ID: 1023271700

View in Genome Browser
Species Human (GRCh38)
Location 7:38470075-38470097
Sequence GTATACCCCTCAACACTCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023271691_1023271700 30 Left 1023271691 7:38470022-38470044 CCACTACCCTTGATCAGGTTGAA 0: 1
1: 0
2: 0
3: 9
4: 95
Right 1023271700 7:38470075-38470097 GTATACCCCTCAACACTCTCTGG No data
1023271696_1023271700 4 Left 1023271696 7:38470048-38470070 CCTGCTTTATCAAGCTTGGGCCC 0: 1
1: 0
2: 0
3: 6
4: 56
Right 1023271700 7:38470075-38470097 GTATACCCCTCAACACTCTCTGG No data
1023271693_1023271700 23 Left 1023271693 7:38470029-38470051 CCTTGATCAGGTTGAACATCCTG 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1023271700 7:38470075-38470097 GTATACCCCTCAACACTCTCTGG No data
1023271692_1023271700 24 Left 1023271692 7:38470028-38470050 CCCTTGATCAGGTTGAACATCCT 0: 1
1: 0
2: 0
3: 14
4: 176
Right 1023271700 7:38470075-38470097 GTATACCCCTCAACACTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023271700 Original CRISPR GTATACCCCTCAACACTCTC TGG Intronic
No off target data available for this crispr