ID: 1023271695

View in Genome Browser
Species Human (GRCh38)
Location 7:38470045-38470067
Sequence CATCCTGCTTTATCAAGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023271692_1023271695 -6 Left 1023271692 7:38470028-38470050 CCCTTGATCAGGTTGAACATCCT 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1023271695 7:38470045-38470067 CATCCTGCTTTATCAAGCTTGGG No data
1023271693_1023271695 -7 Left 1023271693 7:38470029-38470051 CCTTGATCAGGTTGAACATCCTG 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1023271695 7:38470045-38470067 CATCCTGCTTTATCAAGCTTGGG No data
1023271689_1023271695 5 Left 1023271689 7:38470017-38470039 CCAGGCCACTACCCTTGATCAGG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1023271695 7:38470045-38470067 CATCCTGCTTTATCAAGCTTGGG No data
1023271691_1023271695 0 Left 1023271691 7:38470022-38470044 CCACTACCCTTGATCAGGTTGAA 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1023271695 7:38470045-38470067 CATCCTGCTTTATCAAGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023271695 Original CRISPR CATCCTGCTTTATCAAGCTT GGG Intronic
No off target data available for this crispr