ID: 1023271697

View in Genome Browser
Species Human (GRCh38)
Location 7:38470053-38470075
Sequence TTTATCAAGCTTGGGCCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023271691_1023271697 8 Left 1023271691 7:38470022-38470044 CCACTACCCTTGATCAGGTTGAA 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1023271697 7:38470053-38470075 TTTATCAAGCTTGGGCCCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 115
1023271689_1023271697 13 Left 1023271689 7:38470017-38470039 CCAGGCCACTACCCTTGATCAGG 0: 1
1: 0
2: 1
3: 9
4: 96
Right 1023271697 7:38470053-38470075 TTTATCAAGCTTGGGCCCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 115
1023271693_1023271697 1 Left 1023271693 7:38470029-38470051 CCTTGATCAGGTTGAACATCCTG 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1023271697 7:38470053-38470075 TTTATCAAGCTTGGGCCCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 115
1023271692_1023271697 2 Left 1023271692 7:38470028-38470050 CCCTTGATCAGGTTGAACATCCT 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1023271697 7:38470053-38470075 TTTATCAAGCTTGGGCCCTGTGG 0: 1
1: 0
2: 0
3: 8
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023271697 Original CRISPR TTTATCAAGCTTGGGCCCTG TGG Intronic
900192625 1:1357922-1357944 TTTATCACCCACGGGCCCTGGGG - Intronic
900493734 1:2966675-2966697 ATTATCCATCTTGAGCCCTGTGG + Intergenic
901789719 1:11647842-11647864 TTCATCAAGCTGGGCCCCTAGGG - Intergenic
902749201 1:18495192-18495214 ATTATCTAGTTTGGGCCATGAGG + Intergenic
903065431 1:20696849-20696871 TTTAGCAAGGAGGGGCCCTGGGG - Intronic
903291670 1:22318060-22318082 GGGAACAAGCTTGGGCCCTGAGG + Intergenic
905393650 1:37653471-37653493 TTTGTCCAGCCTGAGCCCTGTGG - Intergenic
906742952 1:48200089-48200111 TTTATCAGGCTTTAGCCCTGAGG - Intergenic
907260813 1:53217127-53217149 TTTAGGAATCTTGGGCCCAGAGG - Intronic
908421976 1:63967741-63967763 TTGAGGAAGCTGGGGCCCTGAGG - Intronic
908712279 1:67029897-67029919 TTAATAAAGCTTGGGGCGTGGGG - Intronic
908740543 1:67322915-67322937 ATAAGCAAGCATGGGCCCTGAGG + Intronic
915321878 1:155060875-155060897 GGCATCCAGCTTGGGCCCTGGGG + Intronic
917496471 1:175544848-175544870 GATATCAGGCTTGGGCCATGTGG + Intronic
917499939 1:175577007-175577029 TTTTTCAAGCATGCCCCCTGGGG + Intronic
920749197 1:208658237-208658259 TTTATAATGTATGGGCCCTGGGG - Intergenic
921337843 1:214106652-214106674 TTTATCAAGCGTTTGCCATGTGG + Intergenic
923600411 1:235397924-235397946 TTTAGCAAGCTTTTCCCCTGGGG - Intronic
1065793352 10:29282175-29282197 TTTTTTAAGGTTGGGCACTGTGG - Intergenic
1068432101 10:56947359-56947381 TTTTTAAAGCTTGAGCCCAGTGG - Intergenic
1074053374 10:109899997-109900019 ATTAATGAGCTTGGGCCCTGGGG - Intronic
1078376473 11:10798144-10798166 TTTCTCAAGCCTGGGCCCCCTGG + Intronic
1080664564 11:34324435-34324457 TTGATCAGGCTTGGTCCATGAGG + Intronic
1081099409 11:38983371-38983393 TTATTCAAGGTTGGGCCCAGTGG - Intergenic
1083725380 11:64625306-64625328 GTTAGCAAACTTGGTCCCTGTGG + Intronic
1083966358 11:66046340-66046362 TTTCTCAGTCTTGGGCCCTCAGG - Intronic
1084541297 11:69788689-69788711 TTTATCCAGCGTGGTCCCTAAGG - Intergenic
1085270958 11:75269505-75269527 GTAATCAGCCTTGGGCCCTGGGG - Intronic
1088045383 11:105444021-105444043 TAGAACAGGCTTGGGCCCTGGGG - Intergenic
1088725860 11:112634038-112634060 ATTGTCAAGCTTGCTCCCTGTGG + Intergenic
1089161062 11:116437732-116437754 CTTATCAGGGTTGGCCCCTGAGG - Intergenic
1089413022 11:118262990-118263012 TTTCTCCAGCTTTGCCCCTGTGG - Exonic
1090314607 11:125774226-125774248 TTGATCCAGTTTGGGCCATGGGG + Intergenic
1092588215 12:9922210-9922232 TTTAGCATGCTTGGACCATGTGG + Exonic
1104131977 12:125902749-125902771 ATTTTCCAGGTTGGGCCCTGGGG - Intergenic
1108405925 13:50101597-50101619 GTTATCAAACTATGGCCCTGAGG + Intronic
1110751744 13:79122860-79122882 TTGATCAACCTTGGGCCATCAGG + Intergenic
1116611092 14:47073015-47073037 TTTCTCAAGCTTTGGCCATGTGG - Intronic
1121913930 14:97818953-97818975 TCTCTCAACCTTGGGCCTTGTGG + Intergenic
1122145365 14:99685350-99685372 TTTCTCAAGCCTGGGCCTGGCGG + Intronic
1122966057 14:105126596-105126618 TTTCCCATGCTTGGGCCCTGAGG + Intergenic
1127612636 15:60651851-60651873 AATATCAGGCTTGAGCCCTGAGG + Intronic
1127691885 15:61404610-61404632 TTTACCAAGTTTGGGCTATGAGG - Intergenic
1129461692 15:75703007-75703029 TTTCTCAGGATTGGTCCCTGGGG + Intronic
1129723160 15:77888839-77888861 TTTCTCAGGATTGGTCCCTGGGG - Intergenic
1131102298 15:89702361-89702383 TTTATTCAGCTTGTGCACTGTGG - Intronic
1133633154 16:7641037-7641059 CTTATAAAGCTGGGGCCCTTGGG - Intronic
1133672497 16:8037007-8037029 TTTATCAATCTTTGTCTCTGTGG + Intergenic
1136455304 16:30376777-30376799 TCTACCAAGGCTGGGCCCTGTGG + Intronic
1137974861 16:53022712-53022734 TTTATCCAGCCTGGGCGCGGTGG + Intergenic
1143609395 17:8008993-8009015 TGAACCAAGCTTGGGCCCTTCGG + Intronic
1146937036 17:36818477-36818499 TTTACAAAGCCTGTGCCCTGGGG - Intergenic
1148848519 17:50542587-50542609 TTTATCACACATGGGCACTGGGG + Exonic
1152580598 17:81164048-81164070 TGTAGGAAGCTTGGGCCCTGGGG + Intronic
1153817721 18:8805648-8805670 TTTATCAAGTTTGGGGGATGAGG + Intronic
1157949541 18:52019143-52019165 TTTAACAAGCTTGGTCCCTAGGG + Intergenic
925307960 2:2863372-2863394 TTTACCAAGGGTGGGTCCTGAGG - Intergenic
925802145 2:7611940-7611962 TTGCTCAAGCCTGGGCCCTCGGG + Intergenic
927565003 2:24104349-24104371 TCTATAAGCCTTGGGCCCTGGGG + Intronic
927893725 2:26768227-26768249 TTCATGAGGCTTGGGACCTGAGG + Intronic
928633764 2:33221181-33221203 CTTATCACACTTAGGCCCTGTGG + Intronic
934877982 2:97943794-97943816 CTTATCAAGGTTGGGCACAGTGG + Intronic
943552976 2:189364397-189364419 TATAGCAAGGTTGGGCCCGGTGG + Intergenic
944357087 2:198803464-198803486 TTTATCAAGCTTTGAGGCTGAGG - Intergenic
946107763 2:217386981-217387003 TTGATCCAGCTTGGGTCCTGTGG - Intronic
947478450 2:230473572-230473594 ATTCTGAAGCTTGGGGCCTGTGG - Intronic
947796052 2:232894688-232894710 TGTCTCAAGCATGTGCCCTGGGG + Intronic
1170465893 20:16622293-16622315 CTTATCAACCTTGTTCCCTGAGG + Intergenic
1172347281 20:34211879-34211901 TTTATCCTGCTTGGGCTTTGTGG + Intronic
1175351766 20:58327004-58327026 TTTATCAAGAATGGGTCTTGTGG + Intronic
1175543446 20:59762670-59762692 TATTTCCAGCTTGGGCCATGTGG - Intronic
1182736222 22:32533556-32533578 TTGTTCAACCTCGGGCCCTGAGG + Intronic
1183831035 22:40418486-40418508 TTGATGAGGCTGGGGCCCTGAGG + Exonic
949728910 3:7084255-7084277 TTTCTCAAGCATGGTTCCTGGGG + Intronic
953722229 3:45366475-45366497 TTCAGCAAGCATGAGCCCTGGGG + Intergenic
954086568 3:48248979-48249001 TCAATCAAGCTTGGCCCCTATGG - Intronic
955468257 3:59258718-59258740 TTTATCCCGCTTGTGACCTGAGG + Intergenic
956771698 3:72532202-72532224 TTTCTCAAGCATGGGGCCAGTGG - Intergenic
957246124 3:77719105-77719127 ATTATTAATCTTGTGCCCTGAGG - Intergenic
961116365 3:124333598-124333620 TTTACCAAGCCTGGGCACTGTGG + Intronic
961447526 3:126987846-126987868 TTTATCCAGCATGGGGCTTGGGG + Intergenic
966298377 3:178450581-178450603 TTAATCATGATGGGGCCCTGTGG - Intronic
966511082 3:180764186-180764208 TGTTTCAAGTTTGGCCCCTGAGG - Intronic
973959165 4:56092305-56092327 TCTATCCATCTTGGGCCCCGAGG + Intergenic
974911282 4:68123931-68123953 TTTATCAAGGTCGGGCACGGTGG + Intronic
976700377 4:87964048-87964070 TTCATCAAGCTTGGTCTCTTAGG - Intergenic
978346876 4:107779861-107779883 TTTAGCAAGATTTGGACCTGTGG - Intergenic
982224696 4:153154769-153154791 TTTATCAGGTTATGGCCCTGGGG + Intronic
983991711 4:174127840-174127862 GTTATGAGGCTAGGGCCCTGTGG - Intergenic
986220893 5:5767585-5767607 TTTCTCCCGCTTGGACCCTGTGG + Intergenic
994070450 5:95595693-95595715 TTTATCAACCTCTGGCCCTCTGG - Intronic
994423427 5:99552631-99552653 TTTATCACTCTTAGGACCTGTGG - Intergenic
997397210 5:133572048-133572070 TTTATCTTGCTTGGGGCTTGTGG - Intronic
997515674 5:134487655-134487677 TGTTTCCAGTTTGGGCCCTGTGG - Intergenic
997851375 5:137335856-137335878 ATTATAAAGCATGAGCCCTGCGG + Intronic
999384079 5:151141903-151141925 TTTCTCAAGCTCCGGCCGTGAGG - Intronic
1001812804 5:174642753-174642775 ATTATCAAACTAGGGCTCTGAGG + Intergenic
1002084655 5:176766295-176766317 TTTATCGAGCCTGTGCCCTTGGG + Intergenic
1011957670 6:93043469-93043491 TTTACCAAGGTTGGGCCCAAAGG - Intergenic
1016013486 6:139162078-139162100 TTTACAAAGCCTGGGCCCAGTGG + Intronic
1018020381 6:159757696-159757718 TTAATCAAGGTTGGGCGCGGTGG - Intronic
1018962131 6:168456587-168456609 CTTCTCAAGCTTCGGCACTGGGG - Intronic
1020796267 7:12681803-12681825 TGTCTCAAGATTAGGCCCTGGGG - Intergenic
1023271697 7:38470053-38470075 TTTATCAAGCTTGGGCCCTGTGG + Intronic
1026522616 7:71130743-71130765 TTTACAAAGCATGCGCCCTGAGG + Intergenic
1034317807 7:150149964-150149986 TTTATCAAGCTTCAGTTCTGTGG - Intergenic
1034774945 7:153817288-153817310 TTTATCAAGCTTCAGTTCTGTGG + Intergenic
1038032459 8:23654586-23654608 TGGAACAGGCTTGGGCCCTGGGG + Intergenic
1038085480 8:24192159-24192181 TTTACAAAGGTAGGGCCCTGAGG + Intergenic
1042468963 8:69161656-69161678 TCTACCAAGTTTGGGCCCTCAGG + Intergenic
1044317107 8:90762997-90763019 TTTACCAAGCTTGGACCCTCAGG - Intronic
1048738887 8:137532219-137532241 TTTGAGAAGCTTTGGCCCTGTGG - Intergenic
1048821794 8:138387025-138387047 TTTATAGGGCTTGGGTCCTGTGG - Intronic
1050048849 9:1576701-1576723 TTTATCAGCATTGTGCCCTGAGG - Intergenic
1051502588 9:17794070-17794092 TTTATCATGCTGTGGCACTGGGG + Intronic
1055359245 9:75471702-75471724 TTTATGATGCTTGGGGGCTGGGG - Intergenic
1058507872 9:105685084-105685106 TTTATCAAGCATTTGCCTTGTGG + Intergenic
1059919462 9:119141815-119141837 ATAATAGAGCTTGGGCCCTGTGG + Intergenic
1061252393 9:129434085-129434107 TTCATCCATCTTGGGGCCTGAGG - Intergenic
1188883524 X:35519970-35519992 TTTATTCTGCTTGGGCCTTGGGG - Intergenic
1189543236 X:42014472-42014494 TTGTAAAAGCTTGGGCCCTGGGG - Intergenic
1191713511 X:64177710-64177732 CTCATGAGGCTTGGGCCCTGAGG - Intergenic
1199535716 X:148900597-148900619 TTTATTAACATTGGACCCTGAGG - Intronic
1200155308 X:153971924-153971946 TTTAAGAGGCTTGGGCCCAGGGG - Intergenic