ID: 1023272532

View in Genome Browser
Species Human (GRCh38)
Location 7:38480264-38480286
Sequence ACTCCTGGCGCTGGTCACTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 191}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023272532_1023272542 0 Left 1023272532 7:38480264-38480286 CCCCAGTGACCAGCGCCAGGAGT 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1023272542 7:38480287-38480309 AGGGTGAGGCAGGTGAGACAGGG No data
1023272532_1023272539 -10 Left 1023272532 7:38480264-38480286 CCCCAGTGACCAGCGCCAGGAGT 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1023272539 7:38480277-38480299 CGCCAGGAGTAGGGTGAGGCAGG No data
1023272532_1023272543 17 Left 1023272532 7:38480264-38480286 CCCCAGTGACCAGCGCCAGGAGT 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1023272543 7:38480304-38480326 ACAGGGCACAAAATTTAAGAAGG No data
1023272532_1023272541 -1 Left 1023272532 7:38480264-38480286 CCCCAGTGACCAGCGCCAGGAGT 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1023272541 7:38480286-38480308 TAGGGTGAGGCAGGTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023272532 Original CRISPR ACTCCTGGCGCTGGTCACTG GGG (reversed) Intronic
901315223 1:8302579-8302601 ACTCCCGGCGTTACTCACTGTGG - Intergenic
901633625 1:10659662-10659684 GCTCCTGGCTCTGGGCATTGTGG + Intronic
902329949 1:15726428-15726450 CCTCCTGGCTCCAGTCACTGGGG - Intronic
902800495 1:18826634-18826656 AGTCGTGGTGGTGGTCACTGGGG - Intergenic
903276297 1:22224016-22224038 ATCCCTGGAGCTGGTCTCTGAGG - Intergenic
904419161 1:30380286-30380308 ACTGCAGGAGCTGGGCACTGAGG + Intergenic
908795187 1:67824220-67824242 AATCCTGGGGCTGGGCACGGTGG + Intronic
909782294 1:79561779-79561801 ACTGCTGGCCCTGGGCAGTGAGG - Intergenic
911152797 1:94611205-94611227 ACTCCTAGAGCCAGTCACTGGGG - Intergenic
911324192 1:96450123-96450145 TGTCCTGGGGCTGGGCACTGTGG - Intergenic
912693027 1:111818830-111818852 GATCCTGGGGCTGGTCCCTGAGG + Intronic
914756133 1:150562478-150562500 ATTCCTTCCTCTGGTCACTGAGG + Intergenic
916074776 1:161193940-161193962 AGTCCTGGAGCTGGTCCATGTGG + Exonic
916253184 1:162758621-162758643 GATCCAGGCTCTGGTCACTGTGG + Intronic
918619020 1:186581277-186581299 ATTCCTGCCACTGGCCACTGGGG + Intergenic
919410299 1:197234051-197234073 CCTCCTTGTGCTGGTCACTCAGG - Intergenic
921002639 1:211059453-211059475 ATTCCTGGGGCTGGGCACGGTGG + Intronic
922154815 1:223032492-223032514 ACCCCTGGATCTGGGCACTGTGG - Intergenic
922240039 1:223749328-223749350 GCCCCTGGCGCCGGCCACTGCGG - Intronic
922743715 1:228031175-228031197 AGTCCGGGCACTGGTCACTGTGG + Intronic
922884965 1:229012325-229012347 CCTCCTGGGGCTGCTGACTGGGG + Intergenic
923543404 1:234906395-234906417 CGTCCTGGTGCTGGACACTGGGG - Intergenic
1063975903 10:11415397-11415419 CCACCTGGCGCTGGTTCCTGTGG - Intergenic
1065554894 10:26905652-26905674 ACCCCTGGCCCTGGGCAGTGAGG + Intergenic
1070915916 10:80154690-80154712 GCTCCTGGCTCTGGTCTCTGGGG - Exonic
1073644967 10:105292493-105292515 GCTCCTGTCACTGGTGACTGTGG + Intergenic
1074859468 10:117499421-117499443 GCTCAGGGCTCTGGTCACTGTGG + Intergenic
1076190995 10:128483391-128483413 ACCCCAGGCCCTGCTCACTGCGG - Intergenic
1076830401 10:132991581-132991603 CCTCGTGGCACTGGTCAGTGTGG - Intergenic
1077016222 11:400171-400193 ATTGCAGGCGCGGGTCACTGTGG + Intronic
1077145435 11:1042279-1042301 ACCCCTGGCCCTGGGCAGTGTGG - Intergenic
1077986968 11:7362420-7362442 ACTACTGGGGCTGGTCACGGTGG - Intronic
1082788741 11:57332633-57332655 ACATCTGGCGCTGGTCCTTGTGG + Exonic
1083949136 11:65944407-65944429 ACGCCTGGTGCTGACCACTGAGG - Intergenic
1084080250 11:66818467-66818489 ATTCCTGGGGCTGTTCCCTGTGG + Intronic
1084089293 11:66869758-66869780 AGTCCTGGGGCAGGTCACTGTGG + Intronic
1084209126 11:67612881-67612903 GCTTCAGGCGGTGGTCACTGTGG + Intergenic
1089489066 11:118870462-118870484 ACTCCTTGGGCTGGGCAGTGGGG - Intergenic
1091599616 12:1909874-1909896 ACTCCTGGCACTGGTGCCAGAGG - Intronic
1092143976 12:6202069-6202091 CCCCCTGGAGCTGGTCACTGAGG + Intronic
1092728195 12:11504819-11504841 GCTCCACACGCTGGTCACTGTGG + Intergenic
1096571991 12:52528825-52528847 ACTCCTGGGGCAGGTGGCTGAGG - Intergenic
1101360539 12:104022191-104022213 ATTCCAGGGGATGGTCACTGTGG + Intronic
1102572300 12:113834324-113834346 ACTCCAGGTGCAGGGCACTGGGG + Intronic
1103589234 12:121979471-121979493 TCTCCTGGGGGTGCTCACTGCGG + Intronic
1104448680 12:128853036-128853058 GCCCCTGGTCCTGGTCACTGTGG + Intergenic
1104872921 12:132013610-132013632 AATCCTGGCTCTCTTCACTGGGG - Exonic
1106617073 13:31339920-31339942 CCTCCTGGCCCTGGGCAATGGGG - Intergenic
1109789444 13:67228255-67228277 AAGGCTGGCGCTGGTCCCTGTGG + Exonic
1113745665 13:112742390-112742412 CCTGCGGGCGCTGGTCTCTGTGG + Intronic
1116785348 14:49281621-49281643 GCCCCTGGGGCTGGGCACTGTGG - Intergenic
1116982165 14:51183219-51183241 CTTCCTGGTCCTGGTCACTGAGG - Intergenic
1117288772 14:54312472-54312494 ATGCCTGGGGCTGGTCACCGGGG - Intergenic
1118858974 14:69646986-69647008 ATGCCTGGGGCTGGGCACTGTGG - Intronic
1119485592 14:74984765-74984787 ACTCCTTCCGCTGTCCACTGAGG - Intergenic
1120923826 14:89778836-89778858 ACTCCTGACCATGGTCTCTGAGG + Intergenic
1123994380 15:25708129-25708151 GCACCGGGCGCTGCTCACTGTGG + Intronic
1124139948 15:27068293-27068315 ACTGCAGGAGCTGGGCACTGGGG + Intronic
1125153394 15:36559830-36559852 ACAGCTGGAGCTGGACACTGTGG + Intergenic
1128822322 15:70670109-70670131 ACACCTGGAGCTGGTGACAGCGG + Intronic
1132659547 16:1055273-1055295 ACGGCCGGCGCTGGCCACTGGGG - Intergenic
1133001466 16:2853583-2853605 ACAGCTGGCTCTGGGCACTGAGG + Intronic
1133316856 16:4890228-4890250 TCTCCTGGGGCTCGTAACTGGGG + Exonic
1133442692 16:5834023-5834045 AGGCCTGGGGCTGGACACTGAGG - Intergenic
1134291040 16:12902894-12902916 CCTCCTCCCGCTGGTGACTGAGG + Intronic
1135629421 16:24024051-24024073 GCTCCTGGTTCTGGTCCCTGGGG - Intronic
1136778078 16:32882138-32882160 ACTCCTGGGGGTGGACCCTGTGG - Intergenic
1136892543 16:33979376-33979398 ACTCCTGGGGGTGGACCCTGTGG + Intergenic
1137396967 16:48123028-48123050 GCCCCTGGCTGTGGTCACTGGGG - Intronic
1137788051 16:51152872-51152894 GCTCCTGGCTCTGGGCTCTGGGG - Intergenic
1138443938 16:57051553-57051575 TCTCCAGGCTCTGGTCACTCAGG - Exonic
1138491101 16:57377191-57377213 CCTCCTGTCTCTGGTCACTCAGG + Intronic
1139793822 16:69465145-69465167 CCACCTGGAGCTGGTCTCTGGGG + Exonic
1141370524 16:83482157-83482179 ACTGGTGGCTCTGGTCAGTGTGG + Intronic
1142346005 16:89554320-89554342 TTTCCTGGCACTGGTCACAGGGG + Intronic
1203080497 16_KI270728v1_random:1144247-1144269 ACTCCTGGGGGTGGACCCTGTGG - Intergenic
1142997296 17:3768499-3768521 AATGCTGGCGCTGGTCACCCAGG - Intronic
1143521096 17:7444864-7444886 ACTCCTGGCACTGCTCCCAGGGG + Exonic
1144507838 17:15848385-15848407 GCTTCTGGTGCTGGTAACTGTGG - Intergenic
1145171960 17:20666018-20666040 GCTTCTGGTGCTGGTAACTGTGG - Intergenic
1146266782 17:31458137-31458159 AATCCTGGCCCTGCACACTGTGG - Intronic
1147194399 17:38755877-38755899 ACTTGAGGCGCTGGGCACTGAGG - Exonic
1147552866 17:41456940-41456962 ACTCCTGGCCCTGGGCTGTGGGG + Intergenic
1147570772 17:41569482-41569504 ACTCCTGACGCATGTCATTGAGG + Exonic
1147571468 17:41573762-41573784 AGACGTGGCGCTGGGCACTGGGG - Intergenic
1147774140 17:42888699-42888721 ACTCTCAGCGCTGGTGACTGGGG + Intergenic
1149072967 17:52565025-52565047 ACTCCTGTTGCTGGTCTCAGAGG - Intergenic
1150227134 17:63530317-63530339 ACTCCTGGCCCTGGTTTCAGAGG + Exonic
1150716689 17:67578327-67578349 ACTGCTGGCCCTGGTCACAGAGG - Intronic
1152765812 17:82137957-82137979 TCTCCTGGGGCTGGGCACAGTGG - Intronic
1152864868 17:82716613-82716635 AATCCTAGCGCTTGTCTCTGCGG + Intergenic
1154529794 18:15331567-15331589 ACTCCAGACGCTGGTCAACGAGG - Intergenic
1155254711 18:23984596-23984618 ACTGCTGGCCCTGGGCACAGAGG + Intergenic
1157073515 18:44438164-44438186 TCTCCTGGCTCTGGTTACTATGG + Intergenic
1157283305 18:46360265-46360287 ACTCCTGCTGCTGGGCACAGAGG + Intronic
1158997984 18:62943133-62943155 ACACCTGGCACGGGTCACTGGGG - Intronic
1160958061 19:1703840-1703862 ACTCCTGGGGCTGGGCACGGTGG - Intergenic
1161393143 19:4031642-4031664 ACTGCGGGCTCTGGTCACTGAGG - Intronic
1164811136 19:31156936-31156958 ACTCCTGGGCCTGGTCACATTGG - Intergenic
1165717748 19:38057517-38057539 ACTCCTGGTGTTGCTCATTGAGG + Intronic
1165790756 19:38490331-38490353 TCTCCTGACTCTGATCACTGAGG + Intronic
1165894783 19:39135100-39135122 CCTCCTAGCGGTGGTGACTGAGG + Intronic
1168268239 19:55234973-55234995 GCTCCTGGGTCTGGGCACTGAGG + Intronic
925178853 2:1803720-1803742 AGTCCTGGGGCTGCCCACTGCGG + Intronic
926837249 2:17036752-17036774 GTTCCTGGTGCTGGTCAGTGAGG + Intergenic
927101063 2:19788216-19788238 ACTCCTGGTGCTGGGCATGGTGG + Intergenic
927846752 2:26476221-26476243 ACTCCTTGCGCTGTTTGCTGAGG + Exonic
930482734 2:51969939-51969961 ACTCTGGGGGCTGGGCACTGGGG - Intergenic
933936618 2:87209152-87209174 ACTCCTTGAGCTGGGCATTGTGG - Intergenic
934612608 2:95752337-95752359 AGTCATGGCGCTGTTCCCTGAGG + Intergenic
934648308 2:96072086-96072108 AGTCATGGCGCTGTTCCCTGAGG - Intergenic
934678922 2:96268576-96268598 ACGCCAGGCGCTGGCCACTCGGG - Exonic
934841539 2:97627109-97627131 AGTCATGGCGCTGTTCCCTGAGG - Intergenic
936519739 2:113204232-113204254 AGTCCTGGCCCAGGCCACTGTGG - Intronic
938110313 2:128559955-128559977 AAGCCTAGCGCTGGTCACTGAGG + Intergenic
941469265 2:165864132-165864154 ACTCCTGGCTCTCGTCGCTATGG + Intronic
947866590 2:233402088-233402110 CCTGCTGGCCCTGGTCTCTGGGG + Intronic
1170084798 20:12516675-12516697 ACTCCTGTGGTTGGTCACTCTGG - Intergenic
1171317576 20:24209081-24209103 AATCCTGGAGCTGGTCAGAGCGG + Intergenic
1173664279 20:44753853-44753875 ACACCTGGGGGTGGTCAGTGAGG - Intronic
1174362618 20:50038497-50038519 AATCCTGGAGATAGTCACTGTGG - Intergenic
1175737046 20:61394344-61394366 TCACCTGCCGCTGGTCGCTGGGG - Intronic
1175868612 20:62195873-62195895 ACTCCTTGCGGGGCTCACTGTGG - Exonic
1179160596 21:38893951-38893973 AATCCTGGCTCTGGTAAGTGGGG - Intergenic
1179875687 21:44266192-44266214 ACCACAGGTGCTGGTCACTGGGG + Intergenic
1180880402 22:19199348-19199370 ACTACTGGGGCTGCACACTGTGG + Intronic
1181695096 22:24588983-24589005 GCTCCTGGGGCTGCTCACAGAGG - Intronic
1182706566 22:32284878-32284900 CCTCCTGGGGGTTGTCACTGAGG - Intergenic
1182791233 22:32954740-32954762 GCTGCTGGAGCTGGGCACTGTGG + Intronic
1182796362 22:32994280-32994302 AGTCCTGGCCCTGGTGTCTGGGG - Intronic
1183047255 22:35229864-35229886 TCTCCCGGCGCAGGTCTCTGGGG + Intergenic
1183363398 22:37394561-37394583 ACTCACGGTGCTGGCCACTGCGG - Intronic
1184394887 22:44227950-44227972 CCTCCTGGGGGTTGTCACTGAGG - Intergenic
1184759875 22:46537959-46537981 ACTCCTGGCGGCGGTCTCCGTGG - Intergenic
1185084752 22:48734596-48734618 ACTCCTGAGGCAGGTCACAGTGG - Intronic
952257261 3:31706232-31706254 GCTCCGGGCACAGGTCACTGTGG - Intronic
955284504 3:57626229-57626251 ACTCCTTGCGTTTGTAACTGTGG - Exonic
961449218 3:126994952-126994974 TCTCCTGGAGCTGGGCCCTGGGG + Intronic
962108533 3:132417770-132417792 ACTCCGGGCACTGGGCTCTGGGG + Intronic
963718117 3:148827832-148827854 ACTCTTGGTTCTGGTGACTGTGG + Exonic
968515042 4:1012215-1012237 ATTCCTGGCGCTTGTAACTCCGG - Intronic
969182743 4:5454674-5454696 TATCCTGGAGCTGGGCACTGAGG - Intronic
969296132 4:6271412-6271434 GCTTCTGGGGCTGGTCACAGAGG + Intronic
975114197 4:70660669-70660691 ACTACTGGGGCTGGGCACGGTGG - Intronic
976344083 4:83979618-83979640 ACGCCTGGCCCAGGACACTGGGG - Intergenic
981920368 4:150079023-150079045 ACTCCTGGTGCTGGCCATCGCGG - Exonic
985697106 5:1346785-1346807 ACCCCTTCCGTTGGTCACTGTGG - Intergenic
990372448 5:55134473-55134495 ACTCCTGGGGCTGGGCACGGTGG + Intronic
992048854 5:72925599-72925621 ACTGCTGGCCCTGGGCAGTGAGG + Intergenic
992366238 5:76093005-76093027 ACTCCTGGCACTGGACACATAGG + Intronic
994670528 5:102756302-102756324 GTTCCTGGAGCTGGTCATTGGGG + Intronic
1000040030 5:157478633-157478655 ACTCCTGGCTCTGTTCAGGGAGG - Exonic
1001555328 5:172633014-172633036 TCTCTTGGCCCTGATCACTGTGG - Intergenic
1004540389 6:16544266-16544288 ACAGCTGGCTCTGGTTACTGTGG - Intronic
1005122365 6:22403665-22403687 ACTCCTAGGGCTGGGCACGGTGG + Intergenic
1007090659 6:39182782-39182804 ACACCTGATGCTGGTGACTGAGG - Intergenic
1007316933 6:40996620-40996642 ACTCCTGGCATTGGTCACCTGGG - Intergenic
1017760306 6:157563111-157563133 ACTCCTGGAGGTGGTAACTAAGG + Intronic
1018845615 6:167553354-167553376 ACTCTTGGGGCTGGACACAGGGG - Intergenic
1019452480 7:1106930-1106952 GCTCCTGGCCGTGGTCACGGTGG - Intronic
1019594351 7:1851495-1851517 TCCTCTGGCCCTGGTCACTGGGG - Intronic
1021516196 7:21489936-21489958 AATTCTGGGGCTGGGCACTGTGG - Intronic
1021717816 7:23474758-23474780 CCTCCGGGCGCTGGACGCTGGGG - Intergenic
1022110239 7:27225666-27225688 ACTCTTGGCGGTGGCCTCTGCGG - Intergenic
1022411227 7:30139961-30139983 GCTCCTGGCCCTGGTCAGAGGGG + Intronic
1023272532 7:38480264-38480286 ACTCCTGGCGCTGGTCACTGGGG - Intronic
1027178380 7:75919703-75919725 ACTCCTGACGCTGGTCGGTGTGG + Intronic
1031902856 7:127429278-127429300 ACTGCTGGCCCTGGGCAGTGAGG + Intronic
1032268675 7:130385140-130385162 ACTGCTGGCTCCGGACACTGTGG - Exonic
1033527028 7:142226170-142226192 ACTGCTGGAGGTGGTCTCTGCGG + Intergenic
1034031597 7:147772693-147772715 ACTGCTGCCTCTGTTCACTGGGG - Intronic
1034674326 7:152881761-152881783 ACTACTGTTGCTGGGCACTGTGG - Intergenic
1035156692 7:156920207-156920229 ACACCTGGCCCGGGTCACTTGGG - Intergenic
1036594467 8:10199879-10199901 ACTCCTGGCACTTATCAATGTGG + Intronic
1038400409 8:27280187-27280209 ATGACTGGTGCTGGTCACTGCGG - Intergenic
1039421878 8:37450293-37450315 AGTCCTGGGGCTGCTGACTGTGG + Intergenic
1046149993 8:110211395-110211417 ACTCCTGGCTGTGGTGACTATGG + Intergenic
1048600041 8:135910129-135910151 ACTCCTGGCCCTGGTCCATCTGG + Intergenic
1049081293 8:140445361-140445383 TCTCCTGGCACAGGTCACTTAGG + Intronic
1049098311 8:140561753-140561775 AGTCCTGGGGTTTGTCACTGTGG + Intronic
1052838382 9:33269215-33269237 ACACCTGGGGCTGGGCACAGTGG + Intronic
1053157945 9:35792993-35793015 ACACCTGGTGCTGCACACTGAGG - Exonic
1057483197 9:95461831-95461853 ACTCCAGCTGCTGGGCACTGAGG - Intronic
1060448435 9:123714216-123714238 ACTGCTGGGGCTGGTATCTGTGG - Intronic
1062108125 9:134766827-134766849 AGTCCTGGGGCTGCTCTCTGTGG + Intronic
1062114744 9:134802325-134802347 CCTCCTGCCACTGGTCCCTGTGG + Intronic
1189186539 X:39060069-39060091 AGTCCTGCAGCTGGCCACTGAGG - Intergenic
1190344597 X:49325978-49326000 ACTACAGGCGCCGGCCACTGCGG + Intronic
1190345690 X:49335535-49335557 ACTACAGGCGCCGGCCACTGCGG + Intronic
1190346794 X:49345085-49345107 ACTACAGGCGCCGGCCACTGCGG + Intronic
1190348044 X:49536112-49536134 ACTACAGGCGCCGGCCACTGCGG + Intronic
1190349145 X:49545668-49545690 ACTACAGGCGCCGGCCACTGCGG + Intronic
1190350249 X:49555224-49555246 ACTACAGGCGCCGGCCACTGCGG + Intronic
1190351351 X:49564783-49564805 ACTACAGGCGCCGGCCACTGCGG + Intronic
1190352451 X:49574336-49574358 ACTACAGGCGCCGGCCACTGCGG + Intronic
1190353552 X:49583884-49583906 ACTACAGGCGCCGGCCACTGCGG + Intronic
1190354654 X:49593406-49593428 ACTACAGGCGCCGGCCACTGCGG + Intronic
1190355759 X:49602956-49602978 ACTACAGGCGCCGGCCACTGCGG + Intronic
1190728206 X:53205935-53205957 ACTCCTGGCTCTGCTACCTGAGG - Intronic
1191682141 X:63851977-63851999 ACTCCTGTTATTGGTCACTGAGG + Intergenic
1193009221 X:76657308-76657330 CCTACTGGCTATGGTCACTGGGG + Intergenic
1200101755 X:153691902-153691924 ACTCCTGGGGGTGGACCCTGTGG + Intronic
1200696819 Y:6368303-6368325 ACTCCTGCCTCTGTTCCCTGGGG - Intergenic
1201037294 Y:9796396-9796418 ACTCCTGCCTCTGTTCCCTGGGG + Intergenic