ID: 1023271693

View in Genome Browser
Species Human (GRCh38)
Location 7:38470029-38470051
Sequence CAGGATGTTCAACCTGATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023271693_1023271697 1 Left 1023271693 7:38470029-38470051 CCTTGATCAGGTTGAACATCCTG 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1023271697 7:38470053-38470075 TTTATCAAGCTTGGGCCCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 115
1023271693_1023271694 -8 Left 1023271693 7:38470029-38470051 CCTTGATCAGGTTGAACATCCTG 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1023271694 7:38470044-38470066 ACATCCTGCTTTATCAAGCTTGG No data
1023271693_1023271700 23 Left 1023271693 7:38470029-38470051 CCTTGATCAGGTTGAACATCCTG 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1023271700 7:38470075-38470097 GTATACCCCTCAACACTCTCTGG No data
1023271693_1023271695 -7 Left 1023271693 7:38470029-38470051 CCTTGATCAGGTTGAACATCCTG 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1023271695 7:38470045-38470067 CATCCTGCTTTATCAAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023271693 Original CRISPR CAGGATGTTCAACCTGATCA AGG (reversed) Intronic
901133249 1:6976121-6976143 CAGGAAGATCAATCTGATCATGG + Intronic
901548729 1:9979175-9979197 CAAAATGTTCAGGCTGATCATGG + Intronic
903264251 1:22147493-22147515 AAGGCTGTTCACCCTGACCAGGG + Intergenic
907246718 1:53113663-53113685 CAGAAGGTTCAATCTGACCAGGG - Intronic
908008709 1:59753844-59753866 CAGGATTTTTAACCAGAGCAGGG - Intronic
908107424 1:60859551-60859573 TAGGATTTTCCACCTGATTAAGG + Intergenic
910622098 1:89267083-89267105 CAGGATCTTCAACCCTGTCAAGG + Exonic
911264484 1:95726946-95726968 CATGATGCTCAAGCTGGTCAGGG + Intergenic
917984390 1:180300054-180300076 CAGGATTTACAACCTGCTTAAGG + Intronic
919401339 1:197121208-197121230 TAGTTTGTTCAACTTGATCAAGG + Intronic
920409868 1:205750563-205750585 GAGGATTTTCAAGGTGATCAAGG - Intergenic
1068049545 10:51931957-51931979 CAGGATTTTCAAACATATCAAGG - Intronic
1068118237 10:52758236-52758258 CTGGATTTCCACCCTGATCAGGG - Intergenic
1071470980 10:85983926-85983948 CAGGACGCTCACCCTCATCATGG + Intronic
1071863785 10:89703317-89703339 TAGGAATTTCAGCCTGATCAAGG + Intronic
1073841679 10:107505100-107505122 CATGTTGGTCAACCTAATCATGG - Intergenic
1074317841 10:112375470-112375492 CAGGAAGTTCAGCATGATCCTGG - Intronic
1078466770 11:11555775-11555797 CAGGCTATTCCACCTGGTCATGG - Intronic
1079017355 11:16880530-16880552 CAGCATGTTCAGCCTGCTCTAGG + Intronic
1080016673 11:27514460-27514482 CAGGATGCACAACCTGAAGAGGG - Intergenic
1080325658 11:31069882-31069904 CAGAATGTTCAGCCACATCATGG - Intronic
1087216518 11:95501235-95501257 CAGCATGTTCACCCTCATTATGG - Intergenic
1087252403 11:95917766-95917788 CAGCATGTGCAACATGATGAGGG - Intronic
1089565314 11:119368236-119368258 CAGGAAGTTCAACCTCCTTAGGG + Intronic
1093566206 12:20607068-20607090 CAGGATGTCCTACCTAATCCTGG - Intronic
1096259183 12:50080488-50080510 CAGGATGTTCTCCCTGCACAGGG - Exonic
1098764106 12:74462910-74462932 AAGGATTTTCAACCTAATCATGG + Intergenic
1101530505 12:105569134-105569156 CAGGTTGTTCCACCTGGCCAAGG + Intergenic
1106255287 13:28016903-28016925 CTGGATGTTCACCCTGGACAAGG + Intronic
1108026511 13:46183816-46183838 CAGGATGTGGAACCAGATCAGGG - Intronic
1108691965 13:52867231-52867253 CAGGATGTACAGCCTGGTCAGGG - Intergenic
1113667556 13:112151346-112151368 CAGGATGATCTATCTGGTCAAGG + Intergenic
1113824780 13:113243258-113243280 CAAAATGTTCAAGCTGCTCAAGG + Intronic
1118327548 14:64791844-64791866 CAGGATGTCGAACCTGATATGGG + Exonic
1118716766 14:68565274-68565296 CAGGATGTGCTGCCTTATCAGGG + Intronic
1132217584 15:100077610-100077632 GAGCATGCTCAACCTGATAAAGG + Intronic
1139233653 16:65311676-65311698 CAGGACGTTCCACCTGTTAAGGG - Intergenic
1139624870 16:68179204-68179226 CAGGGTCTTCAACCTAATCTTGG - Intronic
1142191413 16:88719941-88719963 CAGGATGTTCAACCAGAATGTGG - Exonic
1146384811 17:32360678-32360700 CAGCCTGTTCAACCTCAGCAAGG + Exonic
1148356070 17:46976868-46976890 CAGGAAGTCCAGCCTGATCTGGG - Intronic
1158204472 18:54976516-54976538 CAGGAGGCTCAACATGATCCTGG - Intergenic
1160555899 18:79724969-79724991 CAGGAAATCCAACTTGATCAAGG - Intronic
1160565186 18:79782701-79782723 CAGGCAGGTCAACCTGACCACGG - Intergenic
1167150098 19:47703406-47703428 CAGGGGGTTCAACATGAACAAGG + Intergenic
1168256026 19:55165848-55165870 CAGGAGGTTCAACGTGAGCTGGG - Exonic
1168564481 19:57411756-57411778 CAGGATGTTAAACCAGGACAAGG + Intronic
927229302 2:20804200-20804222 TAGGATGTTCAATCTGGGCAGGG - Intronic
928124518 2:28606486-28606508 CAAGTGGTTCAAGCTGATCAGGG - Exonic
928323738 2:30303572-30303594 CAGGACCTTCAACCAGACCAGGG - Intronic
930734477 2:54762361-54762383 GGTGATGTTCAATCTGATCATGG + Intronic
939343293 2:140928632-140928654 CAGGAAGTACAACCTTACCATGG + Intronic
939652012 2:144775134-144775156 CTGAATGTTCAACATGATCCTGG + Intergenic
944071951 2:195680804-195680826 CATACTGTTCACCCTGATCATGG - Exonic
945485446 2:210390131-210390153 CAGGATGTTAAACATGCACATGG + Intergenic
1170580859 20:17698523-17698545 CAGGTTATTCCACCTGAGCAGGG + Intronic
1173110714 20:40185932-40185954 TAGGATTTTCAACATAATCATGG + Intergenic
1173549483 20:43922754-43922776 CAGGATGAGCAACCTGATTGTGG + Intronic
1173948381 20:46969777-46969799 CTGGATGTTAAACCTGGGCAAGG + Intronic
1181289063 22:21776848-21776870 CAAGATTTTCAGCCTCATCAAGG + Intronic
1181311327 22:21946440-21946462 GAGGGGGTTCAACCTGATCACGG + Intronic
1183668413 22:39257950-39257972 CGGGATGTCCAACCTGGTCTTGG - Intergenic
1184085788 22:42263170-42263192 GAGGATGTGCAACCTCATCCTGG - Intronic
1184877125 22:47282970-47282992 CATGATGTCCACCCGGATCATGG - Intergenic
951459458 3:22933679-22933701 TGGGATGTTTAACCTGAGCAAGG - Intergenic
955623473 3:60891347-60891369 CAGGGTGATCAACCTGATCTGGG - Intronic
969863425 4:10055575-10055597 CAGGATATTCAACCTTGCCAGGG - Intergenic
970453105 4:16191405-16191427 CATGATGTACCACCTGATAAGGG - Exonic
973692382 4:53450758-53450780 CAGGAAATTCACCATGATCATGG - Intronic
974810043 4:66934311-66934333 CAGGATATTCAAGCAGTTCATGG + Intergenic
978153857 4:105467638-105467660 CAGGAGGTTACAACTGATCAAGG + Intronic
981579466 4:146237401-146237423 CAGGCTGTTTAACCTCATCAGGG + Intergenic
982103993 4:151995965-151995987 CAGGTTGTTTAACCAGTTCAGGG + Intergenic
983973040 4:173897648-173897670 AAAGATAATCAACCTGATCATGG + Intergenic
986435292 5:7723400-7723422 TGGGATGTTCAAGCTAATCATGG + Intronic
992320980 5:75612649-75612671 CAGAATGTTCCACCAGAACAGGG - Intronic
993634352 5:90326167-90326189 GAGGATGTTCAGCCAGATAATGG + Intergenic
998489029 5:142529786-142529808 CAGGTTGTTCAACAAGACCAAGG + Intergenic
999623912 5:153500159-153500181 CAGGATCTTCAAACTAGTCAGGG - Intronic
1002779866 6:357717-357739 CAGGGTGGTCAACCTGAGCACGG + Intergenic
1004021403 6:11779222-11779244 CAGGTTGATAAACCAGATCATGG + Intronic
1006612732 6:35304338-35304360 GAGGATATTCCACCTGGTCAGGG + Intronic
1010024848 6:71203300-71203322 CAGGATGAGCGACCTCATCAAGG - Intergenic
1010732716 6:79408059-79408081 AATTATGTTCAAACTGATCAGGG - Intergenic
1013391200 6:109688109-109688131 CTGAATGTTCTACCTGTTCATGG + Intronic
1014100522 6:117506580-117506602 GAGGATGTTCAAACAGACCAGGG - Intronic
1019290614 7:248351-248373 CAGGATGGTCAACATGACCAAGG + Exonic
1023271693 7:38470029-38470051 CAGGATGTTCAACCTGATCAAGG - Intronic
1028931386 7:96416266-96416288 CAGAATGCTCAACCTAATGAGGG - Intergenic
1034716887 7:153251706-153251728 CAGGATCTTCACTCTGATCTGGG + Intergenic
1036208361 8:6821943-6821965 GAGGCTGTTCAACCTGCTCGTGG - Exonic
1039091849 8:33838994-33839016 CTTTATTTTCAACCTGATCATGG - Intergenic
1044730662 8:95226322-95226344 GAGGATGCACAACCTGATCCAGG + Intergenic
1052125114 9:24765157-24765179 CAGGAAGTTCAAACTGGGCAGGG - Intergenic
1053275590 9:36780965-36780987 AAGAATGTTCAACCTGTTTATGG - Intergenic
1054924991 9:70580059-70580081 CAGCAGGTTTAACCTGTTCAGGG + Intronic
1055781953 9:79830082-79830104 CAGTATGTTGAACCTCATGATGG - Intergenic
1058539210 9:105994418-105994440 AAGGATGTTCAACTTGATACTGG + Intergenic
1203783212 EBV:112633-112655 CAGCATGTTCAACGCGGTCAAGG - Intergenic
1186169460 X:6861583-6861605 CAAGATTTTCAAGCTGATCTTGG - Intergenic
1188001366 X:24985601-24985623 TAGGATATTCAACCTGTACAAGG - Intronic
1188306047 X:28560919-28560941 CAGGATGTTAAATCTGATTCAGG + Intergenic
1197947009 X:131850359-131850381 GAGCTTCTTCAACCTGATCAAGG + Intergenic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic
1198882893 X:141300474-141300496 CAGGATGTTGAAGGAGATCAAGG - Intergenic
1199515958 X:148675704-148675726 CAGGATGTTCATCCTGAGTGGGG + Intronic