - Exonic
1135421046 16:22305739-22305761 GCAGCAAGGGGAGGGGGCAGAGG - Intronic
1135508301 16:23058725-23058747 GGGGTCAGAGGAGGGGGCAGTGG - Intergenic
1135986048 16:27185125-27185147 GTAGCCAGAGCAGGAGGAAGCGG + Intergenic
1136062821 16:27738263-27738285 GGAGCCAGGGAAGGAGGAAGGGG + Intronic
1136417308 16:30112084-30112106 GGGGCCCCTGGAGGAGGAAGAGG + Intronic
1136450859 16:30353619-30353641 GGGGCCCGAGGAGGAGGCAAAGG - Exonic
1136469853 16:30472899-30472921 GTAGGCAAGGGAGGAGGCAGGGG + Intronic
1136498898 16:30659893-30659915 GGAGCCTGAGGAGGAGGAAGAGG + Exonic
1136517878 16:30778762-30778784 GGAGTCAGTGGGGAAAGCAGAGG - Exonic
1136533922 16:30888050-30888072 GGAGGCTTTGGAGAAGGCAGAGG - Intronic
1137003325 16:35250724-35250746 GTAGCCACTGGGGGAAGCAGAGG - Intergenic
1137621902 16:49881700-49881722 GGAAGCAGAGCAGGAGGCAGTGG + Intergenic
1138328070 16:56191759-56191781 GGAGGAGGTGGAGGAGGCGGCGG - Intronic
1138457610 16:57130458-57130480 GGAGGAAGTGAAGGAGGGAGGGG + Intronic
1138530392 16:57631436-57631458 GGAGGCCATGGAGGAGGCCGTGG + Intronic
1138534283 16:57651748-57651770 GGAGCCAGTGAAGGTGTCTGAGG + Intronic
1138634843 16:58330000-58330022 GGGGCCTGTCGATGAGGCAGGGG - Intronic
1138661022 16:58516814-58516836 GGAACCACTGGAGGAAGAAGAGG + Exonic
1138678113 16:58666416-58666438 GCTGGCAGGGGAGGAGGCAGAGG + Exonic
1138678896 16:58671186-58671208 GGTGCCAGTGGAGGAGGACGTGG - Exonic
1138703154 16:58886275-58886297 GGAGACAGAGCATGAGGCAGTGG + Intergenic
1139285092 16:65805666-65805688 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1139469812 16:67172097-67172119 AGAGCCAGAGAAGGAGGCAGAGG + Intronic
1139550128 16:67668282-67668304 GGAGGCTGAGGTGGAGGCAGAGG + Exonic
1139711565 16:68780245-68780267 GGAGGGAGTGCTGGAGGCAGTGG - Intronic
1140063120 16:71588798-71588820 GGAGGCGGAGGCGGAGGCAGAGG - Intergenic
1140188518 16:72795219-72795241 GGCGCTTGTGGAGGAGGCTGTGG + Exonic
1140209348 16:72958732-72958754 GGAGGAAGAGGAGGAGGAAGAGG - Exonic
1140221598 16:73048079-73048101 GGCGGCAGAGGAGGAGGCGGCGG - Exonic
1140275890 16:73508352-73508374 GGAGAAAGAGGAGGAGGAAGAGG + Intergenic
1140333027 16:74076169-74076191 GGGGCCTGTGGGGGAGGCAGGGG + Intergenic
1140560071 16:75969280-75969302 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1140560074 16:75969292-75969314 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1140560077 16:75969304-75969326 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1140560080 16:75969316-75969338 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1140854860 16:78969104-78969126 GAAGCCAGTGGAGCAGTCAGGGG + Intronic
1141137021 16:81473109-81473131 GGAGGCCGGGCAGGAGGCAGGGG - Intronic
1141145157 16:81524069-81524091 GGAACCCGTGAAAGAGGCAGAGG - Intronic
1141255844 16:82401816-82401838 GAAGCCTGTGGAAGAGACAGTGG + Intergenic
1141426447 16:83947504-83947526 GGAGCCACTGGCTGAGGAAGAGG + Intronic
1141473065 16:84252522-84252544 GGATCCAGTGGAGAGGGAAGAGG + Intergenic
1141617955 16:85220941-85220963 GGGGCCACTGGAGGAGGGGGTGG - Intergenic
1141631687 16:85291464-85291486 GGGGCCGGGGGAGGAGGCTGGGG - Intergenic
1141690760 16:85594967-85594989 GGGGCCAGGGGAACAGGCAGAGG + Intergenic
1141713980 16:85716513-85716535 GGAGACAGGGGAGAAGGAAGAGG + Intronic
1141783908 16:86185478-86185500 GAAGGCAGAGGAGGAAGCAGCGG + Intergenic
1141804511 16:86334035-86334057 GGAGGCAGTGGAGGGGTCTGCGG - Intergenic
1141814344 16:86399622-86399644 AGGGCCAGTGCAGGAGGCGGTGG + Intergenic
1141950592 16:87336649-87336671 GGAGCCAGAGAAGCAGGCTGAGG - Intronic
1142110564 16:88328896-88328918 GGAGGAAGCGGAGGAGGCCGAGG + Intergenic
1142126269 16:88412092-88412114 AGAGGCAGTTGGGGAGGCAGGGG + Intergenic
1142156057 16:88533350-88533372 GGAGGCGGTGGAGGAGCCGGAGG + Exonic
1142285894 16:89171424-89171446 GGAGCCAGAGGAGGATGGGGCGG - Intergenic
1142302470 16:89266630-89266652 TGAGCCAGTGGCGGGGGCAGTGG - Intergenic
1142396759 16:89836409-89836431 GGAGACAGTGGAGGAGGATCTGG - Intronic
1142471898 17:169343-169365 GGGGCCAGGGGAGGAGGAAGGGG + Intronic
1142536491 17:620401-620423 GGAGCTAGAGAAGGTGGCAGAGG + Intronic
1142581986 17:948878-948900 GGGGGGAGAGGAGGAGGCAGGGG - Intronic
1142581994 17:948897-948919 GGGGGGAGAGGAGGAGGCAGGGG - Intronic
1142582002 17:948916-948938 GGGGGGAGAGGAGGAGGCAGGGG - Intronic
1142582010 17:948935-948957 GGGGGGAGAGGAGGAGGCAGGGG - Intronic
1142582222 17:949485-949507 GGGGGGAGAGGAGGAGGCAGCGG - Intronic
1142582300 17:949694-949716 GCAGGGAGAGGAGGAGGCAGGGG - Intronic
1142836953 17:2594129-2594151 GGAGGCGGCGGCGGAGGCAGGGG - Intronic
1142953903 17:3507007-3507029 GGAGGGAGGGGAGGAGGGAGTGG + Intronic
1143140827 17:4740884-4740906 GGAGGAAGGGGAGGAGGAAGAGG + Exonic
1143247120 17:5496466-5496488 GGAGACAGTGAAGTAAGCAGTGG - Intergenic
1143365050 17:6401969-6401991 GGAGCAGGAGGAGGAGGGAGTGG + Intronic
1143383539 17:6510959-6510981 GGAGACAGTGGGGGTGGAAGAGG + Intronic
1143391239 17:6560539-6560561 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1143465125 17:7131386-7131408 GGGGCCAGAGAGGGAGGCAGGGG + Intergenic
1143524204 17:7462919-7462941 GGTGCCAGTGTGGGGGGCAGTGG - Exonic
1143700887 17:8659228-8659250 GGAGCTGGAGGTGGAGGCAGTGG + Intergenic
1143862273 17:9899563-9899585 GAAGCCAGTTAAGGAGCCAGTGG + Intronic
1143885911 17:10064677-10064699 GGAGCCAATGCAGAAGGAAGAGG + Intronic
1144235650 17:13258024-13258046 GGAGGCAGTGGAGGGGGAAGGGG - Intergenic
1144523137 17:15967563-15967585 GGAGAAGGTGGAGGATGCAGGGG + Intronic
1144580457 17:16456145-16456167 GGAGGGAGAGGAGGAGGAAGAGG + Intronic
1144580472 17:16456197-16456219 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1144725692 17:17501202-17501224 GAAGCCAGTGTAGTCGGCAGAGG - Intergenic
1144827547 17:18114776-18114798 CCAGCCAGAGGAGGAGGTAGAGG - Intronic
1145221624 17:21094203-21094225 GGAGAAAGAGGAGGAGGGAGAGG + Intergenic
1145267788 17:21388782-21388804 GGGGCCACTGGGGGAGGCGGTGG + Intronic
1145271885 17:21409228-21409250 GGGGCCAGGGGAGGAGGAGGAGG + Intronic
1145271890 17:21409243-21409265 GGAGGAGGTGGAGGAGGCAGAGG + Intronic
1145310097 17:21696693-21696715 GGGGCCAGGGGAGGAGGAGGAGG + Intronic
1145310103 17:21696708-21696730 GGAGGAGGTGGAGGAGGCGGAGG + Intronic
1145745402 17:27315545-27315567 TGAGGCAGTGGCAGAGGCAGAGG + Intergenic
1145751538 17:27358522-27358544 GGAGGCAGAGGTTGAGGCAGAGG - Intergenic
1145884010 17:28370369-28370391 GCAGCCGCTGGAGGGGGCAGAGG - Exonic
1145905028 17:28511555-28511577 GACCCCAGGGGAGGAGGCAGGGG + Intronic
1146053910 17:29571936-29571958 GGAGGCGGAGGAGGAAGCAGAGG + Exonic
1146449901 17:32964662-32964684 GGAGGCAGTGGAGGTGACAGAGG + Intergenic
1146492390 17:33292286-33292308 GGCGCCCGCGGAGGCGGCAGCGG - Exonic
1146655217 17:34630954-34630976 GGAGGCAGTAGAGTGGGCAGTGG + Intronic
1146803362 17:35844896-35844918 GGAGACCGTGGTGGTGGCAGTGG + Exonic
1147141069 17:38460917-38460939 GGAGGCCGTGGAGGAGGTAAGGG + Exonic
1147168442 17:38605259-38605281 GGGGGAAGTGGAGGATGCAGGGG - Intronic
1147498725 17:40942230-40942252 GGAGGAGGTGGAGGAGGAAGAGG - Intergenic
1147557704 17:41489823-41489845 AGACCCAGTGGAGAAGGTAGGGG + Exonic
1147644967 17:42027998-42028020 GGAGCCAGGGGAGGGGGTTGGGG - Intronic
1147648734 17:42050240-42050262 GGAGCCCGGGGAGGAGGCTCGGG - Intronic
1147710915 17:42463987-42464009 GGAGGCTGAGGAGGAGGAAGGGG + Intronic
1147888138 17:43698370-43698392 GGAGCCAGTGGCCCAGCCAGTGG - Intergenic
1147937889 17:44024085-44024107 AGAGCCAGTGTAGGTGGAAGAGG + Intergenic
1147976972 17:44253408-44253430 GGAGGGGGTGGAGGAGGCAGGGG - Intronic
1148044150 17:44732181-44732203 AGCATCAGTGGAGGAGGCAGTGG + Exonic
1148073390 17:44921599-44921621 GGAGCCAATCAGGGAGGCAGAGG - Intergenic
1148209788 17:45801173-45801195 GGAGCCTGTGGAGGGGGTGGAGG - Intronic
1148227453 17:45908885-45908907 GGAGCAGGTGGAGCAGGCAGAGG + Intronic
1148862038 17:50609537-50609559 GGAGCCAGCTGGGCAGGCAGGGG - Intronic
1149447666 17:56726131-56726153 GGACCCAGCAGAGGAGGAAGAGG + Intergenic
1149712550 17:58756252-58756274 GGAGCCCGAGGAGGAGGCGGCGG + Exonic
1149923544 17:60680717-60680739 GGAGACAGAGGAGGAGGTGGAGG - Intronic
1150004798 17:61463014-61463036 GAAGCCAATGGAGGGGACAGAGG + Intronic
1150129961 17:62663760-62663782 GGAACCAGTGCAAGGGGCAGGGG + Intronic
1150174290 17:63033800-63033822 GGACCCACAGGAGAAGGCAGAGG + Intronic
1150213709 17:63455625-63455647 TGAGGAAATGGAGGAGGCAGAGG + Intergenic
1150239840 17:63622604-63622626 GGAGCCTGGGGAGGCGGCGGGGG + Exonic
1150284981 17:63949435-63949457 GGACCCTGAGGAGCAGGCAGAGG - Exonic
1150525184 17:65915426-65915448 GGAGGCAGGAGAGGATGCAGGGG - Intronic
1150613752 17:66753367-66753389 GTGGCCAGTGGAGGAGTCAGTGG + Intronic
1150649459 17:67000515-67000537 GGAGCCAGGAGAGGGGGCAAGGG + Intronic
1150778659 17:68101617-68101639 GGGGCGGGTGGAGGAGGAAGCGG + Intergenic
1150859089 17:68782928-68782950 TGTGCCAGTGGAGGAGCCATTGG + Intergenic
1151175564 17:72285026-72285048 GGAGCCTGTGCAGGATGAAGAGG + Intergenic
1151250266 17:72828815-72828837 GGAGCCTTTGGAGGAGACAGTGG - Intronic
1151331304 17:73410840-73410862 AGAGCAAGAGGAGGTGGCAGAGG - Intronic
1151569829 17:74920728-74920750 GGAGGGAGTGGAGGGGGGAGGGG + Intronic
1152008116 17:77695089-77695111 GAAGCCAGAGTAGGAGGCAGGGG - Intergenic
1152035403 17:77869251-77869273 GGAGCCAGTGTCCCAGGCAGAGG + Intergenic
1152266236 17:79296663-79296685 GGAGGGAGGGGAGGAGGAAGAGG - Intronic
1152266239 17:79296675-79296697 GGAGGAAGGGGAGGAGGGAGGGG - Intronic
1152292072 17:79445704-79445726 GGAGCACATGGAGGAGGAAGGGG - Intronic
1152295153 17:79463203-79463225 GATGGCAGTGGAGGTGGCAGTGG - Intronic
1152295214 17:79463464-79463486 GATGGCAGTGGAGGTGGCAGTGG - Intronic
1152328827 17:79658658-79658680 GGCCTCAGGGGAGGAGGCAGTGG - Intergenic
1152565133 17:81096980-81097002 GGAGGAGGAGGAGGAGGCAGCGG + Intronic
1152587232 17:81194506-81194528 TGAGCCACAGGAGGAGGCAGGGG - Intronic
1152616811 17:81341663-81341685 GGCTCCAGTGGAGGACGCGGTGG + Intergenic
1152644289 17:81461634-81461656 GGAGCCTGAGGAGGAGGAGGTGG - Exonic
1152713757 17:81888314-81888336 GGCGCCCGTGGAAGAGGCAGAGG - Exonic
1152774417 17:82191574-82191596 GGAGGTTGAGGAGGAGGCAGAGG - Intronic
1152831598 17:82500728-82500750 GGAAGCACTGGAGGAGGCATGGG - Intergenic
1152922301 17:83072243-83072265 GGAGTCAGGGCAGGAGGCTGGGG - Intergenic
1152950449 17:83227231-83227253 GGGGTAAGTGGAGGAGGGAGGGG + Intergenic
1152960900 18:79674-79696 GGGGCCAGAGGAGGAGTGAGGGG - Intergenic
1153140351 18:1965156-1965178 GGAGCAGGAGGAGGAGGTAGAGG + Intergenic
1153164333 18:2244705-2244727 TGCTCCAGTGGAGGTGGCAGGGG - Intergenic
1153335873 18:3924377-3924399 GGTGGCAGTGGGGGAGGAAGTGG - Intronic
1153396333 18:4625582-4625604 TGCTCCAGTGGAGGTGGCAGGGG + Intergenic
1153410704 18:4789463-4789485 GCAGCAAGTGGAGGATGCAGTGG - Intergenic
1154012706 18:10589291-10589313 TGGGGCAGCGGAGGAGGCAGCGG + Intergenic
1154033335 18:10773448-10773470 GGAGTCAGAGGAGGACGGAGAGG - Exonic
1154070736 18:11149420-11149442 TGAGGCGGTGGAGGAGGGAGTGG - Intergenic
1154218807 18:12434354-12434376 GGTGGCAGTGGAGATGGCAGCGG - Intergenic
1154503594 18:15009949-15009971 GGAGGAAGAGAAGGAGGCAGGGG + Intergenic
1155152643 18:23135303-23135325 GGGGCCACGGGAGGAGGAAGAGG - Intronic
1155210627 18:23597715-23597737 GGGGAAGGTGGAGGAGGCAGTGG - Intergenic
1155496651 18:26449288-26449310 GGAGTTAATGGAGGAGGTAGGGG - Intergenic
1155512620 18:26593318-26593340 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1156217365 18:35013327-35013349 GCAGCCAGTGGACAAGGCATAGG + Intronic
1156398591 18:36720777-36720799 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1156398594 18:36720789-36720811 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1156501465 18:37562183-37562205 GGAGTCTGTGGAGGAGGGAGTGG - Intronic
1156918166 18:42485963-42485985 GGAAGCAGTGGAGGAGGAGGAGG - Intergenic
1156944717 18:42814824-42814846 TGATCCAGTGGAGGTGGCGGCGG - Intronic
1157198147 18:45636897-45636919 GGAGGCAGTGGATGATACAGTGG + Intronic
1157447129 18:47754392-47754414 GGCGCCAGGGCAGGAGGCTGGGG - Intergenic
1157618788 18:49003376-49003398 GGAGGCAGGGGAGGAGGGAGAGG - Intergenic
1157742491 18:50106049-50106071 GGAGCAGGCGGAGGATGCAGGGG - Intronic
1157768598 18:50324834-50324856 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1157768604 18:50324861-50324883 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1157768612 18:50324897-50324919 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1157802165 18:50629688-50629710 GAAACCACTGGAGAAGGCAGGGG + Intronic
1158351964 18:56572597-56572619 GGCGCTCGTGGAGGAGGCTGGGG - Intergenic
1158803125 18:60936805-60936827 GGAGCAGGAGGAAGAGGCAGGGG + Intergenic
1159573864 18:70152088-70152110 GGAGCCAGAAGTGGAGACAGAGG - Intronic
1159889896 18:73943471-73943493 GGAGCCAGAGGGGAAGGCAGGGG + Intergenic
1159894450 18:73983222-73983244 GGAGGCAGTAGAGGAGGTGGTGG + Intergenic
1159984761 18:74828933-74828955 GGAGGCAGAGGGGGAGGTAGAGG - Intronic
1160011515 18:75110053-75110075 CAAGCCAGGGGAGGAGGGAGAGG + Intergenic
1160123398 18:76149591-76149613 TGAGCCAATGCAGGAGTCAGGGG + Intergenic
1160208661 18:76858683-76858705 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208674 18:76858727-76858749 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208701 18:76858815-76858837 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208715 18:76858859-76858881 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208743 18:76858947-76858969 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208771 18:76859035-76859057 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208785 18:76859079-76859101 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208799 18:76859123-76859145 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208814 18:76859167-76859189 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160208841 18:76859255-76859277 GGTGCAGGTGGAGGAGGAAGGGG + Intronic
1160258529 18:77267814-77267836 GTGGCCAGTGGAGGAGGCCATGG + Intronic
1160267543 18:77353444-77353466 TGTTCCAGTGGAGGTGGCAGCGG + Intergenic
1160287489 18:77558432-77558454 GGAGGCAGAGGTGGAGGTAGGGG - Intergenic
1160299387 18:77666555-77666577 GGATCCAGTGGAGAATGCTGGGG + Intergenic
1160306595 18:77745585-77745607 GGAGAAAGTGGAGGAGGAAGAGG + Intergenic
1160845671 19:1164977-1164999 GGAGGAGGAGGAGGAGGCAGCGG + Intronic
1160872036 19:1282079-1282101 GGAGGAAGGGGAGGAGGGAGGGG + Intergenic
1160932854 19:1578760-1578782 GGTCCCAGTAGAGGTGGCAGGGG - Intronic
1160941421 19:1622028-1622050 GGACCCAGGGCAGGGGGCAGGGG - Intronic
1161022104 19:2015460-2015482 GGAGCGGGCGGAGGAGGCGGCGG - Exonic
1161288274 19:3479733-3479755 GGGGCTTGTAGAGGAGGCAGAGG + Intronic
1161335197 19:3709197-3709219 GGAGGCAGAGGTGGAGGCAGAGG - Intronic
1161415751 19:4145507-4145529 GGAGGCTGAGGAGGAGGGAGAGG + Intergenic
1161607366 19:5222472-5222494 GGAGCAAGGGGAGGGGGCAGTGG + Intronic
1161683052 19:5690095-5690117 GGAACCAGTGGAGGTGGCTATGG - Exonic
1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG + Intronic
1161985395 19:7650639-7650661 GGTGCCTGGGGAGGGGGCAGAGG + Intergenic
1162053130 19:8046918-8046940 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1162100218 19:8334656-8334678 CGAGGCTGCGGAGGAGGCAGCGG - Exonic
1162181467 19:8871914-8871936 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1162181470 19:8871926-8871948 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1162478248 19:10913745-10913767 GGCGCCAGCGAAGCAGGCAGAGG + Intronic
1162479806 19:10921597-10921619 GGACCCTGTGGAGCAGGCAATGG - Exonic
1163198680 19:15746051-15746073 GGAGGACGTGGAGGAGGAAGGGG - Intergenic
1163374783 19:16923326-16923348 GGACCCAGTGGCGGCGACAGAGG + Intronic
1163479913 19:17549005-17549027 GGAGCCAGGGAATGAGGGAGAGG + Intronic
1163545208 19:17937304-17937326 GGAGGCACTGGAGATGGCAGAGG + Intronic
1163581980 19:18144615-18144637 GGTGGCAGTGGTGGCGGCAGTGG + Exonic
1163630444 19:18415580-18415602 GGAGGAAGAGGAGGAGGGAGAGG + Intergenic
1163644711 19:18482437-18482459 GGAGGCAGAGGCAGAGGCAGAGG - Intronic
1163655196 19:18541841-18541863 GGAGGAAGAGGAGGAGGAAGAGG - Exonic
1163728046 19:18933463-18933485 AGAGCCAGTGGTCCAGGCAGTGG - Intronic
1163745214 19:19042837-19042859 GGAGGCAGTGAAAGAGGCCGTGG + Exonic
1163797567 19:19346223-19346245 GGAGCGAGGTGAGGAGGCAGAGG - Intronic
1164109156 19:22138194-22138216 GGAGCTAGAGGAGGAAGAAGAGG + Intergenic
1164147901 19:22523703-22523725 AGAGTCAGAGGAGGAGGAAGAGG + Intronic
1164324764 19:24181430-24181452 GGAGGAAGAGGAGGAGACAGAGG + Intergenic
1164596042 19:29531081-29531103 GGAGCCATTGGCAGAGGCAGGGG + Intronic
1164801661 19:31081723-31081745 GGTGGCAGTGGAGGAGGAAATGG + Intergenic
1164834625 19:31349485-31349507 GGAGGCAGAGGAGGAGGAGGTGG + Exonic
1164866294 19:31607047-31607069 GGAGCCAGAGGAAGAGAGAGGGG - Intergenic
1164868630 19:31625608-31625630 GGAGGAAGAGGAGGAGGCTGGGG - Intergenic
1164868635 19:31625620-31625642 GGAGAGAGTGGAGGAGGAAGAGG - Intergenic
1164897647 19:31891139-31891161 GAAGCCAGTGGAGCAGGAGGAGG - Intergenic
1165090833 19:33387676-33387698 GGAGCCCCTGGAGCGGGCAGGGG + Intronic
1165139507 19:33690326-33690348 GGGGCCAGAGGTGTAGGCAGAGG + Intronic
1165422069 19:35727315-35727337 GGGGCCTGTGGTGGGGGCAGGGG - Intronic
1165434139 19:35787495-35787517 GGAGCCTGCTGAGGAGCCAGCGG + Exonic
1165477683 19:36040686-36040708 AGGGGCAGTGGAGGGGGCAGAGG - Intronic
1165776175 19:38405569-38405591 GGCGCTTGAGGAGGAGGCAGCGG - Exonic
1165982722 19:39738190-39738212 GGAGGTACTGGAGGAGGAAGGGG + Intergenic
1165989715 19:39803197-39803219 GGAGGGAGAGGAGGAGACAGAGG + Intergenic
1166131694 19:40749613-40749635 GCAGCGGGTGGAGGAGGCAGTGG + Exonic
1166140012 19:40800489-40800511 GGAGGCGGAGGAGGAGGCGGAGG + Exonic
1166178984 19:41094002-41094024 TGATCCAGAGGAGCAGGCAGCGG - Intronic
1166197965 19:41219196-41219218 GGAGTGAGGGAAGGAGGCAGGGG + Exonic
1166337428 19:42116832-42116854 GGAGGCAGAGGAGGAGGAGGAGG + Intronic
1166375309 19:42324283-42324305 GAAGCAGGTGGAGGAGACAGCGG + Intronic
1166678420 19:44753608-44753630 GGAGCCGGTGGCGCAGGCTGGGG - Intronic
1166700317 19:44878366-44878388 GGAGCAGGAGGAGGAGCCAGTGG + Intronic
1166719295 19:44988232-44988254 GGAGGGAGGGGAGGAGGAAGGGG - Intronic
1166794897 19:45420171-45420193 GGACCCTGTGTTGGAGGCAGGGG - Intronic
1166860042 19:45804782-45804804 GGAGGCAGAGGAGGAGGAGGTGG - Exonic
1166860046 19:45804794-45804816 GGAGGGCGAGGAGGAGGCAGAGG - Exonic
1166988934 19:46678983-46679005 CGACCCATTGGAGGTGGCAGAGG - Intronic
1166994637 19:46714334-46714356 TGAGCCTGGGGAGGAGGCACAGG - Intronic
1167015544 19:46838689-46838711 GGAGCCAGAGGAGGGGGACGGGG - Intronic
1167019074 19:46861027-46861049 GGAGGAGGTGGAGGAGGCGGAGG + Intergenic
1167245886 19:48373059-48373081 GGAGAGTGTGGGGGAGGCAGGGG + Intronic
1167281623 19:48572631-48572653 GAGGCCAGAGGAGGAGGCACTGG + Intronic
1167377064 19:49118040-49118062 GGAGCCCGTGGAGGCCCCAGGGG - Intronic
1167389883 19:49188009-49188031 GGAGCAATTGGGGGAGCCAGAGG + Intronic
1167465855 19:49650949-49650971 GGATGCAGAGGAGGGGGCAGGGG - Exonic
1167465944 19:49651193-49651215 GGAGGAAGAGGAGGAGGAAGAGG + Exonic
1167634969 19:50649106-50649128 GGACAGAGGGGAGGAGGCAGGGG + Intronic
1167640432 19:50678709-50678731 AGAGACAGTGGAGGAGTCAAAGG + Intronic
1167686413 19:50959665-50959687 GGAGAGAGAGGAGGAGGAAGAGG + Intronic
1167686424 19:50959715-50959737 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1167686431 19:50959742-50959764 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1167686440 19:50959778-50959800 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1167686448 19:50959811-50959833 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1167719669 19:51169814-51169836 GGAGTCTGTGGAGGAGTCTGCGG - Intergenic
1167773803 19:51541738-51541760 GGAGGCAGAGGAGGGAGCAGCGG - Intergenic
1167852266 19:52211277-52211299 GGCCACAGTGGAGGAGACAGTGG + Exonic
1168418215 19:56182996-56183018 GGAGCAGGGGGAGGAGGGAGAGG - Intronic
1168433958 19:56302983-56303005 GGTGCTAGTGCAGGAGGCAGTGG + Intronic
1168478334 19:56695020-56695042 GGAGCAAGTGATGGAGGCATGGG + Intergenic
1168650179 19:58087478-58087500 GGGGCCTGTGTGGGAGGCAGCGG - Intronic
1168691506 19:58380474-58380496 GGCGCCAGGGAGGGAGGCAGCGG + Intronic
1168712716 19:58511234-58511256 GGAGCCAGTGGAGAATGGAAGGG - Intronic
925169769 2:1743712-1743734 GGAGGAAGGGGAGGAGGAAGAGG + Intronic
925317140 2:2935271-2935293 GTAGGCTGAGGAGGAGGCAGAGG + Intergenic
925558018 2:5153508-5153530 AGATCCACAGGAGGAGGCAGGGG - Intergenic
925681414 2:6425623-6425645 GGAGCCAGAGGAGGAAGCACAGG - Intergenic
925886765 2:8400429-8400451 GGGCCGAGTGGAGAAGGCAGGGG - Intergenic
926023600 2:9519135-9519157 GGAGGCTGAGGATGAGGCAGTGG - Intronic
926035581 2:9632727-9632749 GAAGCCAGTGGAGGTGGATGGGG + Intergenic
926181320 2:10646290-10646312 TGAGCCAGTGGAGAAGGCTTAGG - Intronic
926208024 2:10847764-10847786 AGAGGCAGTGGCGGAGCCAGCGG + Intronic
926977086 2:18525959-18525981 GCTGCCAGAGGAGGAGGAAGGGG - Intergenic
927069896 2:19517174-19517196 GGAGGCAGTGGCAGAAGCAGTGG - Intergenic
927487196 2:23496579-23496601 GGGGCCAGCGGTGGAGGGAGGGG + Intronic
927736358 2:25526057-25526079 GGAGCCCCAGGTGGAGGCAGGGG + Intronic
927810694 2:26178890-26178912 GGAGGCGGAGGCGGAGGCAGAGG + Intronic
927826729 2:26314487-26314509 GAAGCCAGGGGAGGTGGCACAGG + Exonic
927843984 2:26462005-26462027 GGGGGCAGGAGAGGAGGCAGAGG - Intronic
927845026 2:26466998-26467020 GGAGGCAGTGGCCGGGGCAGTGG + Intronic
927860757 2:26558661-26558683 GGAGGAGGAGGAGGAGGCAGCGG - Exonic
927948595 2:27152464-27152486 GGAGCCATCTGAGGAGGGAGAGG - Intronic
928086596 2:28350035-28350057 GGAGGAAGAGGAGGAGGAAGTGG - Intergenic
928086599 2:28350047-28350069 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
928093925 2:28392721-28392743 GGAGGCCGCGGAGGAGGAAGAGG - Intronic
928105827 2:28470057-28470079 GGAGAAAGAGGAGGAGGAAGGGG + Intronic
928109751 2:28496919-28496941 AGAGAGAGTGGAGGAGGCATGGG + Intronic
928172863 2:29014570-29014592 GGAGCGGGAGGAGGAGGAAGTGG + Intronic
928205113 2:29278422-29278444 GGGACCAGGAGAGGAGGCAGAGG + Intronic
928405156 2:31009176-31009198 AGAACAAATGGAGGAGGCAGAGG + Intronic
928443180 2:31310948-31310970 TGCTCCAGTGGAGGTGGCAGGGG + Intergenic
928511869 2:32010397-32010419 GGAGGAAGAGGAGGAGGCGGCGG + Exonic
928585270 2:32753519-32753541 GGAGGCAGAGTGGGAGGCAGAGG - Intronic
928669397 2:33585311-33585333 GGAGGCCGAGGAGGAGGGAGAGG - Exonic
928838340 2:35575195-35575217 GGTGCCAGTGGTGGTGGCAATGG + Intergenic
929310789 2:40421897-40421919 CGAGCCAGGAGAGGAGGCAATGG + Intronic
929470000 2:42182305-42182327 GAAACCAGTGGAGGGGGGAGGGG - Intronic
929584634 2:43106031-43106053 GGAGCTAGAGGAGGAGGAGGAGG - Intergenic
929588080 2:43128393-43128415 GGAGGCAGTGAAGGGGGAAGAGG + Intergenic
929778264 2:44941955-44941977 GGAGCAGGAGGAGGAGGGAGAGG - Exonic
929998569 2:46845786-46845808 GGAGACAGAGGAACAGGCAGAGG - Intronic
930063478 2:47310172-47310194 GGAGCCAGGGGAGAAGGGTGTGG - Intergenic
930639535 2:53840616-53840638 GGAGGGAGTGGAGGGGGGAGGGG + Intergenic
930733021 2:54745990-54746012 GGAGCTGGTGGTGGAGGAAGTGG + Intronic
930874008 2:56193326-56193348 GGAGGCAGTGGAGGAAGTGGAGG + Exonic
931136938 2:59413954-59413976 TGCTCCAGTGGAGGTGGCAGGGG + Intergenic
931426681 2:62178096-62178118 GGTGTATGTGGAGGAGGCAGAGG - Intergenic
931643126 2:64398895-64398917 GGAGCAAGAGGAGGAGGAAGAGG + Intergenic
931643129 2:64398907-64398929 GGAGGAAGAGGAGGAGGAAGTGG + Intergenic
931657593 2:64524372-64524394 GGAGGAGGTGGAGGAGGCGGCGG + Exonic
932068199 2:68589192-68589214 GGAGCCAGTGTAGGAAGTGGTGG - Intronic
932599699 2:73114966-73114988 GAAACCAGTAGAGTAGGCAGAGG + Intronic
932735652 2:74252305-74252327 GGAGCTCCTGGAGGAGGCAATGG - Exonic
932949550 2:76276923-76276945 GGAAGAAGAGGAGGAGGCAGAGG + Intergenic
933121409 2:78542290-78542312 TGTTCCAGTGGAGGTGGCAGGGG - Intergenic
933666775 2:84971032-84971054 GGAGGCGGAGGAGGAGGAAGAGG + Intergenic
933708338 2:85307695-85307717 GCAGCAAGTCCAGGAGGCAGAGG + Exonic
934784659 2:96996237-96996259 GGAGGGAGAGGAGGAGGAAGAGG - Intronic
934897584 2:98132273-98132295 GCAGGGAGTGGAGAAGGCAGGGG - Intronic
934973832 2:98786453-98786475 TGAGGCAGAGCAGGAGGCAGTGG - Intergenic
935088211 2:99869033-99869055 GGAGGCAGAGGCAGAGGCAGAGG - Intronic
935196606 2:100820090-100820112 GGAGGCAGGGGAGGAGGCAGAGG + Intergenic
935220069 2:101004592-101004614 GAGCCCAGTGGAGGAGGGAGGGG + Intronic
935337281 2:102028220-102028242 GGAGAACGTGGAGGAGGCTGTGG - Exonic
935463073 2:103361939-103361961 GGAGGCGGAGGAGGAGGCGGAGG - Intergenic
936372991 2:111918559-111918581 GCTGCCAGTGGAGAAAGCAGAGG + Intronic
936528011 2:113255211-113255233 GGAGGGAGGGGAGGAGGGAGGGG + Intronic
936528017 2:113255223-113255245 GGAGGGAGGGGAGGAGGGAGGGG + Intronic
936528034 2:113255258-113255280 GGAGGGAGGGGAGGAGGGAGGGG + Intronic
936528051 2:113255293-113255315 GGAGGGAGGGGAGGAGGGAGGGG + Intronic
936633839 2:114233737-114233759 TGCTCCAGTGGAGGTGGCAGAGG + Intergenic
936934563 2:117826759-117826781 GAGGGCAGGGGAGGAGGCAGAGG - Intronic
936939613 2:117870996-117871018 GGTGGCAGCGGAGGAGGCAGCGG - Intergenic
936939662 2:117871129-117871151 GGAGGCGGTGGAGGAGGAGGAGG - Intergenic
937053553 2:118912111-118912133 GGACCCAGTGGAAGTGGCACAGG + Intergenic
937085724 2:119170480-119170502 GCAGCCTGAGGATGAGGCAGAGG - Intergenic
937132617 2:119524504-119524526 GCTGGCAGGGGAGGAGGCAGAGG + Intergenic
937326161 2:120990504-120990526 AGAGGCTGTGGAGGAGGCTGGGG - Exonic
937572524 2:123381274-123381296 TGATCCAGTGGAGGTGGCAGAGG - Intergenic
938099902 2:128491533-128491555 GGAGCCAGTGTGGGCGGCAAGGG + Intergenic
938275176 2:130014172-130014194 GGATTCAGTGGAGGATACAGTGG - Intergenic
938326135 2:130404896-130404918 GGATACAGTGGAGGATACAGTGG - Intergenic
938363804 2:130716563-130716585 GGATACAGTGGAGGATACAGTGG + Intergenic
938440189 2:131323107-131323129 GGATACAGTGGAGGATACAGTGG + Intronic
938502768 2:131840080-131840102 GGAGGAAGAGAAGGAGGCAGGGG + Intergenic
938579552 2:132633951-132633973 GGAGGCAGTGGTGGAAACAGTGG + Intronic
938606058 2:132894058-132894080 GGAGCCAGTTGCTGAGGCAAAGG + Intronic
938611246 2:132949528-132949550 GGAGACAGAGGAAGGGGCAGAGG - Intronic
938614859 2:132987161-132987183 AGAGCCAGTGGAGGACACACAGG - Intronic
938825927 2:135005291-135005313 AGAGGGAGTGGAGGAGGGAGAGG - Intronic
938937581 2:136140585-136140607 AGAGCCAAGGGAGGAGGCAGGGG - Intergenic
939865647 2:147469580-147469602 GGCAGCAGGGGAGGAGGCAGTGG - Intergenic
940340100 2:152571159-152571181 GGAGGAAAAGGAGGAGGCAGAGG - Intronic
940389940 2:153120746-153120768 AGAGCCAGAGGAGGAGTGAGAGG + Intergenic
940709344 2:157143712-157143734 TGTTCCAGTGGAGGTGGCAGGGG + Intergenic
940802213 2:158145233-158145255 TGTTCCAGTGGAGGTGGCAGAGG - Intergenic
940830093 2:158457080-158457102 GGGGCCGGTGGGGGAGGGAGGGG + Intronic
941250451 2:163154991-163155013 GGAGCCAGTGAAGCAGGTAGAGG + Intergenic
941752127 2:169144487-169144509 GGACCCTGAGGAGAAGGCAGAGG - Intronic
941844882 2:170122504-170122526 AGAGCCAGGGGAGGAGGGGGAGG - Intergenic
942046650 2:172102808-172102830 GCGGGCAGTGGAGGGGGCAGGGG + Exonic
942213721 2:173697145-173697167 GGAGCCTGGGGAGGTGGCGGTGG + Intergenic
942640822 2:178059147-178059169 GGAGCTAGGGCAGGAGGCAGAGG - Intronic
942695971 2:178645961-178645983 GGAGCAGGTGGAGGAGGTGGGGG + Exonic
942817581 2:180070435-180070457 GGTGCCAGGCGGGGAGGCAGTGG + Intergenic
943069272 2:183121746-183121768 GGAATCAGTGGAGGTTGCAGTGG + Intronic
943330771 2:186556340-186556362 GGAGGCAGTGGGGGAGACAGAGG - Intergenic
943521050 2:188949619-188949641 TGAGCCAGTGCAGGAGCCAGGGG - Intergenic
944715927 2:202376245-202376267 GGAGACTGAGGAGGAGGCGGAGG + Intergenic
945141404 2:206690504-206690526 GGAGACCGAGGAGGAAGCAGGGG + Intronic
945530645 2:210950131-210950153 GGAGACTGTGGGGGAGACAGAGG - Intergenic
945727853 2:213494889-213494911 GGAGTCTGTGGAGAAGGTAGTGG - Intronic
945950575 2:216035196-216035218 AGAGACATTGGAGGAGGAAGAGG + Intronic
946142889 2:217706589-217706611 GGAGAAAGGGGAGGAGGAAGGGG + Intronic
946195002 2:218027629-218027651 GAAGTCAGTGCGGGAGGCAGAGG - Intergenic
946214427 2:218173199-218173221 GGGGCCAGGAGAGAAGGCAGGGG - Intergenic
946232740 2:218302599-218302621 GGAGACTGGGGAGGTGGCAGGGG + Intronic
946394547 2:219436538-219436560 GGAGGCTGGGGAGGAGGCACAGG + Intronic
946427712 2:219608303-219608325 GGAGCCACAGGAGGAGGAAGAGG + Exonic
946436349 2:219658457-219658479 GGAGCCAGAGGAGGAAAGAGAGG - Intergenic
946782641 2:223206441-223206463 GGTACCAGTGGTGGTGGCAGTGG - Intergenic
947330814 2:229027573-229027595 GTGTTCAGTGGAGGAGGCAGTGG + Intronic
947518925 2:230829121-230829143 GCACTCAGTGGGGGAGGCAGAGG - Intergenic
947590197 2:231381026-231381048 GGAAACAGTGGAGGATGTAGTGG - Intergenic
947590204 2:231381067-231381089 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590208 2:231381079-231381101 GGAGGGAGTGGAGGATGGAGTGG - Intergenic
947590217 2:231381114-231381136 GGAGACAGTAGAGGATGGAGTGG - Intergenic
947590223 2:231381150-231381172 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590236 2:231381193-231381215 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590243 2:231381217-231381239 GGAGACAGTGGAGGATGGAGTGG - Intergenic
947590246 2:231381229-231381251 GGATGGAGTGGAGGAGACAGTGG - Intergenic
947590248 2:231381241-231381263 GGAGAGAGTGGAGGATGGAGTGG - Intergenic
947590253 2:231381265-231381287 GGAGGGAGTGGAGGATGGAGTGG - Intergenic
947590256 2:231381277-231381299 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590260 2:231381289-231381311 GGAGGGAGTGGAGGATGGAGTGG - Intergenic
947590263 2:231381301-231381323 GGAGGGAGTGGAGGAGGGAGTGG - Intergenic
947590267 2:231381313-231381335 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590282 2:231381361-231381383 GGAGACAGTGGAGGAGGGAGTGG - Intergenic
947590286 2:231381373-231381395 GGAGGGAGTGGAGGAGACAGTGG - Intergenic
947590288 2:231381385-231381407 GGAGGGAGTGGAGGAGGGAGTGG - Intergenic
947590292 2:231381397-231381419 GGAGACAGTGGAGGAGGGAGTGG - Intergenic
947590296 2:231381409-231381431 GGAGGGAGTGGAGGAGACAGTGG - Intergenic
947590298 2:231381421-231381443 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590302 2:231381433-231381455 GGAGGGAGTGGAGGATGGAGTGG - Intergenic
947590305 2:231381445-231381467 GGAGAGAGTGGAGGAGGGAGTGG - Intergenic
947590321 2:231381521-231381543 GGATGGAGTGGAGGAGGGAGTGG - Intergenic
947590335 2:231381581-231381603 GGAGACAGTGGAGAATGGAGTGG - Intergenic
947590337 2:231381593-231381615 GGAGGGAGTAGAGGAGACAGTGG - Intergenic
947590356 2:231381687-231381709 GGAGAGAGTGGAGGATGGAGTGG - Intergenic
947590361 2:231381711-231381733 GGAGGGAGTGGAGGATGGAGTGG - Intergenic
947590364 2:231381723-231381745 GGAGACAGTGAAGGAGGGAGTGG - Intergenic
947665271 2:231901339-231901361 GAAGCCAGGGGAGGAGGCACTGG - Intergenic
947667968 2:231918953-231918975 ACAGCCATTGGGGGAGGCAGGGG - Intergenic
947714584 2:232333264-232333286 GGAGGCAGAGGAGGAGGAGGAGG - Intronic
947721760 2:232373965-232373987 TGAGCCACTGCAGGAGGCTGAGG + Intergenic
947747596 2:232516989-232517011 GGAGGCAGTGAGGGAGGAAGAGG + Intergenic
947817694 2:233048994-233049016 GCAGCCAACGGAGAAGGCAGGGG + Intergenic
947869770 2:233428126-233428148 GGAGCCAGAGGAGGAGGAGGTGG + Intronic
947901582 2:233725264-233725286 GGAGGCAGAGGCAGAGGCAGAGG + Intronic
948048070 2:234958616-234958638 GGAGCCAGTGGAGGAGCAGCTGG + Intronic
948054131 2:234998720-234998742 GTAGCCAGAGGCGGGGGCAGGGG - Intronic
948115656 2:235493320-235493342 GAACCCCGTGGAGCAGGCAGCGG + Intergenic
948229058 2:236336475-236336497 GGTGCCAGTGGTGGTGGCCGTGG - Intronic
948310461 2:236981898-236981920 ACAGCCTGTGGAGGAGGCTGTGG + Intergenic
948388852 2:237598111-237598133 GGGGACAGTGGAGGACGGAGAGG - Intronic
948388903 2:237598228-237598250 GGGGACAGTGGAGGAAGGAGAGG - Intronic
948390593 2:237608617-237608639 GCAGCCTGGGGAGGAGGGAGAGG - Intergenic
948463928 2:238143251-238143273 GGAGCATGGGGAGGAGGCAGCGG - Intronic
948465187 2:238148748-238148770 GGGGCCTGTGGAGGGTGCAGGGG - Intronic
948583944 2:239006816-239006838 GGAGACAGTGGAGCAGAGAGTGG - Intergenic
948722367 2:239909067-239909089 GGAGGCGCTGGAGGAGGCAGTGG - Intronic
948756061 2:240160371-240160393 AGAGCCTGGGGGGGAGGCAGGGG - Intergenic
948811705 2:240481737-240481759 GAGGCCAGTGGTGGAGGGAGGGG + Intronic
948867109 2:240781772-240781794 GGAGCCAGGCGAGGAAGCTGAGG - Intronic
948921008 2:241065916-241065938 GGAGCCAGTGTGGGAGACAGGGG + Intronic
949000250 2:241609156-241609178 GGTGGCCGTGGTGGAGGCAGTGG + Intronic
949001599 2:241617716-241617738 GTAGCTGGTGGAGGAGGCTGAGG - Intronic
1168842242 20:916912-916934 AGAGGGAGGGGAGGAGGCAGAGG + Intergenic
1168895936 20:1323537-1323559 GGATCCAGAGAAGGTGGCAGTGG - Intronic
1168901174 20:1366243-1366265 GGAGGCAGGGGTGGGGGCAGTGG - Intronic
1168978676 20:1986984-1987006 GGAGCCAGCATAGGAGGCCGTGG - Intronic
1169002396 20:2177470-2177492 GGTGCCAGAGAAGGTGGCAGGGG - Intergenic
1169006708 20:2213352-2213374 TGCGCCAGTGGAGGAGTCCGGGG + Intergenic
1169020353 20:2326403-2326425 GAGGCCAGAGGAGGAAGCAGAGG - Intronic
1169052761 20:2594656-2594678 GGAGCCACTGGAGGAGGTGAAGG + Intronic
1169064968 20:2690018-2690040 GGAGCTAAGGGAGGAGGCTGTGG + Intergenic
1169142819 20:3235792-3235814 GGAGCCAGTGGTCAGGGCAGGGG - Intronic
1169758731 20:9068755-9068777 GGGGGCAGGGGAGGAGGAAGCGG + Intronic
1170039164 20:12022322-12022344 GGAGGCAGGGGAGGAGGGTGGGG - Intergenic
1170064657 20:12298664-12298686 GGCCCCAGTGGTGGAAGCAGTGG + Intergenic
1170305272 20:14931217-14931239 GGAGCCAGTGAATGAGACATAGG + Intronic
1170395216 20:15918818-15918840 GGAGCCCCATGAGGAGGCAGTGG - Intronic
1170656461 20:18291485-18291507 AGAGCCAGTAAAGGAGACAGAGG - Intronic
1170728924 20:18955543-18955565 GGAGTCAGGGGGGAAGGCAGGGG - Intergenic
1170779624 20:19412607-19412629 GGAGCAAGAGGAGGAGGAGGAGG + Intronic
1171013638 20:21521979-21522001 GGAGGCGGAGGAGGAGGGAGGGG - Intergenic
1171066892 20:22026351-22026373 TGCTCCAGTGGAGGAGGCAGGGG + Intergenic
1171130794 20:22651569-22651591 AGAGTAAGTGGAGCAGGCAGTGG - Intergenic
1171339065 20:24412907-24412929 GGGGCCAGTGGCAGAGGCAGAGG - Intergenic
1171385337 20:24765968-24765990 GCAGCCAGCGGTGGAGGCAGTGG - Intergenic
1171452782 20:25247848-25247870 GGAGCGACTGGAGGGGGCAAGGG - Intergenic
1172007096 20:31825007-31825029 CGTTCCAGTGGAGAAGGCAGGGG + Intronic
1172067386 20:32231130-32231152 GGAGCCCGTGAAGCATGCAGTGG - Intronic
1172109950 20:32538745-32538767 GGAGGGAATGGGGGAGGCAGCGG + Intronic
1172183427 20:33017113-33017135 GGAGCCAGGGGAGGGGGCTGGGG + Intronic
1172447245 20:34999674-34999696 GGCTGCACTGGAGGAGGCAGAGG + Exonic
1172826785 20:37795216-37795238 AGAGGTAGAGGAGGAGGCAGAGG - Intronic
1172841049 20:37903031-37903053 GGAGGGAGGGGAGGAGGGAGGGG + Intergenic
1172958536 20:38779700-38779722 GGAGCCAGAAGAGCAGGCTGAGG - Intergenic
1173002045 20:39111642-39111664 GGAGGAAGGGGAGGAGGAAGGGG + Intergenic
1173322351 20:41999257-41999279 GAAGCCGCTGGAGGAGCCAGCGG + Intergenic
1173338399 20:42131990-42132012 GGAGACAGAGGAGGCAGCAGCGG + Intronic
1173583863 20:44166945-44166967 TGAGGCAGGGGAGGTGGCAGGGG - Intronic
1173821556 20:46022986-46023008 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1173847591 20:46197882-46197904 GCAGCTAGGGGAGGAGGAAGAGG + Intronic
1173869107 20:46330637-46330659 AGAGCAAGTAGAGGGGGCAGTGG - Intergenic
1174225986 20:49000461-49000483 GGAGCCTGTGGATGATCCAGGGG + Intronic
1174286794 20:49479772-49479794 GGAGACTGGGGAGGAGGCTGCGG + Intronic
1174365229 20:50052794-50052816 GGCGGCAGTGGTGGAGGGAGTGG + Intergenic
1174778334 20:53365825-53365847 TGAGTCAGTGGAGAAGGAAGTGG - Intronic
1175069118 20:56316801-56316823 TGTTCCAGTGGAGGTGGCAGTGG - Intergenic
1175120167 20:56710845-56710867 GGAGGAAGAGGAGGAGGGAGAGG - Intergenic
1175120192 20:56710920-56710942 GGAGGGAGAGGAGGAGGGAGAGG - Intergenic
1175244108 20:57571195-57571217 GGGGTCAGGGGAGGAAGCAGTGG + Intergenic
1175247665 20:57591465-57591487 GGAGCAGGAGGAGGAGGAAGAGG + Intergenic
1175657553 20:60784821-60784843 GGATCCAGATGAGGAGGTAGAGG - Intergenic
1175759813 20:61554334-61554356 GGGGGCAGTAGAGGAGGCACAGG + Intronic
1175863792 20:62163829-62163851 GGAGTCAGTGTTGGGGGCAGGGG + Intronic
1175892291 20:62321195-62321217 GGGGCCAGTGGAGGAAGAGGGGG + Intronic
1175892412 20:62321536-62321558 GGCGCCAGTGGAGGAAGAGGGGG + Intronic
1175901739 20:62362598-62362620 GGTGACTGTGGAGGAGGAAGGGG - Intronic
1175967303 20:62666018-62666040 GGGGTCAGTGGAGGAGTCATTGG + Intronic
1175991990 20:62794307-62794329 GGAGGCGGAGGCGGAGGCAGAGG + Intergenic
1175994493 20:62805971-62805993 GAAGCCACAGCAGGAGGCAGAGG - Intronic
1176037874 20:63049178-63049200 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1176103137 20:63373603-63373625 GGAGTCAGAGGCAGAGGCAGGGG - Intronic
1176104828 20:63381025-63381047 GGGGCTAGTGTAGGAGGCTGAGG - Intergenic
1176171181 20:63697055-63697077 GGAGCGTGAGGAGGAGGCACGGG + Exonic
1176257145 20:64158533-64158555 GGGGCCAGTGGAGCAGGTGGGGG - Intronic
1176265582 20:64207642-64207664 GCTGCCCTTGGAGGAGGCAGTGG - Exonic
1177114899 21:17073445-17073467 GGAGGCAGAGGAGGAGGAGGAGG + Intergenic
1177195528 21:17900577-17900599 GTTTCCAGTGGAGGTGGCAGGGG + Intergenic
1177301866 21:19257166-19257188 GAAGGCAGTGGTGAAGGCAGCGG + Intergenic
1178157531 21:29872441-29872463 GAAGTCAGAGCAGGAGGCAGAGG - Intronic
1178441249 21:32600391-32600413 GGAGTGAGTGGAGGTGGCAGGGG - Intronic
1178493716 21:33070395-33070417 GGAGGAAGTGGAGGAGGTGGAGG - Exonic
1178632096 21:34270717-34270739 GAAGCCACTGGAGATGGCAGTGG + Intergenic
1178680764 21:34670372-34670394 GGACGCAGCGGAGGAGGCGGAGG + Exonic
1178801731 21:35801670-35801692 TGTTCCAGTGGAGGTGGCAGGGG - Intronic
1178839959 21:36130317-36130339 GGAGGAAGAGGAGGAGGCGGCGG - Intergenic
1178959089 21:37047616-37047638 TGTTCCAGTGGAGGTGGCAGGGG - Intergenic
1179030117 21:37712753-37712775 GAAGGCAGGGGAGGAGGAAGGGG - Intronic
1179132248 21:38648612-38648634 GGAGGTGGAGGAGGAGGCAGAGG - Intronic
1179133669 21:38660991-38661013 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1179133673 21:38661003-38661025 GGAGGAAGAGGAGGAGGCGGAGG + Intronic
1179133676 21:38661015-38661037 GGAGGCGGAGGAGGAGGAAGAGG + Intronic
1179308109 21:40173243-40173265 GGACCCAGTGGAGTGGGCAGTGG + Intronic
1179543447 21:42099359-42099381 GGAGCCAGTGAAGGCACCAGCGG - Intronic
1179556877 21:42184633-42184655 GGCGCCAGTGGAGCTGGCAGTGG + Intergenic
1179624656 21:42642023-42642045 GAAGCCACTGGAGGTGGCAAAGG - Intergenic
1180058853 21:45374556-45374578 AGGGGCAGGGGAGGAGGCAGGGG - Intergenic
1180104254 21:45607572-45607594 GGAGGGAGGGGAGGAGGGAGGGG + Intergenic
1180230511 21:46424305-46424327 GGTGGCAGCGGCGGAGGCAGGGG - Intronic
1180250752 21:46585818-46585840 TGTTCCAGTGGAGGTGGCAGGGG - Intergenic
1180704018 22:17797807-17797829 GCAGCCAGCAGAGGACGCAGAGG + Intronic
1180741207 22:18054306-18054328 GGAGGCAGTACAGGAGGCGGAGG - Intergenic
1181003761 22:19999880-19999902 GGGTCCTTTGGAGGAGGCAGTGG - Intronic
1181031043 22:20149036-20149058 GGAGCCTGTCCAGGAGGAAGGGG - Intronic
1181055008 22:20256702-20256724 GCAGCCAGTGGAGGAGTGAGCGG - Intronic
1181512283 22:23394366-23394388 GGAGCCTGTCCAGGAGGAAGGGG + Intergenic
1181534222 22:23533417-23533439 GGAGCAGGTGAGGGAGGCAGCGG + Intergenic
1181616907 22:24061207-24061229 GCACCAAGTGGAGGAGGCTGGGG - Intronic
1181634829 22:24169685-24169707 TGGGCCAGTGGAGGAGGCAGGGG - Intronic
1181831561 22:25564606-25564628 GGAGGGAGGGGAGGAGGAAGAGG + Intergenic
1181844238 22:25693861-25693883 GGAGGCAGAGGCAGAGGCAGAGG - Intronic
1181980258 22:26761082-26761104 GGAGGAAGTGGAGGAAGGAGGGG + Intergenic
1182068092 22:27444261-27444283 GGAGATAGAGGAGGAGGAAGCGG + Intergenic
1182143795 22:27984441-27984463 GGGGCCTGTGGAGGAGGGGGTGG - Intronic
1182293335 22:29298777-29298799 GGAGGCCGTGGAGGAGATAGAGG + Exonic
1182321412 22:29480381-29480403 GAAGCCGCTGGAGGAGCCAGCGG - Exonic
1182369047 22:29798142-29798164 ATAGCCAGTGAAGGAGTCAGTGG - Intronic
1182697742 22:32207888-32207910 GTAGCATGTGGAGGAGGGAGTGG + Intergenic
1183056221 22:35307717-35307739 GGAGCCAGGGGAGAAGGGAGGGG + Intronic
1183229682 22:36573988-36574010 GGAGCCAGTGGAAGAGTGTGGGG + Intronic
1183229691 22:36574024-36574046 GGAGCCAGTGGAGGAGTGTGGGG + Intronic
1183236698 22:36624197-36624219 GGAGTCTGTGTGGGAGGCAGCGG + Intronic
1183301480 22:37061145-37061167 GGAAGCGGAGGAGGAGGCAGTGG - Intronic
1183386665 22:37519155-37519177 GGAGGCCGAGGAGGAGGCCGGGG - Exonic
1183437786 22:37805264-37805286 GGAGGCAGAGGCAGAGGCAGAGG + Exonic
1183464603 22:37973390-37973412 GGTGGCAGTGGAGGAGGCTGAGG - Exonic
1183665763 22:39244909-39244931 GGAGGCAGCGGGGGAGGCTGCGG + Intergenic
1183777302 22:39974933-39974955 GGAGGCAGAAGAGGAGGCTGAGG - Intergenic
1183832413 22:40425354-40425376 TGAGGCAGTGGTGAAGGCAGGGG + Intronic
1183963692 22:41428467-41428489 GGAGCCAGTGGGGCAAGAAGAGG + Intergenic
1184087467 22:42273763-42273785 TGAGCCAGAGGAGGAGGGAAAGG - Intronic
1184092506 22:42299897-42299919 GGAGCGGGTGGAGGAGGAGGGGG + Intronic
1184151314 22:42640745-42640767 GAAGGCTGAGGAGGAGGCAGGGG - Intronic
1184256991 22:43292971-43292993 GAAGCCTGGGGAGGAGGGAGAGG + Intronic
1184326261 22:43789312-43789334 GGAGAAGGTGGAGGAGGAAGGGG + Intronic
1184413315 22:44338142-44338164 GGACCCCTTGGAGGAGGAAGGGG - Intergenic
1184451258 22:44584114-44584136 GGAGCCAGGTGAGGGGGCGGTGG - Intergenic
1184529765 22:45047574-45047596 GGAGCCCCTGGGGGAGTCAGAGG - Intergenic
1184536923 22:45093919-45093941 GGAACCAGTGGAGGTGGTTGGGG - Intergenic
1184537967 22:45100291-45100313 TGTGCCAGAGGAGGAGGCATGGG + Intergenic
1184745634 22:46454113-46454135 GGTGCTAGTGGTGGAAGCAGGGG + Intronic
1184751052 22:46487013-46487035 GCAGGAAGTGGAGGGGGCAGGGG - Intronic
1184806098 22:46795928-46795950 GGAGCCTCTGAAGGAGGGAGAGG + Intronic
1184890971 22:47379042-47379064 GGAAAAAGAGGAGGAGGCAGAGG + Intergenic
1184890980 22:47379078-47379100 GGAGGAAGAGGAGGAGGAAGAGG + Intergenic
1184891009 22:47379201-47379223 GGACGCGGCGGAGGAGGCAGAGG + Intergenic
1184891020 22:47379240-47379262 GGCGGCGGCGGAGGAGGCAGCGG + Intergenic
1184891024 22:47379252-47379274 GGAGGCAGCGGAGGAGGAGGCGG + Intergenic
1184894533 22:47399477-47399499 GGGGCCAGTGGAGGGGGCAGTGG - Intergenic
1184951855 22:47848739-47848761 GAAGCCTGTGCAGGAGACAGAGG - Intergenic
1185045860 22:48528442-48528464 GCAGCCAGTGCAGGGTGCAGAGG - Intronic
1185187644 22:49412179-49412201 GGAGGGAGTGGAGGAGGAGGAGG + Intergenic
1185384943 22:50527279-50527301 GGAGGCTTTGGGGGAGGCAGAGG + Exonic
1185402201 22:50625081-50625103 GGAGCCTGTGGGGGAGGCTCAGG - Exonic
949250089 3:1973160-1973182 GGAGGGAGAGGAGGAGGGAGGGG + Intergenic
949443615 3:4110373-4110395 GGACCCACTTGAGGAGGCAGTGG + Intronic
949838452 3:8294240-8294262 GGAGAAAGAGGAGGAGGAAGAGG - Intergenic
950463444 3:13139116-13139138 CCAGCCAGTGAAGTAGGCAGAGG + Intergenic
950530279 3:13549060-13549082 GGAGTCAGGGGAGGGGGCCGGGG + Intergenic
950543396 3:13625315-13625337 GAAGCCAGTGAAGGAGAGAGAGG - Intronic
950553996 3:13684368-13684390 GGAGCCAGAGGTGGGGGTAGAGG + Intergenic
950571790 3:13804919-13804941 GTAGCCTGAGGAGGAGGAAGAGG - Intergenic
950575946 3:13832127-13832149 GGAGCCTGAGGAGGAGGAAGAGG - Intronic
950575968 3:13832238-13832260 GGAGCAAGAGGAGGAGGAGGGGG - Intronic
950580280 3:13857575-13857597 GGAGCCCTTGGAGCATGCAGGGG - Intronic
951294558 3:20917912-20917934 CGATCCAGTGGAGGTAGCAGGGG - Intergenic
951455802 3:22890896-22890918 GGAGAAAGTGGAGGAGGAGGAGG - Intergenic
951537843 3:23755831-23755853 AGAGCCTGTGAAAGAGGCAGAGG - Intergenic
951598108 3:24340345-24340367 GGAGCAAGAGGAGGAGGAAGAGG - Intronic
952101462 3:30017859-30017881 AGAGCCAGTGAAGGAGACACAGG + Intergenic
952227217 3:31390742-31390764 AGAGAGAGTGGAGGAGGCTGGGG + Intergenic
952233489 3:31455542-31455564 TGAGCCAGAGGAAGAGGCTGGGG + Intergenic
952382547 3:32816657-32816679 GGAGGAGGAGGAGGAGGCAGAGG + Intergenic
952534439 3:34295141-34295163 GGAGCCAATGAAAGGGGCAGGGG + Intergenic
952754719 3:36856310-36856332 GGAGGAAGAGGAGGAGGAAGAGG - Exonic
953452005 3:43013505-43013527 GAAGCCACAGGAAGAGGCAGTGG + Intronic
953474485 3:43194130-43194152 GGGGCCACGAGAGGAGGCAGAGG - Intergenic
953708955 3:45253340-45253362 GAGGCCAGTGGAGAAGGGAGAGG + Intergenic
953769154 3:45765504-45765526 CCAGCCAGTGGAGGAGGCAGGGG - Intronic
953793576 3:45966555-45966577 GGAGCGAGTGGAGGAGGCACTGG - Exonic
953837631 3:46361070-46361092 AGAGCCAGTGGTGGAGGGCGTGG - Intergenic
953902138 3:46849444-46849466 TGCTCCAGTGGGGGAGGCAGGGG - Intergenic
954003996 3:47578247-47578269 GGAGCCAGTGGACGCGGCTCAGG - Intronic
954076846 3:48187973-48187995 GGAGGCAGAGGAAGAGGGAGCGG - Exonic
954285561 3:49616632-49616654 GGAGCCAGTGCAGGCGCCAGAGG - Intronic
954338447 3:49934369-49934391 GGAGGCGGAGGCGGAGGCAGAGG + Intergenic
954707234 3:52487505-52487527 GGAGGAAGAGGAGGAGGAAGAGG + Exonic
955081644 3:55663304-55663326 GCAGCCAGTAGAGGAGAAAGGGG + Intronic
955175581 3:56610964-56610986 GGAGGTGGTGGAGGATGCAGTGG + Intronic
955283461 3:57616356-57616378 GGAGGAGGAGGAGGAGGCAGGGG + Intergenic
955283486 3:57616487-57616509 GGAGGAAGAGGAGGAGGAAGAGG + Intergenic
955342462 3:58135694-58135716 GTAGGGAGGGGAGGAGGCAGAGG - Intronic
955347660 3:58173109-58173131 GGAGACAGAGGAGGAGGAGGTGG - Intergenic
956772323 3:72537114-72537136 GGAGGCAGTGTCGGAGGGAGGGG - Intergenic
957073243 3:75581519-75581541 GGAGGCAGTGGAGGCAGGAGAGG + Intergenic
957223154 3:77410683-77410705 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
957828767 3:85487594-85487616 GGAGGAAGTGGAGGAGGAGGAGG + Intronic
958059985 3:88467192-88467214 GGAGGAAGTGGAGGAGGAGGTGG - Intergenic
959163320 3:102744786-102744808 GGAGCCAGTGTAGGGTGAAGAGG + Intergenic
959419994 3:106117253-106117275 GGAGCCAGAAGGGGAGGCAGTGG + Intergenic
959920984 3:111868107-111868129 AGAGGCAGAGGTGGAGGCAGGGG - Intronic
960163023 3:114371033-114371055 GGAGCAACTGGAGGAAGGAGAGG - Intronic
960740162 3:120824610-120824632 GCAGCCAGGGGAGGAGGGAACGG - Intergenic
960764934 3:121115824-121115846 GGAGCAAGAGGAGGAGTTAGGGG + Intronic
960796120 3:121490380-121490402 GAAGGCAGTGGATGAGGAAGAGG - Exonic
960829108 3:121826140-121826162 GGAGCCAGGAGAAGATGCAGAGG - Exonic
960967748 3:123116788-123116810 GGAACCAGAGGAGGAGGAGGTGG + Intronic
961052231 3:123756615-123756637 GGACCCAGAGGAGAATGCAGGGG - Intronic
961280839 3:125765259-125765281 GGAGGCAGTGGAGGCAGTAGAGG - Intergenic
961609797 3:128127575-128127597 GGAGGCAGTGAAGAAGGCAGAGG - Intronic
961656839 3:128447331-128447353 GGAGCCAGTGAAGGGGAGAGTGG - Intergenic
961658664 3:128456997-128457019 GGAGCCCCTGGAGGGGGCTGGGG - Intergenic
961756345 3:129129278-129129300 GGAGCGAGTGGAGCAGGTGGAGG + Intronic
961795496 3:129405923-129405945 GAAGCCAGGGGTGGATGCAGTGG + Intronic
961873551 3:130004325-130004347 GGAGGCAGTGGAGGCAGGAGAGG + Intergenic
961978036 3:131047662-131047684 TGCTCCAGTGGAGGTGGCAGGGG + Intronic
962224761 3:133596715-133596737 GGAGCCAGTGAATGAGACATAGG + Intergenic
962388983 3:134956083-134956105 GGAGGAAGGGGAGGAGGCTGGGG + Intronic
962715794 3:138124908-138124930 GTAGCCAGGGGAAGAGGGAGGGG + Intronic
962985967 3:140536344-140536366 GAAGGTTGTGGAGGAGGCAGGGG - Intronic
963046953 3:141109663-141109685 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
963234942 3:142947309-142947331 GAAGCCACAGGAGGAGGAAGGGG + Intergenic
963605616 3:147410008-147410030 GGAACAAGAGGAGGAGGAAGAGG - Exonic
963687878 3:148460853-148460875 TGATCCAGTGGAGGTTGCAGGGG + Intergenic
963746036 3:149126059-149126081 GGATCCAGTAAAGGAGACAGAGG + Intergenic
963897657 3:150703820-150703842 GGAGTCAGAGGAGGAGTTAGAGG - Exonic
963988962 3:151630973-151630995 TGAGCCAGTGGTGGAGGTGGGGG + Intergenic
964374392 3:156035384-156035406 GGAGGAAGGGGAGGAGGGAGAGG - Intergenic
965060982 3:163785970-163785992 TGCTCCAGTGGAGGTGGCAGGGG + Intergenic
965133431 3:164730990-164731012 GGAGTAAGTGGCGGAGGCATGGG - Intergenic
965742792 3:171893841-171893863 GGAGAGAGGGAAGGAGGCAGGGG - Intronic
966123849 3:176552327-176552349 AGAGCCACTGGAGAAGGCAGAGG - Intergenic
966210886 3:177452385-177452407 GGAGGGAGTGAAGGAGGGAGAGG - Intergenic
966524900 3:180910240-180910262 GGAGGCTGAGGCGGAGGCAGTGG + Intronic
966900060 3:184475798-184475820 GGAGGCAGAGGAGGAGGAGGAGG - Intronic
967108706 3:186273955-186273977 GGAGCAGGAGGAGAAGGCAGAGG - Intronic
967251115 3:187539841-187539863 GGAGAAAGGGGAGGAGGAAGAGG + Intergenic
967386476 3:188916589-188916611 TGAGCCTGGGGAGCAGGCAGTGG + Intergenic
967469767 3:189848213-189848235 GGAGGAGGAGGAGGAGGCAGAGG - Intronic
967553837 3:190831539-190831561 GGAGGCGGTGGAGGAGGAGGAGG - Intergenic
967762818 3:193243861-193243883 TAAGGAAGTGGAGGAGGCAGTGG - Intronic
967905014 3:194492115-194492137 AGTGCCAGTGGAGGGGGAAGTGG - Intronic
967961466 3:194928634-194928656 GGAGTCAGGGAATGAGGCAGGGG + Intergenic
967969858 3:194991013-194991035 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
967969874 3:194991079-194991101 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
967969877 3:194991091-194991113 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
967969880 3:194991103-194991125 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
967969921 3:194991274-194991296 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
967969924 3:194991286-194991308 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
968078889 3:195833366-195833388 GGGGCCAGTGGAGGAGGGTGAGG + Intergenic
968309155 3:197668446-197668468 GGAGTAAGAGTAGGAGGCAGAGG - Intergenic
968652690 4:1766489-1766511 GGTGCCAGTCGAGGAGGGAGGGG + Intergenic
968862334 4:3182772-3182794 GGAGGCAGTGTAGGAGGTAAGGG - Intronic
968966760 4:3772702-3772724 GCAGGCAGTGGAGGAGGATGGGG + Intergenic
969016377 4:4106888-4106910 GGGGCCTGTGGTGGGGGCAGGGG - Intergenic
969033280 4:4230066-4230088 GGAGGCAGAGGCAGAGGCAGAGG + Intergenic
969229698 4:5821445-5821467 GGAGCCAGTGGAGTTAGAAGTGG + Exonic
969360546 4:6660603-6660625 GTAAGCAGAGGAGGAGGCAGAGG + Intergenic
969413152 4:7042782-7042804 GGAGCCGGAGGAGGAGGAGGAGG - Exonic
969454787 4:7294882-7294904 GGAGGGAGAGGAGGAGGGAGAGG - Intronic
969454877 4:7295108-7295130 GGAGGAAGAGGAGGAGGGAGAGG - Intronic
969480747 4:7445638-7445660 GAGGCCAGAGGAGGAGGCAAGGG + Intronic
969676203 4:8615691-8615713 CCAGCCAGAGGAGGAGACAGAGG + Intronic
969737121 4:8999501-8999523 GGAGGCAGTGGAGGCAGGAGAGG - Intergenic
969796313 4:9531089-9531111 GGAGGCAGTGGAGGCAGGAGAGG - Intergenic
969933510 4:10658008-10658030 GCAGCAAATGGAGGAGACAGTGG - Intronic
970350423 4:15196437-15196459 GGAACCAGAGGAGGAACCAGAGG - Intergenic
970372287 4:15420111-15420133 GGAGCCCGTTGCGGAGGCTGTGG - Intronic
970444512 4:16112683-16112705 GGAGGGAGGGGAGGAGGGAGGGG + Intergenic
970967979 4:21949235-21949257 GGAGCCCCTGGGGGACGCAGCGG - Intergenic
971019050 4:22516050-22516072 GGAGGCAGTGGCGGCGGCGGCGG - Exonic
971019055 4:22516062-22516084 CTGGCCAGGGGAGGAGGCAGTGG - Intergenic
971695395 4:29895476-29895498 ACAGCCAGTGGAGGTGGCCGAGG - Intergenic
972086719 4:35226487-35226509 GGAGCATGTGGGGGAGGAAGAGG + Intergenic
972151135 4:36092492-36092514 CGAGCCACTGGAGGAGGTTGAGG + Intronic
972242731 4:37210806-37210828 GGAGACAGAGGGGGTGGCAGTGG + Intergenic
972701748 4:41500866-41500888 GGGGTCAGTGGAGGATGGAGGGG + Intronic
973179526 4:47251333-47251355 TGTTCCAGTGGAGGTGGCAGGGG + Intronic
973257961 4:48131882-48131904 CCTGCCAGTGGAGGTGGCAGGGG + Intronic
973532099 4:51844133-51844155 GGAGCTAGTCGGGGAGGAAGGGG + Intronic
973547156 4:51993381-51993403 AGAGCCAGTTGCTGAGGCAGTGG + Intergenic
973569813 4:52226545-52226567 AGATCCAGTAGAGGAAGCAGGGG + Intergenic
974128920 4:57729854-57729876 GGAGCCCATGGAGGAGGGGGAGG + Intergenic
974165127 4:58191486-58191508 TGCTCCAGTGGAGGTGGCAGAGG - Intergenic
974187762 4:58463570-58463592 GGAGACAGAGGAGGAGACAGAGG + Intergenic
975002258 4:69238966-69238988 GGAGTCGGGGGAGGAGGGAGTGG + Intergenic
975118662 4:70705457-70705479 GGCGCCCGGTGAGGAGGCAGCGG + Intronic
975990675 4:80257046-80257068 TGAGCCAGGGGAGCAGGTAGGGG + Intergenic
976280479 4:83322056-83322078 TGAACAAGAGGAGGAGGCAGTGG - Intronic
976361774 4:84187541-84187563 AGAGAAAGTGGAGGAGGAAGAGG + Intergenic
976430474 4:84958159-84958181 GGAAGCAGTGGAAAAGGCAGAGG + Intronic
976595240 4:86889663-86889685 GGAGGCAGAGGCAGAGGCAGAGG + Intronic
976774904 4:88697688-88697710 GGCGGCAGCGGCGGAGGCAGCGG - Exonic
976794119 4:88913174-88913196 GGAAGAAGTGGAGGAGGAAGAGG + Intronic
976794133 4:88913258-88913280 GGAAGAAGTGGAGGAGGAAGAGG + Intronic
977609848 4:99020481-99020503 GGAGCCTGAGGAGGAGGAGGCGG + Intronic
977731104 4:100352953-100352975 GGAGGAAGAGGAGGAGGAAGAGG + Intergenic
977746827 4:100558989-100559011 TGTTCCAGTGGAGGTGGCAGAGG - Intronic
977810079 4:101347568-101347590 GGAGGAAGGGGAGGAGGCGGAGG - Intronic
977826137 4:101533858-101533880 TGCTCCAGTGGAGGTGGCAGGGG - Intronic
977929837 4:102738354-102738376 TGCTCCAGTGGAGGTGGCAGGGG - Intronic
977995391 4:103493876-103493898 GGAGCCAGTGAATGAGACATAGG - Intergenic
978072556 4:104491362-104491384 GGAGGCGGAGGAGGAGGCGGCGG + Exonic
978268545 4:106859008-106859030 GGAGGAAGAGGAGGAGGAAGGGG + Intergenic
978541646 4:109822437-109822459 GGAGGCCGAGGAGGAGGAAGAGG + Exonic
978878908 4:113676443-113676465 GGGAACAGTGGAGGAGTCAGTGG - Intronic
979327285 4:119394909-119394931 GGGGCCATTGGTGGGGGCAGTGG - Intergenic
980621613 4:135314107-135314129 TGAGGTAGTGGAGGAGGAAGAGG - Intergenic
981034379 4:140154128-140154150 GGAGCGAGAGGAGGAGGAGGAGG - Exonic
981081627 4:140643630-140643652 GGAGCCAGTGGAGGTGCCTGTGG - Intronic
981093492 4:140756370-140756392 GGAGCGGGAGGAGGAGGAAGAGG + Intergenic
981093502 4:140756402-140756424 GGAGCGGGAGGAGGAGGAAGTGG + Intergenic
981167678 4:141581166-141581188 TGCTCCAGTGGAGGTGGCAGAGG - Intergenic
982117920 4:152113359-152113381 GGAGGAGGAGGAGGAGGCAGAGG + Intergenic
982288691 4:153759595-153759617 GGAGGGAGTGGAGGAGGGACTGG + Intronic
982536840 4:156617569-156617591 GGACCCTGTGGTGGAGGCAGTGG - Intergenic
983058578 4:163128934-163128956 GAAGAGGGTGGAGGAGGCAGTGG + Exonic
983058584 4:163128946-163128968 GGAGGCAGTGGTGGAGGGGGAGG + Exonic
983245168 4:165279597-165279619 GGGGCCATTGGTGGGGGCAGTGG - Intronic
983449840 4:167895759-167895781 TGTTCCAGTGGAGGTGGCAGAGG - Intergenic
983517493 4:168673349-168673371 GGAGCCAGTAGGGAAGGCTGGGG + Intronic
983759230 4:171384838-171384860 GGAGGAAGTGGAGGAGGAGGAGG - Intergenic
984324401 4:178233685-178233707 GGGGCCTGTGGTGGAGGGAGGGG - Intergenic
984377607 4:178953374-178953396 GGTGGCAGTGGTGGTGGCAGTGG - Intergenic
984653546 4:182293723-182293745 AAAGCATGTGGAGGAGGCAGCGG - Intronic
984734819 4:183099219-183099241 GGAGGAAGAGGCGGAGGCAGCGG + Intergenic
984744087 4:183196678-183196700 GCAGCCAGCTGAGGAGGCACAGG - Intronic
985126361 4:186698688-186698710 GGAGCCAGTGAGGGAAGCACGGG + Intronic
985174819 4:187189526-187189548 GAAGCCAGTGGAGTGGGCATAGG - Intergenic
985384205 4:189428319-189428341 GGAACCAGTGAAGGAATCAGAGG - Intergenic
985498397 5:224597-224619 GGAGCAGGGGGAGGAGGCAGGGG - Intronic
985523636 5:390989-391011 GGAGCCCCTCCAGGAGGCAGTGG + Intronic
985544852 5:504474-504496 GGACACACTGGAGGAGGCTGTGG - Intronic
985548264 5:520711-520733 GAAGCCAGAGGAGGAGGCCTAGG - Intronic
985763202 5:1762448-1762470 GGAGGCAGAGGCAGAGGCAGGGG + Intergenic
985833116 5:2250591-2250613 GGAGACAGCGAGGGAGGCAGGGG - Intergenic
985852356 5:2397963-2397985 GGAGCCTGTTGGGGAGGCCGGGG + Intergenic
985884027 5:2662440-2662462 GAGTCCAGTGGAGGTGGCAGAGG - Intergenic
985914003 5:2903910-2903932 GGAGCCAGGTGTGGAGGCAAAGG + Intergenic
986032739 5:3909197-3909219 GGAGCCAAGAGAGGAGGCAGTGG - Intergenic
986168017 5:5292670-5292692 GAAGACACTGGAGGAGGCAGTGG - Intronic
986859030 5:11904534-11904556 GGAGAGAGGGGAGGAGGCCGCGG + Intergenic
986870283 5:12037069-12037091 TGTTCCAGTGGAGGTGGCAGGGG - Intergenic
988986228 5:36621456-36621478 GGAGTCAGTGGAGGGAGTAGGGG + Intronic
989192985 5:38689431-38689453 AGAGCTAGAGGATGAGGCAGGGG - Intergenic
990373523 5:55145736-55145758 GGAGACAGAGGAGGAGGAGGAGG - Intronic
991312499 5:65259420-65259442 GGAGCCAATGAAGGAGGAAGAGG + Intronic
991387005 5:66101455-66101477 TGTTCCAGTGGAGGTGGCAGAGG - Intergenic
991598162 5:68325472-68325494 GGAGGAAGAGGAGGAGGAAGAGG + Intergenic
991598172 5:68325532-68325554 GGAGCAAGAGGAGGAGGAAGAGG + Intergenic
991959513 5:72030448-72030470 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
992090614 5:73312844-73312866 GGAGGGGGAGGAGGAGGCAGAGG - Intergenic
992090617 5:73312856-73312878 GGAGGCAGAGGAGGAGGGGGAGG - Intergenic
992105727 5:73448046-73448068 GGAGCCGGTGGGGGCGGCGGCGG - Exonic
992605062 5:78447844-78447866 GGGGGCAGGGGAGGAGGGAGGGG - Intronic
992843131 5:80715964-80715986 GGAGCTATTGAAGGAGTCAGAGG + Intronic
992864698 5:80946034-80946056 GGGGCCTGTCGGGGAGGCAGAGG - Intergenic
994710387 5:103258690-103258712 GGAGGCGGAGGAGGAGGCGGAGG + Exonic
994875359 5:105414250-105414272 TGTTCCAGTGGAGGTGGCAGGGG - Intergenic
995030963 5:107480986-107481008 GGAGCCTGAGGAGCTGGCAGGGG + Intronic
995135791 5:108678709-108678731 GGAGGAAGTGAAGGAGGAAGAGG - Intergenic
995357871 5:111260415-111260437 GAAACCAGTGAAGAAGGCAGAGG - Intronic
995464224 5:112434727-112434749 GGAGTTCGTGGAGGTGGCAGAGG - Intergenic
995631544 5:114138768-114138790 GGAGGTAGAGGAGGAGGAAGAGG + Intergenic
996354287 5:122579289-122579311 GGGGCCAGTGGCTGAGGAAGTGG - Intergenic
997013554 5:129905225-129905247 GGAGCCCGAGGAGGAGGACGGGG + Exonic
997070601 5:130617905-130617927 GGAGGGAGTGGGGGAGGCAAGGG - Intergenic
997485167 5:134225483-134225505 GGCGCCAGACGAGGTGGCAGGGG - Intronic
997685635 5:135786004-135786026 GGATCCAGTGGGGGAGACGGTGG + Intergenic
997691678 5:135831607-135831629 TTAGCCAGGGGAGGAGGGAGAGG + Intergenic
997903887 5:137795006-137795028 GGAGACAGTAGAGGTGGCAGGGG + Intergenic
998184290 5:139966974-139966996 GGAGCCACTGGGGGAGGCTGGGG - Intronic
998991599 5:147823306-147823328 GGAGGTAGAGGAGGAGGAAGAGG - Intergenic
999087198 5:148903505-148903527 GGAGCCAGTGAGGGAGACAAGGG + Intergenic
999125349 5:149242145-149242167 GTGGCCACTGGTGGAGGCAGTGG + Intronic
999409729 5:151340212-151340234 GGAGGGAGAGGAGGAGGAAGGGG + Intronic
999420746 5:151440378-151440400 GAAGCCACTGTAGGGGGCAGTGG + Intronic
999655974 5:153811100-153811122 GGAGCCAGCAGCGGCGGCAGTGG + Exonic
1000289302 5:159855268-159855290 GGAGCCAGTGAAGGAAATAGAGG + Intergenic
1000779698 5:165465284-165465306 TGTTCCAGTGGAGGTGGCAGGGG - Intergenic
1000846922 5:166293145-166293167 GGGGCCTGTGGGGAAGGCAGGGG - Intergenic
1000889527 5:166786443-166786465 CTAGCCAGGGGAGGTGGCAGTGG - Intergenic
1001136379 5:169106040-169106062 GGAGCCTGTTGGGGGGGCAGGGG + Intronic
1001424819 5:171616180-171616202 GGGGCCAGGGGAGGAGGTGGCGG + Intergenic
1001987730 5:176089855-176089877 GGAGACAGTGGTTGAGGCAATGG - Intronic
1002133934 5:177096901-177096923 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1002229137 5:177748285-177748307 GGAGACAGTGGTTGAGGCAATGG + Intronic
1002266206 5:178035488-178035510 GGAGACAGTGGTTGAGGCAATGG - Intronic
1002419703 5:179139238-179139260 ACAGGCAGTGGAGGAGGGAGAGG + Intronic
1002744681 5:181461046-181461068 GGGGTAAGTGGAGGAGGGAGGGG + Intergenic
1002896454 6:1382930-1382952 GGAGTCAGGGGAGCAGGAAGGGG + Intergenic
1003418574 6:5935676-5935698 GGAGCCACTGGAGGAGACATCGG + Intergenic
1003712893 6:8613545-8613567 GGAGACGGTGGCAGAGGCAGAGG - Intergenic
1003735857 6:8876895-8876917 GGAGCCAGTGGAGGAGCTCAGGG + Intergenic
1003737675 6:8895254-8895276 GGAGGCTGTGGTGGGGGCAGGGG + Intergenic
1003739215 6:8915487-8915509 GGGGCCAGTAGAGGAAGCAAAGG + Intergenic
1003751983 6:9069236-9069258 GGGAACAGAGGAGGAGGCAGAGG + Intergenic
1004511474 6:16287452-16287474 AGAGACAGTGGAGGAGGGAATGG - Intronic
1004627445 6:17390198-17390220 GGAGCAAGGGGAGGAGGGAGGGG - Intergenic
1004643651 6:17539329-17539351 GGAGGCAGAGGAGGAGGGGGTGG - Exonic
1004643659 6:17539341-17539363 GGTGGCCCTGGAGGAGGCAGAGG - Exonic
1004881533 6:20013328-20013350 AGAGAAAGTGGAGGAGGGAGAGG + Intergenic
1004999380 6:21225256-21225278 GCAGTAAGTAGAGGAGGCAGGGG + Intronic
1005040476 6:21595694-21595716 GGAGCCCGAGGAGGAGGAAGAGG - Exonic
1005624727 6:27652907-27652929 AGAGGCAGTGGCAGAGGCAGAGG - Intergenic
1005662297 6:28010841-28010863 GGAGCCAGGAGAAGATGCAGAGG + Intergenic
1005683026 6:28225461-28225483 GGAGCCGGAGGAGGGGGCGGCGG + Intronic
1005841655 6:29748070-29748092 GGGGGCAGGGGATGAGGCAGAGG + Intergenic
1005854947 6:29853411-29853433 GGAGACAGTGGCTGTGGCAGTGG - Intergenic
1005997868 6:30942497-30942519 GAGGCCAGGGGTGGAGGCAGGGG + Intronic
1006076406 6:31535306-31535328 CGAGGAAGGGGAGGAGGCAGCGG + Intronic
1006504466 6:34479313-34479335 GGTTCCAGTGGGGGAGGGAGGGG - Intronic
1006513757 6:34534890-34534912 GGAGCTACAGGAGGAGGCCGTGG - Exonic
1006740004 6:36301381-36301403 GGAGGCTGAGGAGGCGGCAGGGG - Intronic
1007302459 6:40877606-40877628 GGTGAAGGTGGAGGAGGCAGGGG - Intergenic
1007339239 6:41179788-41179810 GGTGCCAGAGGAGGATGGAGAGG - Intergenic
1007450766 6:41939456-41939478 GGAGCCTGGGGAGGAGGCGGGGG - Intronic
1007495772 6:42259568-42259590 GGCGCCCGAGTAGGAGGCAGCGG + Exonic
1007593509 6:43037712-43037734 GGTGGCAGTGCAGGAGGCATAGG + Exonic
1007702131 6:43771585-43771607 GGAGCCGGAGGAGGAGGCCGAGG + Intronic
1007712751 6:43835037-43835059 GGGGACAATGGAGGAGGTAGGGG + Intergenic
1007742816 6:44023163-44023185 GCATCCAGTGGGTGAGGCAGGGG - Intergenic
1007818878 6:44545197-44545219 GGTGGCAGTGGTGGTGGCAGTGG + Intergenic
1007965367 6:45999617-45999639 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1008125724 6:47666095-47666117 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1008148591 6:47922438-47922460 GGAGCCAGTTGGGCCGGCAGGGG - Intronic
1008250845 6:49238046-49238068 TGCTCCAGTGGAGGTGGCAGGGG + Intergenic
1008250861 6:49238128-49238150 TGCTCCAGTGGAGGTGGCAGGGG + Intergenic
1008419803 6:51284883-51284905 GAAGGCAGTGGAGGAGGGAGTGG - Intergenic
1008528564 6:52433564-52433586 TGCTCCAGTGGAGGTGGCAGGGG + Intronic
1010058095 6:71588801-71588823 GGAGCAAGTGGTGGTGGCGGCGG + Intergenic
1010069678 6:71728883-71728905 GAACCCAGGAGAGGAGGCAGAGG - Intergenic
1010208386 6:73343186-73343208 GGAGCCAGTGGAGGAGACATAGG - Intergenic
1010855093 6:80828230-80828252 GGAACCATCGGAGGAGGGAGAGG - Intergenic
1011484700 6:87829762-87829784 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1011539288 6:88413370-88413392 GGTGGCAGTGGTGGTGGCAGTGG + Intergenic
1011635693 6:89371170-89371192 GGAGCGAGGGTAGGAGGGAGAGG + Intronic
1011766085 6:90621787-90621809 TGAGCCAGGTGAGCAGGCAGAGG + Intergenic
1011898324 6:92260213-92260235 GAAGCCAGTGAAGGAGTCTGAGG - Intergenic
1012335030 6:98044946-98044968 AGTGCATGTGGAGGAGGCAGTGG + Intergenic
1013056580 6:106589163-106589185 GGAGGCGGTGGAGGAGGAGGAGG + Intronic
1013065860 6:106684020-106684042 GGAGCCAGGGGAGAAGACATGGG + Intergenic
1013299887 6:108795019-108795041 GGAGAAAGAGGAGGAAGCAGAGG + Intergenic
1013350508 6:109301612-109301634 GTAACCAGTGGAGGACACAGTGG - Intergenic
1013380392 6:109563602-109563624 GGAGCTAGAGGAAGAGGAAGAGG - Exonic
1013592301 6:111629429-111629451 GGAGACACTGCAGGAGGAAGGGG - Intergenic
1014304775 6:119727207-119727229 TGATCCAGTGAAGGTGGCAGTGG + Intergenic
1015210971 6:130697954-130697976 GTGGCCAGTGGTGGAGGAAGGGG - Intergenic
1016161299 6:140883911-140883933 GAAGCCAATGGAGGAGGAGGAGG - Intergenic
1016472006 6:144384469-144384491 CGGGGCAGTGGGGGAGGCAGTGG - Intronic
1017665253 6:156713739-156713761 GGAGGCAGAGGAGGAGGCAAAGG + Intergenic
1017672294 6:156778881-156778903 GGAGGCAGCGGAGGAGGAGGAGG + Exonic
1017760670 6:157565726-157565748 GAACCCAGTGCAGGAGGCGGAGG + Intronic
1017810734 6:157981805-157981827 GGAGGAAGGGGAGGAGGCCGGGG + Intergenic
1018009460 6:159656042-159656064 TGTTCCAGTGGAGGTGGCAGGGG - Intergenic
1018477940 6:164161360-164161382 GGTGCCTGTGAAGGAGGCCGGGG + Intergenic
1018482586 6:164206644-164206666 AGAGAAAGAGGAGGAGGCAGAGG - Intergenic
1018606099 6:165599806-165599828 GAAGGCTGTGGAGGAGGCCGTGG - Intronic
1018662895 6:166104990-166105012 GGCGGCAGTGGAGGAGACAGTGG - Intergenic
1018971969 6:168536260-168536282 GGGGCCAGTGGGGGAGCCTGTGG + Intronic
1019140375 6:169938754-169938776 GGAGCCGGTGGGGCAGGCAGGGG + Intergenic
1019249592 6:170734587-170734609 GGGGTAAGTGGAGGAGGGAGGGG + Intergenic
1019312038 7:367588-367610 GCAGCCTGGGGAGGAGGGAGGGG + Intergenic
1019315071 7:380532-380554 GGAGGGAGGGGAGGGGGCAGGGG + Intergenic
1019315085 7:380562-380584 GGAGGCAGGGGAGGGGGCAGGGG + Intergenic
1019315100 7:380592-380614 GGAGGGAGGGGAGGGGGCAGGGG + Intergenic
1019315115 7:380622-380644 GGAGGGAGGGGAGGGGGCAGGGG + Intergenic
1019456557 7:1130627-1130649 GCACCCAGTGGGGGCGGCAGAGG - Intronic
1019606168 7:1911308-1911330 GGGGCCTGAGGAGGAGGGAGAGG - Intronic
1019635325 7:2072417-2072439 GGAGCGCCTGGAGGGGGCAGGGG - Intronic
1019664799 7:2246483-2246505 GGTGTGAGTGGAGCAGGCAGCGG + Intronic
1019705496 7:2495452-2495474 GGAGGCAGGGGTGGAGGCAGGGG + Intergenic
1019749142 7:2717985-2718007 GGAGCCGCCGGGGGAGGCAGGGG - Intronic
1020026828 7:4905397-4905419 GGAGGAAGTGGAGGAGGAGGAGG + Intergenic
1020096170 7:5370795-5370817 GGAGCCGGTGGAGGTGCCTGTGG - Exonic
1020275431 7:6621927-6621949 GGAGCCCGAGGAGGAGGAAGAGG + Exonic
1020418180 7:7969355-7969377 GGAGGAGGAGGAGGAGGCAGTGG - Exonic
1020945650 7:14601965-14601987 GGAGAAAGAGGAGGAGGAAGAGG - Intronic
1021726197 7:23550197-23550219 GGAGGCAGAGGAGGAGGAGGAGG - Intergenic
1021726201 7:23550209-23550231 GGAGGAGGAGGAGGAGGCAGAGG - Intergenic
1021783806 7:24133155-24133177 GTACCCAGGGGAGGAGGCAGGGG + Intergenic
1021997276 7:26192541-26192563 GGAGGCAGTGGAGGAAGTGGGGG - Exonic
1022277828 7:28873380-28873402 GGAGGCCATGGAGGAGACAGTGG + Intergenic
1022296806 7:29063175-29063197 GCTGCCAGTGGAGGTGCCAGTGG - Intronic
1022395968 7:29988943-29988965 AGAGCGAGCCGAGGAGGCAGAGG + Intronic
1022400752 7:30034664-30034686 GGAGGCAGAGGAAGAGGAAGAGG + Intronic
1022610607 7:31867682-31867704 GGAGCCAGTGGTGGCAGCAGTGG - Intronic
1022820619 7:33956571-33956593 GGACAAAGTGGAGGAGGTAGAGG - Intronic
1023019358 7:35996784-35996806 AGAGCCGTTAGAGGAGGCAGTGG - Intergenic
1023132390 7:37015642-37015664 GAAGCCAAGGGAGAAGGCAGAGG - Intronic
1023267061 7:38417824-38417846 GGAGCCAGTGGAGGAGGCAGTGG - Exonic
1023342093 7:39231721-39231743 GGATCCAGTGGCGGACTCAGGGG + Intronic
1023418152 7:39950862-39950884 GAAGCAAGAGGAGGAGGCCGCGG - Exonic
1023765205 7:43504251-43504273 GGAGTAAGTGGTTGAGGCAGGGG - Intronic
1023884174 7:44340383-44340405 GGAGGTAGAGGAGGAGGAAGAGG - Intergenic
1024004188 7:45213188-45213210 TCAGCCATTGGAGGAAGCAGAGG + Intergenic
1024010077 7:45259672-45259694 CAAGCCAGTGGAGGTGGCACAGG - Intergenic
1024036317 7:45510206-45510228 AGGGCCATGGGAGGAGGCAGGGG + Intergenic
1024215251 7:47243179-47243201 GGAGCAAGGAGAGGAGGCCGTGG - Intergenic
1024242946 7:47449356-47449378 GGAGGCACATGAGGAGGCAGGGG - Intronic
1024311616 7:47974676-47974698 GGAGCAGGGGGAGGAGGGAGGGG + Intronic
1024575897 7:50763973-50763995 GCAGCCTGGAGAGGAGGCAGGGG - Intronic
1024580011 7:50793535-50793557 GTAGCCGGGGGAGGAGGCGGAGG - Intergenic
1024604236 7:51011537-51011559 GATGCCAGGGGAGGAAGCAGGGG + Intergenic
1024720944 7:52137042-52137064 GGAGGAAGAGGAGGAGGAAGAGG + Intergenic
1024840072 7:53575222-53575244 TGCTCCAGTGGAGGTGGCAGGGG - Intergenic
1024917178 7:54514951-54514973 TGTTCCAGTGGAGGTGGCAGGGG + Intergenic
1025777055 7:64569277-64569299 GGAGAAAGAGGAGGAGGCAGAGG - Intergenic
1025955157 7:66177125-66177147 GGTGACAGTGGTGGATGCAGTGG - Intergenic
1026333458 7:69373306-69373328 GGAGGAAGAGGAGGAGGAAGAGG + Intergenic
1026598249 7:71752362-71752384 GCAGACAGGGCAGGAGGCAGCGG - Intergenic
1026638545 7:72105201-72105223 GGGGGCAGGGGAGGAGCCAGGGG - Intronic
1026736313 7:72950915-72950937 GAGCCCAGTGGAGGAGGCACGGG + Exonic
1026786668 7:73305969-73305991 GAGCCCAGTGGAGGAGGCACGGG + Intronic
1026883251 7:73920627-73920649 AGAGGCAGGGGAGGTGGCAGTGG + Intergenic
1027107420 7:75414147-75414169 GAGCCCAGTGGAGGAGGCACGGG - Intergenic
1027209900 7:76137451-76137473 GGAGGCAGAGGCAGAGGCAGAGG + Intergenic
1027350402 7:77306091-77306113 TGTTCCAGTGGAGGTGGCAGAGG + Intronic
1027587964 7:80081576-80081598 GGAGTCAGTGGGGCAGACAGGGG + Intergenic
1028401653 7:90431512-90431534 TGCTCCAGTGGAGGTGGCAGGGG - Intronic
1028433548 7:90775747-90775769 GGAGAAAGAGGAGGAGGAAGAGG - Intronic
1028739518 7:94257607-94257629 GGAGCCAGGGAAGGAGGCCTTGG - Intergenic
1029114946 7:98232003-98232025 GGTGCCAGGGGAGGAGGGCGGGG + Intronic
1029204807 7:98863260-98863282 GGATCCAGTGGAAGCGGTAGAGG + Exonic
1029207337 7:98877873-98877895 GGAGCCAGGGGAGGTGGCATGGG - Intergenic
1029257519 7:99279599-99279621 GGAGCGGCTGGAGGAGGAAGAGG + Intergenic
1029401488 7:100349769-100349791 GGAGACAGTGGAGTAGACAGCGG - Intronic
1029495542 7:100894160-100894182 GGAGCCAGAGGAGGAGGAGAAGG + Exonic
1029575638 7:101401644-101401666 GGAGGAGGTGGAGGAGGAAGAGG + Intronic
1029983682 7:104902397-104902419 GGAGGAAGAGGAGGAGGGAGAGG + Intronic
1030078009 7:105753170-105753192 GAAGCCACTGGAGGAGATAGGGG + Intronic
1030110344 7:106021520-106021542 GGAGCCAGTGGAGGAATGAGCGG + Intronic
1030521838 7:110607196-110607218 GAAGCCAGTGGAAGAGAGAGTGG - Intergenic
1030951800 7:115800023-115800045 GGAGGAAGTAGAGGAGGAAGAGG + Intergenic
1031025272 7:116672542-116672564 GGAACCAGTGGAGAAGTCAGCGG - Exonic
1031138915 7:117919513-117919535 TGCTCCAGTGGAGGTGGCAGGGG - Intergenic
1031171499 7:118297724-118297746 GGAGCCAGGGGAATGGGCAGTGG + Intergenic
1031586297 7:123534963-123534985 GGAGCCAGAGGAGGGGGATGGGG + Intronic
1031586324 7:123535060-123535082 GGAGAAAGGGGAGGAGCCAGAGG + Intronic
1031629769 7:124032706-124032728 TGAGCGAGTGCAGCAGGCAGCGG + Exonic
1031828011 7:126589732-126589754 TGCTCCAGTGGAGGTGGCAGGGG - Intronic
1031947676 7:127858320-127858342 GGGGCCCGAGGAGGAGGCAAAGG - Intronic
1031993418 7:128212248-128212270 GGAGCCAGGGAAGGTGGGAGTGG + Intergenic
1032121187 7:129158106-129158128 GGAGACGGTGATGGAGGCAGAGG - Intronic
1032317474 7:130852897-130852919 GAAGCTAGTAAAGGAGGCAGTGG + Intergenic
1032383433 7:131505981-131506003 GGGGCCACCGGAGGAGGCCGAGG - Exonic
1032492419 7:132333496-132333518 GGAGTCAGGGGAGGAGGCCCAGG - Intronic
1032523297 7:132562036-132562058 GGAGGGAGAGGAGGAGGAAGAGG - Intronic
1032523306 7:132562069-132562091 GGAGGGAGAGGAGGAGGAAGAGG - Intronic
1032523359 7:132562313-132562335 GGAGAGAGAGGAGGAGGAAGAGG - Intronic
1032523370 7:132562362-132562384 GGAGAAGGAGGAGGAGGCAGAGG - Intronic
1032523500 7:132562925-132562947 GGAGGGAGAGGAGGAGGGAGAGG - Intronic
1032523690 7:132563727-132563749 GGAGGGAGAGGAGGAGGAAGAGG - Intronic
1032523700 7:132563766-132563788 GGAGGAAGAGGAGGAGGAAGAGG - Intronic
1032532571 7:132634345-132634367 GGAGCCAGTGAATGAGACATAGG - Intronic
1032535385 7:132658667-132658689 GGAGGCAGTGGAGGGGTCAAAGG - Intronic
1032791433 7:135245937-135245959 TGAGTCTATGGAGGAGGCAGTGG - Intronic
1033108491 7:138553889-138553911 GGAGCCAGTGAATGAGACACAGG + Intronic
1033120550 7:138664120-138664142 GGGGCGAGTGAGGGAGGCAGAGG - Intronic
1033890447 7:146006441-146006463 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1034220272 7:149439037-149439059 TGAGCCAGTGTAGGAAGTAGGGG - Intronic
1034303598 7:150035237-150035259 AGAGCCAGTGGGGGAACCAGGGG + Intergenic
1034304046 7:150036937-150036959 AGAGCCAGTGGGGGAACCAGGGG + Intergenic
1034304191 7:150037406-150037428 AGAGCCAGTGGAGGAACTAGGGG + Intergenic
1034304565 7:150038834-150038856 AGAGCCAGTGGGGGAACCAGGGG + Intergenic
1034304677 7:150039224-150039246 AGAGCCAGTGGGGGAACCAGGGG + Intergenic
1034305255 7:150041581-150041603 AGAGCCAGTGGGGGAACCAGGGG + Intergenic
1034305429 7:150042132-150042154 AGAGCCAGTGGGGGAACCAGGGG + Intergenic
1034421593 7:150993714-150993736 GGACCGAGAGGAGGGGGCAGTGG - Intronic
1034705436 7:153139198-153139220 TGCTCCAGTGGAGGTGGCAGGGG + Intergenic
1034735923 7:153429552-153429574 TGAGCCAGAGGAAGAGGTAGAGG + Intergenic
1034781669 7:153887376-153887398 GGAGCCAGGGAGGGAGGAAGAGG - Intronic
1034801416 7:154058520-154058542 AGAGCCAGTGGGGGAACCAGGGG - Intronic
1034801923 7:154060369-154060391 AGAGCCAGTGGGGGAACCAGGGG - Intronic
1034802373 7:154062058-154062080 AGAGCCAGTGGGGGAACCAGGGG - Intronic
1034802489 7:154062445-154062467 AGAGCCAGTGGGGGAACCAGGGG - Intronic
1034802547 7:154062607-154062629 AGAGCCAGTGGGGGAACCAGGGG - Intronic
1034802602 7:154062770-154062792 AGAGCCAGTGGGGGAACCAGGGG - Intronic
1035029927 7:155850178-155850200 GGTGCCTGTGGTGGAGGCTGTGG + Intergenic
1035063501 7:156088325-156088347 GCTGCCAGTGGAGCAGGGAGGGG + Intergenic
1035174579 7:157041054-157041076 GGAGCCGGTGAAGGAGACTGCGG + Intergenic
1035240342 7:157524930-157524952 GGAGACAGAGAAGGAGGCAGAGG + Intergenic
1035280807 7:157776797-157776819 GGAGGAAGTGGAGGAGGAAAGGG - Intronic
1035456208 7:159010618-159010640 GGGGCCAGTGGAGGGGGAAGGGG - Intergenic
1035498504 8:73069-73091 GGGGTAAGTGGAGGAGGGAGGGG - Intronic
1036258133 8:7221331-7221353 GGGGCCAGTGGTGGGGGTAGGGG - Intergenic
1036310182 8:7679927-7679949 GGGGCCAGTGGTGGGGGTAGGGG - Intergenic
1036601050 8:10260407-10260429 GGAGACAGAGGAGGAGGAAGCGG + Intronic
1036616521 8:10392065-10392087 GAAGCCAGTGGGGGAGGCTGAGG - Intronic
1036645124 8:10607902-10607924 GGAGGCAGAAGAGGAGGCACAGG - Exonic
1036708021 8:11059587-11059609 GGTGCCAGTGGAGGAGGAGCAGG + Intronic
1036756504 8:11474828-11474850 GGAGGAAGATGAGGAGGCAGAGG + Intergenic
1036899143 8:12658741-12658763 GGGGCCTGTGGTGGGGGCAGGGG - Intergenic
1037336738 8:17800179-17800201 GGAGGCAATGCAGGAGGGAGGGG - Intronic
1037584733 8:20268686-20268708 GGCGAGAGTGGAGGAGGAAGGGG + Intronic
1037634849 8:20692370-20692392 GCAACCAGAGGAGCAGGCAGTGG + Intergenic
1037786059 8:21903989-21904011 GGAGCCAGAGGAGCTGGGAGGGG - Intergenic
1038393730 8:27231063-27231085 AGAGCCAGTGGGGCAAGCAGAGG + Intergenic
1038421120 8:27434569-27434591 GGAGCAGGTGGAGGATGCAGCGG - Intronic
1039143723 8:34421784-34421806 GGAGCCATTGGAAGAAGAAGAGG + Intergenic
1039310690 8:36314968-36314990 GTAGTCAGTGAAGGAGGAAGAGG - Intergenic
1039848447 8:41342564-41342586 GGAGGCAGAGGAGGAGGGAAAGG + Intergenic
1039891941 8:41691629-41691651 GCACCCAGGTGAGGAGGCAGAGG - Intronic
1040340115 8:46436198-46436220 GGAGACATTGAAGCAGGCAGAGG - Intergenic
1040732447 8:50465170-50465192 TGAGCAAGGGGAGGAGGCTGTGG - Intronic
1040967267 8:53095990-53096012 GGAGGAAGAGGAGGAGGAAGAGG + Intergenic
1041539399 8:58966133-58966155 GGAGGCACTGGAGAAGGAAGAGG + Intronic
1041609909 8:59833497-59833519 GGAGGGAGAGGAGGAGGCAGAGG + Intergenic
1041716553 8:60937739-60937761 GGCGGCAGTGGAGGGGACAGTGG - Intergenic
1041763602 8:61393793-61393815 TGCTCCAGTGGAGGTGGCAGGGG + Intronic
1042170441 8:65985812-65985834 GGAGAGAGAGGAAGAGGCAGGGG - Intergenic
1042194551 8:66221292-66221314 ACGGACAGTGGAGGAGGCAGAGG - Intergenic
1042378449 8:68082780-68082802 GGCTCCAGTGCAGGAGACAGAGG - Intronic
1043040839 8:75259933-75259955 TGTTCCAGTGGAGGTGGCAGGGG - Intergenic
1043552056 8:81386094-81386116 GGCCCCAGTGGTGGAGGTAGTGG + Intergenic
1044300317 8:90575921-90575943 GGATCCAGTGTAGGAGTTAGAGG - Intergenic
1044467770 8:92526515-92526537 GGTGCCAATGGTGGTGGCAGCGG - Intergenic
1044917953 8:97136203-97136225 GGAGCAAGGGAAGGAGGAAGAGG + Intronic
1044927085 8:97218552-97218574 AGAGGGACTGGAGGAGGCAGTGG - Intergenic
1045122830 8:99056698-99056720 CCATCCAGTGGAGGTGGCAGGGG + Intronic
1045292704 8:100847603-100847625 GGAGCCAGCAGAGGAGCTAGTGG + Intergenic
1045357877 8:101405402-101405424 GCAGCAAATGGGGGAGGCAGAGG - Intergenic
1045834215 8:106501364-106501386 GAAGCCAGTGAAGTAGGCAGGGG + Intronic
1046870958 8:119205529-119205551 GGTGGCAGTGGGGGAGGCGGGGG + Intronic
1047168371 8:122465673-122465695 GCAGCCATTTGATGAGGCAGAGG - Intergenic
1047274634 8:123396295-123396317 GGAGCCCGTGGCCGAGGCCGCGG + Exonic
1047534920 8:125710870-125710892 GGAGGAAGAGGAGGAGGAAGAGG + Intergenic
1047702039 8:127458340-127458362 GGAGCCAGCGGAAGAGGATGTGG - Intergenic
1048064398 8:130952707-130952729 GGAGCCAAGGCTGGAGGCAGAGG + Intronic
1048195917 8:132331593-132331615 GGAGCAGGAGGAGGAGGAAGAGG - Intronic
1048326525 8:133443393-133443415 GGTGGCGGTGGAGGTGGCAGTGG - Intergenic
1048371644 8:133783773-133783795 TGCTCCAGTGGAGGTGGCAGGGG + Intergenic
1048448423 8:134510557-134510579 CAAGCCAGTGGCTGAGGCAGTGG + Intronic
1048524897 8:135193447-135193469 GGAGCCAGCCGAGCTGGCAGAGG - Intergenic
1048551913 8:135441435-135441457 GGAGCCACAGGAGGAAGGAGGGG + Intergenic
1048575992 8:135690490-135690512 GGCGCTAGTGGAGCAGGGAGCGG + Intergenic
1048882464 8:138882122-138882144 GGAGCTCGGGGAGGAGGCAGGGG - Intronic
1048996356 8:139796021-139796043 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1048996371 8:139796090-139796112 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1048996384 8:139796139-139796161 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1049121968 8:140747501-140747523 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1049381503 8:142318649-142318671 GGAGCCAGGAGCGAAGGCAGGGG + Intronic
1049408644 8:142462759-142462781 TGAGCCTGTGCAGGAGGGAGGGG - Intronic
1049478901 8:142810667-142810689 CTAGCCAGTGCAGGGGGCAGGGG + Intergenic
1049607903 8:143538194-143538216 GGAGGAAGAGGAGGAGGCAGAGG + Exonic
1049741469 8:144243001-144243023 AAAGCCAGTGGAAGTGGCAGTGG + Intronic
1049748755 8:144273831-144273853 GGAGCCCCTGGAGGAGGCGCTGG - Intronic
1049869729 8:144965357-144965379 TGCTCCAGTGGAGGTGGCAGGGG + Intergenic
1049906931 9:226484-226506 GGAGGCAGTGGAGAATCCAGGGG + Intronic
1050002837 9:1096868-1096890 GGAGCCAGTGTCGGATGCTGTGG + Intergenic
1050018720 9:1262025-1262047 GGATCCTGAGGAAGAGGCAGTGG + Intergenic
1050423602 9:5491879-5491901 GGAGGGAGTGGAGAGGGCAGAGG + Intergenic
1050642403 9:7682372-7682394 GGAGACAGTGGAGGATGGAGAGG - Intergenic
1050744244 9:8858109-8858131 GGAGCGGGAGGAGGAGGAAGAGG - Intronic
1051687640 9:19675241-19675263 TGCTCCAGTGGAGGTGGCAGGGG + Intronic
1052624857 9:30962118-30962140 TGCTCCAGTGGAGGTGGCAGGGG + Intergenic
1052836393 9:33253162-33253184 GGAGCTAGAGGGAGAGGCAGAGG + Exonic
1052918121 9:33939769-33939791 GGAGGAAGGGGAGGAGGAAGGGG + Intronic
1052918126 9:33939781-33939803 GGAGGAAGGGGAGGAGGAAGGGG + Intronic
1052918131 9:33939793-33939815 GGAGGAAGGGGAGGAGGAAGGGG + Intronic
1052918136 9:33939805-33939827 GGAGGAAGGGGAGGAGGAAGGGG + Intronic
1052925915 9:34016212-34016234 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1053055195 9:34989769-34989791 GGAGCCGGGGGAGGGGGCAGCGG + Exonic
1053123028 9:35560375-35560397 GGAGACAGAAGAGGTGGCAGAGG + Exonic
1053165039 9:35838386-35838408 GGAGACAGAGGAGTGGGCAGTGG - Intronic
1053269413 9:36739944-36739966 GGTGCCATGGGAGGAGGAAGGGG - Intergenic
1053524472 9:38814924-38814946 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1054196707 9:62039327-62039349 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1054641697 9:67549355-67549377 GGAGGAAGAGGAGGAGGAAGAGG + Intergenic
1054835697 9:69672708-69672730 GGAGCCAGAGGATGGGGCTGTGG - Intergenic
1054904781 9:70405197-70405219 GGAACCAGTGGAATAGGCAATGG - Intronic
1055125955 9:72718591-72718613 TGGTCCAGTGGAGGTGGCAGAGG + Intronic
1055183660 9:73422769-73422791 AGAGGGAGGGGAGGAGGCAGGGG + Intergenic
1055194141 9:73566320-73566342 GAAGGTAGTGGAGGAGGTAGAGG - Intergenic
1055289868 9:74771153-74771175 TGAGGCAGTGGGCGAGGCAGGGG - Intronic
1056469073 9:86887321-86887343 GGAGAGGGTGGAGTAGGCAGTGG - Intergenic
1056789593 9:89617021-89617043 GGTGCCAGTGGAGGGTCCAGGGG - Intergenic
1056819969 9:89833442-89833464 GGAGACAGAGGAAGAGGAAGAGG - Intergenic
1056828003 9:89890211-89890233 TGACCCAGTGGAGGTGGAAGAGG + Intergenic
1057181559 9:93033405-93033427 GGAGCAGGAGGAGGAGGGAGAGG - Intronic
1057231903 9:93326142-93326164 GAAGACAGTGGGGGAGGAAGCGG - Intronic
1057310888 9:93942603-93942625 GGAGGAGGAGGAGGAGGCAGCGG - Intergenic
1058172862 9:101703885-101703907 AGAGACAGTAGTGGAGGCAGAGG - Intronic
1058418300 9:104810931-104810953 CCAGGCAGTGGAGGGGGCAGGGG + Intronic
1058625606 9:106929966-106929988 GGAGCCATGGGAGGAGTCAAAGG - Intronic
1058666699 9:107324906-107324928 GGAGGAGGTGGAGGTGGCAGTGG + Exonic
1058694417 9:107547332-107547354 GGAACCAGAGGAGGGGGCAAGGG + Intergenic
1058784504 9:108374132-108374154 TGCTCCAGTGGAGGTGGCAGGGG + Intergenic
1058834096 9:108845732-108845754 GGAGCCAGCATAGGAGGCCGTGG - Intergenic
1058877167 9:109254319-109254341 GGGTCCTGTGGAGGATGCAGAGG - Intronic
1058949924 9:109893823-109893845 GGGGCCAGTCGAGGGGGCTGCGG + Intronic
1059258034 9:112948471-112948493 GGGGCCAGTCAAGGAGGCTGGGG + Intergenic
1059366343 9:113789457-113789479 GGAGGAAGGAGAGGAGGCAGAGG - Intergenic
1059409724 9:114124361-114124383 GGGGAGAGAGGAGGAGGCAGAGG + Intergenic
1059489261 9:114653679-114653701 AGAGACATTGGAGGAGGAAGAGG - Intergenic
1059583798 9:115583075-115583097 GGGGCCTGTTGACGAGGCAGGGG - Intergenic
1060221752 9:121767806-121767828 GGAGCGGGTACAGGAGGCAGTGG + Intronic
1060269071 9:122128443-122128465 GGGGACTGTGGAGGGGGCAGGGG - Intergenic
1060371834 9:123080966-123080988 GGCAGAAGTGGAGGAGGCAGAGG - Intronic
1060569949 9:124629050-124629072 GGAGGCATTGCAGGAGGCAGAGG - Intronic
1060785840 9:126451104-126451126 GGGGTCAGAGGAGGAGGAAGAGG + Intronic
1061153419 9:128842610-128842632 GGAGGCACTGGGGGAGGAAGGGG - Intronic
1061208426 9:129177348-129177370 GAAGCCGGGGGAGGAGGCGGGGG + Exonic
1061246250 9:129402497-129402519 GGAGCAGGCGAAGGAGGCAGCGG - Intergenic
1061386546 9:130293999-130294021 GGGTCCAGTGTAGCAGGCAGGGG + Intronic
1061645341 9:131996368-131996390 GGAGCCACTGGAGCCGGCAGAGG + Intronic
1061883447 9:133579186-133579208 GGAGCCGCCGGAGGAGGAAGAGG - Exonic
1061886447 9:133593407-133593429 GGGGCCAGTGGAGGTGGCCTGGG - Intergenic
1061902592 9:133680628-133680650 GGAGCGTGTGGAGGACGGAGCGG - Intronic
1061974641 9:134062078-134062100 GGAGCCAGGGGAGAAGTCGGGGG + Intronic
1062145765 9:134988846-134988868 GGAGCAAGAGGCAGAGGCAGGGG + Intergenic
1062243783 9:135553046-135553068 GGAGGCAGAGTGGGAGGCAGAGG - Intergenic
1062429349 9:136520086-136520108 GCAGCCTGTGGAGGAGGAGGGGG - Intronic
1062462578 9:136668081-136668103 GGGGCCAGCGGAGGAGAGAGTGG + Intronic
1062730837 9:138107575-138107597 AGAGCCAGAGGAGGCGGCAATGG - Intronic
1062737265 9:138144317-138144339 GGGGCCAGAGGAGGAGTGAGGGG + Intergenic
1203610492 Un_KI270748v1:91525-91547 GGGGTAAGTGGAGGAGGGAGGGG + Intergenic
1185499214 X:584599-584621 GGAGGGAGAGGAGGAGGGAGAGG + Intergenic
1185603538 X:1354794-1354816 GGAGAGGGTGGAGGAGGAAGAGG + Intronic
1185662075 X:1735736-1735758 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1186124707 X:6400904-6400926 GGAGGAAGGGGAGGGGGCAGGGG - Intergenic
1186170158 X:6868134-6868156 GGTGACAGTGCAGGTGGCAGTGG + Intergenic
1186327906 X:8499878-8499900 AGATCATGTGGAGGAGGCAGAGG + Intergenic
1186768029 X:12791335-12791357 GGAGCCGGAGGAGGAGCTAGAGG - Intronic
1186846572 X:13536633-13536655 TGAGCCAGTGGTGAAGGCAGTGG - Intergenic
1187722459 X:22165490-22165512 GGAGGCAGAGGCGGAGGCGGAGG + Intronic
1187748435 X:22433946-22433968 TGCTCCAGTGGAGGTGGCAGAGG - Intergenic
1189834105 X:45003844-45003866 GGAGAGAGAGGAGAAGGCAGGGG - Intronic
1189999158 X:46668421-46668443 GGAGGCAGAGGCGGAGGCAGAGG + Intronic
1190325302 X:49203679-49203701 TTAGCCAGAGGAGGTGGCAGAGG - Intergenic
1190440471 X:50470563-50470585 GGAGCCGGTGGTGGTGGCGGCGG + Exonic
1190453969 X:50607670-50607692 GGAGGCAGAGGAGGAGGAAGAGG - Exonic
1190456638 X:50634200-50634222 GGAGCCAGTGGAAGAGACCCAGG - Exonic
1190759491 X:53427810-53427832 GAGGCCAGAGAAGGAGGCAGAGG + Intronic
1190898969 X:54650604-54650626 AGAGCCAGTGGACGAGGCGGGGG + Intergenic
1191184297 X:57592777-57592799 GGCGCCTGAGGAGGAGGCGGAGG + Exonic
1192172282 X:68864234-68864256 GGAGCCAGGGAAGGAGGTGGGGG + Intergenic
1192312815 X:70030561-70030583 GGAGGCTGGGGAGGAGGCAGGGG - Intronic
1192358594 X:70424879-70424901 GGAGCCCGGGGGAGAGGCAGAGG - Intronic
1192433860 X:71130230-71130252 GGGGGCTGTGGAGGAAGCAGTGG + Intronic
1192881050 X:75284684-75284706 TGTTCCAGTGGAGGTGGCAGGGG + Intronic
1192968131 X:76202066-76202088 TGTTCCAGTGGAGGTGGCAGGGG + Intergenic
1193520396 X:82522975-82522997 GGTTCCAGTGGTGGTGGCAGAGG + Intergenic
1194165402 X:90508413-90508435 TGCTCCAGTGGAGGTGGCAGGGG - Intergenic
1194177852 X:90673490-90673512 GGAGGCAGAGGCCGAGGCAGAGG + Intergenic
1194688923 X:96957939-96957961 GGAGGTGGTGGAGGAGGAAGAGG - Exonic
1194882518 X:99271738-99271760 TGTTCCAGTGGAGGTGGCAGGGG + Intergenic
1195065393 X:101234515-101234537 TGAGCCAGGCCAGGAGGCAGGGG - Intronic
1195231921 X:102859135-102859157 TGCTCCAGTGGAGGTGGCAGGGG + Intergenic
1195237149 X:102911629-102911651 GCAGCCAGTGGAGGTAGCAGGGG - Intergenic
1195463526 X:105154674-105154696 GGATCCAGTGGAGGAGACACAGG - Intronic
1195668368 X:107449971-107449993 GGAGGAAGAGGAGGAGGAAGAGG + Intergenic
1195740372 X:108059202-108059224 AGAGCAAGTTGAGGAGGCTGGGG + Intronic
1195756603 X:108205033-108205055 GGAGGAAGTGGAGGAGGGGGAGG + Intronic
1195896336 X:109749417-109749439 GGAGCCCATGGAGGGGGCGGAGG + Intergenic
1195909162 X:109872074-109872096 GGAGAGGGAGGAGGAGGCAGGGG - Intergenic
1195923154 X:110002570-110002592 GGAGGCAGTGGCGGTGGCAGCGG + Intergenic
1196228837 X:113197305-113197327 GGAGCCTGTCGTGGGGGCAGAGG - Intergenic
1196724621 X:118885152-118885174 GGAGGCAGTGGAGGTGACACAGG + Intergenic
1196741558 X:119029842-119029864 GGCGCCAGTGGAGCAGGGGGTGG - Intergenic
1196865204 X:120065077-120065099 GGGGGCAGAGGAGGAAGCAGGGG + Intergenic
1196877889 X:120171203-120171225 GGGGGCAGAGGAGGAAGCAGGGG - Intergenic
1196900031 X:120373893-120373915 GGAGCAGGAGGAGGAGGCGGGGG - Intronic
1196951791 X:120931748-120931770 GGAGGAAGAGGAGGAGGAAGAGG - Exonic
1196952475 X:120936609-120936631 GGAGGAAGAGGAGGAGGAAGAGG - Exonic
1196953160 X:120941470-120941492 GGAGGAAGAGGAGGAGGAAGAGG - Exonic
1196953845 X:120946330-120946352 GGAGGAAGAGGAGGAGGAAGAGG - Exonic
1196954530 X:120951191-120951213 GGAGGAAGAGGAGGAGGAAGAGG - Exonic
1196955213 X:120956051-120956073 GGAGGAAGAGGAGGAGGAAGAGG - Exonic
1196955900 X:120960934-120960956 GGAGGAAGAGGAGGAGGAAGAGG - Exonic
1196956582 X:120965795-120965817 GGAGGAAGAGGAGGAGGAAGAGG - Exonic
1196957264 X:120970655-120970677 GGAGGAAGAGGAGGAGGAAGAGG - Exonic
1196957946 X:120975515-120975537 GGAGGAAGAGGAGGAGGAAGAGG - Exonic
1196958628 X:120980375-120980397 GGAGGAAGAGGAGGAGGAAGAGG - Exonic
1196959309 X:120985235-120985257 GGAGGAAGAGGAGGAGGAAGAGG - Exonic
1197055443 X:122113482-122113504 TGCTCCAGTGGAGGTGGCAGGGG + Intergenic
1197669029 X:129255615-129255637 TGTTCCAGTGGAGGTGGCAGGGG + Intergenic
1197720623 X:129742362-129742384 GGAGGGAGTGGAGGGGGGAGGGG - Intronic
1197971474 X:132119587-132119609 GGACCCAGAAGAGGAGGAAGTGG + Intronic
1198383394 X:136105125-136105147 GGAGAGAGAGGAGGAGGGAGGGG + Intergenic
1198462613 X:136877941-136877963 GGAGGAAGTGGAGGAACCAGGGG - Exonic
1199526798 X:148801854-148801876 GGAGAGAGTGGAAGGGGCAGAGG - Intronic
1199711300 X:150471324-150471346 AGTGGCCGTGGAGGAGGCAGTGG - Exonic
1199751537 X:150824058-150824080 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1199751567 X:150824203-150824225 GGAGGAAGAGGAGGAGGAAGAGG + Intronic
1199772001 X:150981091-150981113 GGAGACAGGGGAAGAGGGAGTGG + Intronic
1199913784 X:152316120-152316142 TGCTCCAGTGGAGGTGGCAGCGG - Intronic
1200022958 X:153226917-153226939 GAAGCCTGTGCAGGAGACAGAGG + Intergenic
1200024055 X:153240210-153240232 GGAGCCACTGGAGGAAGGAGAGG - Intergenic
1200039530 X:153355468-153355490 GGAGCCCAGGGAGGAGGGAGGGG - Intronic
1200234963 X:154463779-154463801 GGAGAAAGTGGAGGAGGGCGGGG - Intronic
1200238738 X:154482690-154482712 GGAGCAAGTGGTGGAAACAGCGG + Intergenic
1200399508 X:156010842-156010864 GGGGCCAGAGGAGGAGTGAGGGG + Intergenic
1200511670 Y:4086223-4086245 TGCTCCAGTGGAGGTGGCAGGGG - Intergenic
1200524516 Y:4255640-4255662 GGAGGCAGAGGCCGAGGCAGAGG + Intergenic
1201422833 Y:13818996-13819018 GGAGGAAGAGGAGGAGGAAGAGG - Intergenic
1201422836 Y:13819008-13819030 GGAGAAAGAGGAGGAGGAAGAGG - Intergenic
1201434113 Y:13938168-13938190 AGATCATGTGGAGGAGGCAGAGG - Intergenic
1201560489 Y:15310926-15310948 GGTGAAAGTGGAGGTGGCAGTGG + Intergenic
1202112209 Y:21434023-21434045 TGAGCCAGTGTAGAAGGCTGAGG + Intergenic