ID: 1023270439

View in Genome Browser
Species Human (GRCh38)
Location 7:38456287-38456309
Sequence CTCCCTAATAGCAGGTCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 97}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023270435_1023270439 -3 Left 1023270435 7:38456267-38456289 CCACCATGAGAGGCTTTGACCTC 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1023270439 7:38456287-38456309 CTCCCTAATAGCAGGTCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 97
1023270429_1023270439 22 Left 1023270429 7:38456242-38456264 CCACAGCTACCTCCCTACACTGC 0: 2
1: 2
2: 3
3: 38
4: 385
Right 1023270439 7:38456287-38456309 CTCCCTAATAGCAGGTCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 97
1023270436_1023270439 -6 Left 1023270436 7:38456270-38456292 CCATGAGAGGCTTTGACCTCCCT 0: 1
1: 0
2: 1
3: 15
4: 153
Right 1023270439 7:38456287-38456309 CTCCCTAATAGCAGGTCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 97
1023270428_1023270439 23 Left 1023270428 7:38456241-38456263 CCCACAGCTACCTCCCTACACTG 0: 2
1: 3
2: 2
3: 34
4: 417
Right 1023270439 7:38456287-38456309 CTCCCTAATAGCAGGTCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 97
1023270432_1023270439 9 Left 1023270432 7:38456255-38456277 CCTACACTGCTCCCACCATGAGA 0: 1
1: 0
2: 1
3: 18
4: 227
Right 1023270439 7:38456287-38456309 CTCCCTAATAGCAGGTCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 97
1023270430_1023270439 13 Left 1023270430 7:38456251-38456273 CCTCCCTACACTGCTCCCACCAT 0: 1
1: 0
2: 2
3: 57
4: 593
Right 1023270439 7:38456287-38456309 CTCCCTAATAGCAGGTCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 97
1023270434_1023270439 -2 Left 1023270434 7:38456266-38456288 CCCACCATGAGAGGCTTTGACCT 0: 1
1: 0
2: 1
3: 8
4: 102
Right 1023270439 7:38456287-38456309 CTCCCTAATAGCAGGTCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 97
1023270431_1023270439 10 Left 1023270431 7:38456254-38456276 CCCTACACTGCTCCCACCATGAG 0: 1
1: 0
2: 3
3: 19
4: 228
Right 1023270439 7:38456287-38456309 CTCCCTAATAGCAGGTCCGCAGG 0: 1
1: 0
2: 0
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023270439 Original CRISPR CTCCCTAATAGCAGGTCCGC AGG Intronic
902248243 1:15136017-15136039 CTCCCTAATCTCAGGTACCCAGG - Intergenic
904846652 1:33423971-33423993 CTCCCGAATAGCAGGACTACAGG - Intronic
907131375 1:52100328-52100350 CTCCCTAATAGCTGGGACTCAGG + Intergenic
908468354 1:64416661-64416683 CTCCCTAATCTCAAGTACGCAGG + Intergenic
915980505 1:160417064-160417086 CTCCCCAGTAGCAGGTGAGCTGG - Intronic
915992799 1:160533122-160533144 CTCCCTAATCTCAGGTACCCAGG + Intergenic
916221686 1:162450998-162451020 CTCCCTAATCTCAGGTACCCAGG - Intergenic
918011663 1:180592582-180592604 CTCCCCAATATCATGTCCTCAGG - Intergenic
918812394 1:189139340-189139362 CTCCCTAATCTCAGGTACCCAGG - Intergenic
919959311 1:202451338-202451360 CTCCCTAATCTCAAGTACGCAGG - Intronic
923790683 1:237108467-237108489 CTCCCTGGGAGCAGGGCCGCTGG + Intronic
1063732183 10:8710451-8710473 CTCCCTAGTAGCTGGGCTGCAGG + Intergenic
1069929894 10:71875314-71875336 CTCCCTAATCGCAAGTACCCAGG - Intergenic
1070964974 10:80524369-80524391 CTCCCTCATAGGAGGTGCGGAGG - Exonic
1073608052 10:104915454-104915476 CTCCCGTATAGAGGGTCCGCTGG + Intronic
1075725350 10:124608099-124608121 CTCCCTAGTGCCAGGTCTGCTGG + Intronic
1079479132 11:20862772-20862794 CTCCCTAATCTCAAGTACGCAGG - Intronic
1081528212 11:43941583-43941605 GTCTCTAAGAGCAGGTCCACAGG - Intronic
1082071760 11:47945065-47945087 CTCCCGAATAGCAGGATAGCAGG + Intergenic
1084280261 11:68085344-68085366 CTCCCAAGTAGCAGGACCACAGG + Intronic
1084371326 11:68746335-68746357 GACCCTAAAAGCAGGTCAGCAGG - Intronic
1097399124 12:59108471-59108493 CTCCCTAATCTCAGGTACCCAGG + Intergenic
1098242686 12:68484743-68484765 CTCCCTAATCTCAAGTACGCAGG + Intergenic
1099710878 12:86223287-86223309 CTCCCTAGTGGCAAGTCCACAGG + Intronic
1101892524 12:108730594-108730616 TTCCCTAATAGCGGGGCAGCTGG - Intronic
1104605435 12:130184323-130184345 CTCCCGCATGGCAGGTCCTCTGG + Intergenic
1106193095 13:27471418-27471440 CTCCCAAATAGCTGGTTCACAGG - Intergenic
1115688767 14:35824122-35824144 CTCCCTAATCTCAGGTACCCAGG - Intergenic
1118004020 14:61549085-61549107 CTCCCTAATCCCAGGGGCGCTGG - Intronic
1118141281 14:63085969-63085991 CTCCCTAATAGCTGGACTACAGG + Intronic
1122254167 14:100464495-100464517 CTGGCTAATAGCAGGTCCTCAGG + Intronic
1122702876 14:103602027-103602049 CTCCCTAGTAGCGGGTCTACAGG - Intronic
1124607988 15:31185235-31185257 CTCCCTAATCGCAAGTTCCCAGG + Intergenic
1127653638 15:61034566-61034588 CTCCCTACTGGCAGTTCCCCAGG - Intronic
1129737353 15:77973768-77973790 CTGCCCAACAGCAGGCCCGCAGG + Intergenic
1129848719 15:78779857-78779879 CTGCCCAACAGCAGGCCCGCAGG - Intronic
1136496616 16:30649036-30649058 CTCTGTAACAGGAGGTCCGCTGG - Intergenic
1139623035 16:68162912-68162934 CTCCCTAATCGCAAGTACCCAGG - Intronic
1139864804 16:70052775-70052797 CTCCCTAATCGCAAGTACCCAGG + Intergenic
1140988648 16:80186153-80186175 CTCCTTAATAGCTGGGCCTCAGG + Intergenic
1141494464 16:84397549-84397571 CTCCTGAATAGCAGGACCACAGG - Intronic
1142704880 17:1688743-1688765 CTCCCTAATCTCAGGTACCCAGG - Intergenic
1143022451 17:3923901-3923923 CTACCAAACAGCAGGTCAGCAGG + Intronic
1145920010 17:28603621-28603643 CTCCCTAATCGCAAGTACCCAGG - Intronic
1150099404 17:62409178-62409200 CTCCCAAATAGCTGGACCACAGG + Intronic
1152932660 17:83118082-83118104 CTCACTAAAGGCAGGTCCGGAGG - Intergenic
1162708881 19:12576994-12577016 CTCCCAAATAGAAGGACCCCAGG + Intronic
1166043568 19:40217057-40217079 CTACCTAGAAGCAGCTCCGCGGG + Intronic
1167548230 19:50141690-50141712 CTCCCTAATCGCAAGTTCCCAGG + Intergenic
1167817507 19:51896739-51896761 CTCCCAAATGGCAGATCCTCAGG - Intronic
1167897360 19:52592947-52592969 CTCCCTAATCTCAGGTACCCAGG - Intergenic
1167975595 19:53223459-53223481 CTCCCTAATCTCAGGTACCCAGG + Intergenic
1168017795 19:53587430-53587452 CTCCCTAATCTCAGGTACCCAGG + Intergenic
1168385587 19:55960411-55960433 CTCCCTAATAAAAGGTCCTCAGG - Intronic
930435758 2:51339934-51339956 CTTCCTAATAGCATTTCGGCTGG + Intergenic
935183251 2:100708521-100708543 CTTCCTTATAGCAGGGCGGCTGG + Intergenic
939537965 2:143455970-143455992 CTTCCTAATGGCAGGTCTCCAGG - Intronic
940080783 2:149798525-149798547 TTCCCTAATAGCAGGTCCTGAGG - Intergenic
943005924 2:182387244-182387266 CTCCCTAATCTCAAGTACGCAGG + Intronic
943291644 2:186079528-186079550 CTCCCTTAAAGCAGGACAGCAGG + Intergenic
946012528 2:216577651-216577673 CTCCCAAATAGCTGGACTGCAGG + Intronic
947614856 2:231549378-231549400 CTCCCTAGTACCAGGCCCACAGG + Intergenic
1172729058 20:37070296-37070318 CTCCCTAATCGCAAGTTCCCAGG + Intronic
1172797365 20:37550307-37550329 CTCCCTAATCGCAAGTTCCCAGG - Intergenic
1172910911 20:38408160-38408182 CTCCCTAATCGCAAGTTCCCAGG + Intergenic
1174483172 20:50845274-50845296 CTCCCAGAGAGCAGGTCCGGCGG - Intronic
1181592816 22:23895334-23895356 CTCCCGAACAGCAGGTTCGGAGG - Exonic
1181929345 22:26387413-26387435 CTCCCAAATAGCTGGACCACAGG + Intergenic
1182997451 22:34827198-34827220 ATCCCCAATAGCAGGACTGCTGG + Intergenic
952296184 3:32064084-32064106 CTCCCTAGTAGCTGGACCACAGG + Intronic
952913251 3:38209339-38209361 CTCCCAAATAGCTGGCCCACAGG + Intronic
957010296 3:74997579-74997601 CTCCCGAGTAGCAGGTCTACAGG + Intergenic
959985302 3:112564768-112564790 CTCCCTAATCTCAAGTACGCAGG - Intronic
968470445 4:779617-779639 CTACCTAAAAGGAGGTCCCCAGG + Intergenic
970964543 4:21913215-21913237 CTCCCAAGTAGCTGGTCTGCAGG - Intronic
979523711 4:121696676-121696698 CTCCCCAAGCGCAGGTCCGCGGG + Intronic
980883779 4:138739957-138739979 CTCCCTAATCTCAAGTACGCAGG + Intergenic
981551455 4:145945707-145945729 CTCCCTGATGGCAGGTCCATGGG + Intergenic
985057778 4:186050306-186050328 CTCCCTAATCTCAAGTACGCAGG + Intergenic
985105055 4:186491683-186491705 CTCCCAAATAGCTGGACCACAGG - Intronic
989837436 5:46009624-46009646 CTCCCTAATCGCAAGTACCCAGG - Intergenic
992061038 5:73047956-73047978 CTCCCTAGTAGCTGGGCTGCAGG + Intronic
997984573 5:138492275-138492297 CTCCTTGGCAGCAGGTCCGCTGG - Intergenic
1000301736 5:159962791-159962813 CTCCCGAGTAGCTGGTCCACAGG + Intronic
1005625018 6:27654214-27654236 CTCCCTAATCGCAAGTACCCAGG + Intergenic
1006599579 6:35216515-35216537 TTGCCTAATAGCAGGTTTGCTGG + Intronic
1009042126 6:58191259-58191281 CTCCCTAATCGCAAGTTCCCAGG + Intergenic
1013955653 6:115836975-115836997 CTCCCTAATCTCAGGTACCCAGG + Intergenic
1016029143 6:139319639-139319661 CTCCCAAATAGCTGGTACACAGG - Intergenic
1019111016 6:169713996-169714018 CTCCCAAATAGCGGGACTGCAGG - Intronic
1023270439 7:38456287-38456309 CTCCCTAATAGCAGGTCCGCAGG + Intronic
1026285403 7:68958307-68958329 CTCCCTAGTAGCAGGACTACAGG - Intergenic
1028137491 7:87237405-87237427 CTCCCGAGTAGCAGGACTGCAGG - Intergenic
1031280579 7:119795443-119795465 CTCCCTAATTGCAGAGCCACAGG - Intergenic
1043873533 8:85461813-85461835 CTCCCTAACAGCAGCTCTGTGGG + Intergenic
1045187495 8:99853959-99853981 CTTCCTAACAGCAGGTTGGCTGG + Exonic
1050665405 9:7930273-7930295 CTCACTAATATCAGGTATGCGGG - Intergenic
1052903499 9:33815619-33815641 CTCCCAAGTAGCAGGACCACAGG - Intergenic
1054706589 9:68469038-68469060 CTCCCAAGTAGCAGGACCACAGG + Intronic
1055678984 9:78695212-78695234 CTCAGTAATAGCAGGGCTGCTGG - Intergenic
1189997354 X:46651703-46651725 CTCCCTAGTAGCTGGGCCACAGG - Intronic
1194901309 X:99514817-99514839 CTCTCTTATGGCAGGTCTGCTGG - Intergenic