ID: 1023276081

View in Genome Browser
Species Human (GRCh38)
Location 7:38519966-38519988
Sequence TCTTAGATTCAGAGGGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 236}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023276081_1023276084 30 Left 1023276081 7:38519966-38519988 CCATGAACCCTCTGAATCTAAGA 0: 1
1: 1
2: 2
3: 31
4: 236
Right 1023276084 7:38520019-38520041 AAAAAAATAAAAAATCATCTTGG 0: 4
1: 29
2: 945
3: 12386
4: 66366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023276081 Original CRISPR TCTTAGATTCAGAGGGTTCA TGG (reversed) Intronic
902220581 1:14962000-14962022 TCCTAGATGCAGAGGGTTCTGGG + Intronic
904407865 1:30305233-30305255 GCTTAGACTGAGAGGGTTCTTGG - Intergenic
906501483 1:46344242-46344264 GCTTAGAATCAGAGGTTTGAGGG - Intronic
906754882 1:48302224-48302246 TTATAGATTTAGAGGGTGCAAGG + Intronic
906848074 1:49216278-49216300 TTTTAGACTCAGAGGGTTACAGG + Intronic
908333520 1:63096463-63096485 TCTTAGCTTCAGATGGTTGCTGG - Intergenic
912186849 1:107287600-107287622 TCTTAAATTTAGAGGGTTGATGG + Intronic
913044715 1:115064021-115064043 TTTTAGAATCAGGGGGTACATGG - Intronic
913184679 1:116359224-116359246 GCTGAGATTCAGAGGGATTATGG - Intergenic
914413318 1:147453675-147453697 TCTTTGATTCTGAGAATTCAAGG - Intergenic
916339761 1:163718815-163718837 TTTTAGATACAGGGGGTACATGG - Intergenic
918729432 1:187972557-187972579 ACTTAGAATCAGGGGGTACACGG + Intergenic
919244037 1:194953970-194953992 TTTTAGATTCAGAGAGTACATGG - Intergenic
920673136 1:208020069-208020091 TCTGAGATTCAGAGAGGTTAAGG - Intergenic
921223418 1:212992256-212992278 TTTGAGATCCAGAGAGTTCAAGG - Exonic
922649710 1:227327297-227327319 TTTTAGATTCAAGGGGTACATGG - Intergenic
923422813 1:233835864-233835886 TCTTTGATTCAGACAGTTTATGG - Intergenic
923425524 1:233865085-233865107 TTTTAGATTCAGGGGGTACATGG - Intergenic
924304572 1:242673963-242673985 ACTTACTCTCAGAGGGTTCAAGG + Intergenic
1063473272 10:6306284-6306306 TGATAGATGCATAGGGTTCAGGG - Intergenic
1063552641 10:7047638-7047660 TCTTATTTTCAGGGGCTTCAGGG + Intergenic
1064117462 10:12591137-12591159 TGTTAGACACAGAGGGGTCAGGG + Intronic
1064832348 10:19484251-19484273 TTTTAGATTCACAGGGCACATGG - Intronic
1067842904 10:49696175-49696197 TTTTAGATACAGGGGGTACATGG + Intronic
1069311529 10:67043956-67043978 TTTTAGATTCAGGGGGTACATGG + Intronic
1069846923 10:71378634-71378656 TTTTAGATTCAGTAGGTACAGGG - Intergenic
1071359935 10:84836514-84836536 TCTTATTCTCACAGGGTTCAGGG + Intergenic
1071661889 10:87512623-87512645 TGTTAATTTTAGAGGGTTCAAGG - Intronic
1073645835 10:105302801-105302823 TTTTAGATTCTGGGGGTACATGG + Intergenic
1074817269 10:117151827-117151849 TCTTAGATTCAGATGCCTCAAGG - Intergenic
1074939282 10:118218853-118218875 TCTTAGTTTTTGAGGGTTCCTGG - Intergenic
1077868883 11:6244870-6244892 TCTTAGACCTAGAGGGCTCAGGG - Intergenic
1078811157 11:14764918-14764940 TCTTTGTTACATAGGGTTCAAGG + Intronic
1078853681 11:15188389-15188411 TGTCAAATTCAGAGGGGTCAGGG + Intronic
1079546147 11:21634214-21634236 GCTCAGTCTCAGAGGGTTCAGGG + Intergenic
1082046318 11:47731777-47731799 TGTTGGAGTGAGAGGGTTCAGGG - Intronic
1082119020 11:48357955-48357977 CCATTGATTCAGAGGGTGCAAGG - Intergenic
1082255271 11:50027192-50027214 CCATTGATTCAGAGGGTGCAAGG + Intergenic
1086247836 11:84775866-84775888 TTTTAGATTCTGCGGGTACATGG - Intronic
1087725747 11:101714167-101714189 TTTTAGATACAGGGGGTACATGG - Intronic
1090245111 11:125210575-125210597 TCTTTGGTTCAGAGTTTTCAGGG + Intronic
1091677720 12:2503535-2503557 TCTTAGGGTCAGCGGGTACAGGG + Intronic
1091689919 12:2588931-2588953 TCATTGCTGCAGAGGGTTCAAGG + Intronic
1091937353 12:4444360-4444382 TCCTAGAGTTAGAGGGATCATGG - Intronic
1094211796 12:27900884-27900906 TTTTAGATTCAGGGGCTACAAGG - Intergenic
1094494166 12:30979063-30979085 TCCCCGATTCAGAGGGCTCAAGG - Intronic
1094593719 12:31844979-31845001 TCTTAGTTTAAGAGGATTTATGG - Intergenic
1095905806 12:47376917-47376939 TCTTATTCTCAGAGGGTTCAGGG - Intergenic
1097954970 12:65474909-65474931 TTTTTGATTCATAGGCTTCAAGG + Intronic
1098845021 12:75524276-75524298 TCCTAGATTCCCAGGGTTCTTGG - Intergenic
1099046388 12:77726091-77726113 TCATATATTCACAGGTTTCAAGG + Intergenic
1099612761 12:84895669-84895691 TCTTATGTTCAGTGGGTGCATGG - Intronic
1099963015 12:89414823-89414845 TCTTAGATGCATAGAATTCATGG + Intergenic
1101011599 12:100456629-100456651 TCTAAGAATCAGAGGGATCTGGG - Intergenic
1101665913 12:106814306-106814328 TCTTAGCTAAAGGGGGTTCAAGG + Intronic
1104366846 12:128185850-128185872 TTTTAGATTCAGGAGGTACATGG + Intergenic
1105691646 13:22846279-22846301 GCTTAGAGTCAGAGGTTGCATGG + Intergenic
1106951847 13:34893084-34893106 CCTAAGGTTCAGAGAGTTCATGG - Intergenic
1107379684 13:39842914-39842936 GCTTTCATTCAGAGGTTTCAAGG - Intergenic
1108458752 13:50643886-50643908 TCTTTGGGTCAGAGGGTTAATGG - Intronic
1108748939 13:53426469-53426491 TTTTAGATTCAGAAGGTACGTGG + Intergenic
1108830544 13:54472620-54472642 TTTTAGATTCAGAGGTGTCTGGG - Intergenic
1109308552 13:60665458-60665480 TTTTAGATTCAGGGGGTACATGG + Intergenic
1109636431 13:65123841-65123863 TATAAGTTTCAGAGGGATCATGG + Intergenic
1110754081 13:79151480-79151502 TCGTAGAATCAGAGTTTTCAGGG + Intergenic
1112578683 13:100659879-100659901 CCTGAGATTGAGAGGGTTCTGGG - Intronic
1115036285 14:28860672-28860694 GATTAGATTCAGAGGCTTGATGG + Intergenic
1116933086 14:50709523-50709545 TCTTAGATTCCTAGGTTCCATGG + Intergenic
1119121844 14:72086741-72086763 AGTTAGCTTCAGAGAGTTCAGGG - Intronic
1119319453 14:73720985-73721007 TCTGAGATTCAGAGGGAAAAAGG - Intronic
1120225475 14:81786806-81786828 TCTTGGAATCAGAGGCTACATGG - Intergenic
1122832273 14:104404736-104404758 TCTTATATTCTATGGGTTCATGG - Intergenic
1124587239 15:31021121-31021143 TTCTAAATTCATAGGGTTCAAGG - Intronic
1127067775 15:55258155-55258177 TCTTAGTGTCAGTGGTTTCAAGG - Intronic
1129607532 15:77032154-77032176 TCTTTGATCCTGAGGGGTCACGG - Intronic
1130201785 15:81836692-81836714 TCTTAGATTCAGCCAATTCATGG - Intergenic
1130773838 15:86954775-86954797 TGTTAGATATAGAGGGTTCATGG - Intronic
1132407384 15:101552100-101552122 TCCTGGTTTCAGAGGGCTCATGG - Intergenic
1134397262 16:13876671-13876693 TCTTAGACTCTGAGGCTTCCTGG - Intergenic
1134450067 16:14357843-14357865 TCTCAGGTTCAGAGGGTTCCAGG - Intergenic
1135161108 16:20097190-20097212 ATTTAGATTCAGGGGGTACATGG + Intergenic
1135385918 16:22039788-22039810 TCTTAGATTCAGGGTGGTTAGGG - Intronic
1138091455 16:54177958-54177980 AAATAGATTCAGAGGGTGCATGG - Intergenic
1138710122 16:58961702-58961724 TTTTAGATTCAGGGGGTATAGGG + Intergenic
1138934041 16:61697069-61697091 TTTTAGGTTCAGAGGATTCGTGG - Intronic
1139168819 16:64605265-64605287 TGTTAGTTTCAAAGGGTCCATGG - Intergenic
1139436236 16:66938185-66938207 TCCAAGATTCAGGGGGCTCAGGG - Exonic
1140548605 16:75837815-75837837 TCAGAGGTTCAGAGGGCTCAAGG - Intergenic
1140649552 16:77072175-77072197 TCTTAGATTCAGGGGGTACAAGG - Intergenic
1140926507 16:79589569-79589591 TCTTATTTACAGAGGGTTCCTGG + Intronic
1140938726 16:79700926-79700948 TTTGAGATTCAGAGGGTCCATGG + Intergenic
1141382787 16:83590830-83590852 TTTATGATTCAGAAGGTTCAGGG - Intronic
1141399025 16:83730679-83730701 TTTTAGATTCAGGGGGTCCATGG + Intronic
1142603711 17:1070306-1070328 TCTGGGATTCAGAGAGGTCAGGG - Intronic
1144145168 17:12390199-12390221 TCTCTGAATCAGAGGGGTCATGG - Intergenic
1144675932 17:17161573-17161595 CCTTAGATATAGAGGTTTCAGGG - Intronic
1146784996 17:35711948-35711970 TCTTTTATTCTGAGGGTTCCAGG - Intronic
1148124634 17:45230472-45230494 TCCTAGGGTCAGAGGATTCATGG + Intronic
1148181097 17:45605493-45605515 GCTTAGACTGAGAGGGTTCTTGG + Intergenic
1148267814 17:46240436-46240458 GCTTAGACTGAGAGGGTTCTTGG - Intergenic
1148475675 17:47927142-47927164 TCTTAGGTGCAGAGGCTCCAGGG + Intronic
1148971538 17:51487449-51487471 TTTTAGATTCAAGGGGTACATGG + Intergenic
1149741458 17:59050195-59050217 TCTTGGATTTAGAGGATTCTAGG - Intronic
1150931100 17:69586319-69586341 TTTTAGATTCAGGAGGTACATGG - Intergenic
1151098173 17:71523222-71523244 TTTTAGATACAGGGGGTACATGG - Intergenic
1153065097 18:1036414-1036436 TTTTAGATTCAGGGGGTACATGG + Intergenic
1153466261 18:5390977-5390999 TTTTAGATTCAGAGGGCACATGG - Intergenic
1154947209 18:21173831-21173853 TCTAAGATTTAAAGTGTTCATGG + Intergenic
1154959747 18:21296540-21296562 TCTTAGATTCAAGGGGTATATGG - Intronic
1159301564 18:66578243-66578265 TCTTGTATTCAGAGTGTACAAGG + Intronic
1159385334 18:67717525-67717547 TTTTTGATTCAGTGGGTACATGG + Intergenic
1159385395 18:67718273-67718295 TTTTTGATTCAGTGGGTACATGG - Intergenic
1161875271 19:6903664-6903686 ACCTAGATGCAGAGGGTTCTAGG + Intronic
1163655349 19:18542602-18542624 TGTTAGATTCAGAGTGTGGAAGG - Intronic
1164480205 19:28605869-28605891 TCTTAGGCTCAGAGGCTGCAAGG + Intergenic
1167051951 19:47084792-47084814 TCTGAGGTTCAGAAGGTTCTAGG - Intronic
1167653546 19:50748028-50748050 TTTTAGATTCAGGGGGTACATGG - Intergenic
1168650342 19:58088400-58088422 CTTTATTTTCAGAGGGTTCATGG + Intronic
925763512 2:7209215-7209237 GCTTGGATTCAGAGGGGCCATGG - Intergenic
927031427 2:19124043-19124065 ACTTGGATTCAAAGGCTTCAAGG + Intergenic
927312501 2:21647014-21647036 CCTTAGAGTCAGAGAGCTCATGG - Intergenic
927319365 2:21724530-21724552 TCTGAGATCCAGATGGTTCAAGG + Intergenic
927453873 2:23232660-23232682 TTTCTGATTCAGTGGGTTCAGGG - Intergenic
927678504 2:25124371-25124393 CCTTGGATTCAGAGACTTCATGG + Intronic
928253329 2:29700883-29700905 CCTCAGGTTCAGAGTGTTCAAGG - Intronic
928658521 2:33477780-33477802 TCTTTGAATCAGAGGCTGCAGGG + Intronic
929369248 2:41202119-41202141 TGTTAATTTCAAAGGGTTCAAGG + Intergenic
930592911 2:53350893-53350915 TCTAGGATTCACAGGGGTCAGGG - Intergenic
932072266 2:68633196-68633218 TTTTAGATTCAGGGGGTACATGG + Intergenic
932857398 2:75250688-75250710 TCTTACATTAACATGGTTCATGG + Intergenic
933556042 2:83831561-83831583 TCTTTGATTCACAGAGTTTAAGG - Intergenic
938330553 2:130445287-130445309 CATGAGATTCAGAGGGGTCAGGG - Intergenic
939130433 2:138229416-138229438 TCTTAGTTGCAGAGGAATCAGGG + Intergenic
940398975 2:153224461-153224483 TTTTAGATTCAGGGGGTACATGG - Intergenic
941139245 2:161757235-161757257 TTTTAGATATAGAGGGTACATGG - Intronic
941310767 2:163928013-163928035 TTTTAGGTTCAGGGGGTACACGG - Intergenic
942801119 2:179877093-179877115 TCCTAAATTCAGAGAGATCATGG - Intergenic
945103177 2:206282436-206282458 TTTTAGATTCAGGGGGTATATGG + Intronic
945756800 2:213856673-213856695 CCTTTGCTTCAGAGGGTGCAAGG - Intronic
948158524 2:235804553-235804575 TCTTTGATACAGAGGGCTCTTGG + Intronic
948190584 2:236055164-236055186 TCCCGGATGCAGAGGGTTCAGGG + Intronic
948844442 2:240676471-240676493 TCTTAGCTACAGAAGGTTCCAGG + Exonic
948849418 2:240698408-240698430 TCTTAGCTACAGAAGGTTCCAGG - Exonic
1169779174 20:9290942-9290964 ACTAAGACTCAGAGGGTTAAGGG + Intronic
1170537355 20:17354111-17354133 TTTTAGATTCAGGGGGCACATGG - Intronic
1171958534 20:31477129-31477151 TCTAAGAGTCAGAGGAGTCAGGG - Intronic
1173479281 20:43386346-43386368 TTTTAGATTCAGGGGATGCATGG + Intergenic
1175007285 20:55698520-55698542 TCTTAGATTCAGAGGGTACATGG + Intergenic
1177044030 21:16146931-16146953 TCTTACATGCAGGAGGTTCATGG - Intergenic
1177229877 21:18305571-18305593 TCTTAGATTCAGAATGGTCTAGG - Intronic
1177244904 21:18510559-18510581 TCTTTGCTTCAGAGGGTGCAAGG + Intergenic
1180250673 21:46585350-46585372 TGTTGGATTGAGAGGGATCATGG + Intergenic
1182634401 22:31712931-31712953 TCTTAGCTTCTGAGTCTTCATGG + Exonic
1184609500 22:45593754-45593776 TCCTAGATTGTGAGGCTTCAGGG + Intronic
1184941630 22:47770947-47770969 AATTAGATGCAGAGGGTTGATGG - Intergenic
950584680 3:13883790-13883812 TTTTTGTTTCAGAAGGTTCATGG + Intergenic
952020093 3:29008298-29008320 TTTTAGATTCAGGAGGTACATGG - Intergenic
952179960 3:30907095-30907117 TCCTAGAGACAGAGGGTTCCAGG + Intergenic
952736284 3:36694702-36694724 TTTTAGAGTCAGAGAGCTCAAGG - Intergenic
953253600 3:41267954-41267976 TGTTTGATTCAGTGGCTTCATGG + Intronic
956050730 3:65245424-65245446 TTTTAGGGTCAGAGGGTTCCAGG - Intergenic
956517494 3:70065467-70065489 TATTAGATTGAGAGACTTCAAGG + Intergenic
957856973 3:85892055-85892077 TCTTAGAATCAGAATATTCAAGG - Intronic
959428950 3:106227957-106227979 TTTTAGATTCAGGGAGTACACGG - Intergenic
960175278 3:114510364-114510386 TCCTAGAGTCTGAAGGTTCATGG + Intronic
960514701 3:118590538-118590560 TCTAAGATTTAGGGGGTTAAAGG + Intergenic
961110022 3:124276026-124276048 TCTCAGATGTAGAGGGTGCATGG - Intronic
961407820 3:126694504-126694526 TTTTAGATTCAGGAGGTACACGG + Intergenic
963544331 3:146636427-146636449 TCTCAGATTCTGGGAGTTCATGG - Intergenic
964037924 3:152221026-152221048 TCTTAGAATCAAAGGGTGCCAGG - Intergenic
964250855 3:154715038-154715060 TCTTCGATTCACAGGGGTCTGGG + Intergenic
964813563 3:160692476-160692498 TCTTATATGGACAGGGTTCAAGG - Intergenic
966074415 3:175919480-175919502 ACATAGCTTCAGAGGGTTTAAGG - Intergenic
967194639 3:187015874-187015896 TCTTGGATTCAGACAGTTCTGGG + Intronic
967532172 3:190561176-190561198 TCTTAGAGTGAGAGGGTGCTGGG - Intronic
968294796 3:197567700-197567722 TCTGAGATTTTGGGGGTTCATGG + Intronic
969282461 4:6179909-6179931 TCTTAGATTCAGAGAGACCTGGG - Intronic
969284620 4:6195102-6195124 CCTGAGTTGCAGAGGGTTCAGGG + Intronic
970405403 4:15758156-15758178 TTTTAGTTTCAGGGGGTACATGG + Intergenic
971368772 4:25998610-25998632 TCTGAGATTCAGAATGTTCTAGG + Intergenic
972701585 4:41499326-41499348 TCTTACATTCAAATGGTTCAGGG - Intronic
974445661 4:61977807-61977829 TTTTAGATTCATGGGGTACATGG + Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
976561360 4:86505278-86505300 TTTTAGATTCAGGGGGTACATGG - Intronic
976891327 4:90051059-90051081 TCTCAGGTTCTGAGAGTTCATGG - Intergenic
980144635 4:128966873-128966895 TTTTTGATTCAGGGGGTACATGG + Intronic
981239244 4:142455342-142455364 TCTTAGACTTAGAGGGTAGAAGG - Intronic
982796332 4:159649793-159649815 TCTTAAGTTCAGAGGATCCATGG + Intergenic
983632744 4:169866148-169866170 TCTTAAATTCTGAGAGTTTAGGG - Intergenic
983889796 4:173018899-173018921 TTTTAGATTGAGAGGGAACAAGG + Intronic
988019904 5:25608976-25608998 TTTTAGAATCTGAGGGTTAAAGG + Intergenic
988368287 5:30331817-30331839 TCTCATATTCAGAAGATTCAAGG - Intergenic
988785315 5:34561389-34561411 TCTTAGATCCAGAGGGAGGAAGG - Intergenic
989431255 5:41358192-41358214 ACTGAGGTTCAGAGGGTTTATGG + Intronic
992106780 5:73454944-73454966 TCTTAGAATGAAAGGATTCAAGG - Intergenic
992754440 5:79890898-79890920 TATTAGATTCAGTGGTTTCAAGG - Intergenic
993086451 5:83369262-83369284 TCATAGAATCAGAGGGCGCATGG + Intergenic
994278561 5:97870043-97870065 TTTTAGGTTCAGTGGGTACATGG - Intergenic
998526072 5:142844511-142844533 TTTCAATTTCAGAGGGTTCAGGG + Intronic
1000322259 5:160143838-160143860 TTATAGATTCAGAGGGTATATGG + Intergenic
1001219881 5:169891376-169891398 TCTTATAGTTAGAGGCTTCAAGG + Intronic
1002299843 5:178251591-178251613 TTTTAGATTCAGGGGGTACACGG + Intronic
1003960193 6:11201819-11201841 ACTTAGACTCAGAGGAATCACGG - Intronic
1005101105 6:22173352-22173374 TCTTTGCTTCAGAGGGTGCAAGG + Intergenic
1005419241 6:25631826-25631848 TCCTGAATTCAGAGGGTTTAAGG + Intergenic
1006252416 6:32798936-32798958 TCATAGATTCAGATCTTTCAGGG - Intergenic
1009765459 6:68068891-68068913 TTTTAGATTCAAAGGATTCTAGG + Intergenic
1012648734 6:101724205-101724227 TTTTAGATTCAGGGGGTACATGG + Intronic
1013377307 6:109530070-109530092 TGTTAGATTTAGAGGATTCTGGG - Intronic
1013630071 6:111977945-111977967 TTCTAGATTGAGAGGGATCATGG + Intergenic
1014383734 6:120776577-120776599 TTTTAGATTCAGGGGGTACATGG + Intergenic
1014563016 6:122913855-122913877 CCATTGCTTCAGAGGGTTCAAGG + Intergenic
1015359338 6:132320239-132320261 TCTTTGAGTCAGAGGCCTCAAGG + Intronic
1018559449 6:165086215-165086237 TTTTAAATTCAGAGGATACATGG - Intergenic
1020559300 7:9709994-9710016 TACTAGAGTCAAAGGGTTCAGGG - Intergenic
1020882021 7:13774326-13774348 TCTCAGATTCTGAAGTTTCATGG - Intergenic
1020936597 7:14473290-14473312 CCATAGCTTCAGAGGGTGCAAGG + Intronic
1022599737 7:31746503-31746525 GCATAGATTCAGAAAGTTCAAGG + Intergenic
1023112389 7:36826800-36826822 TCACAGTTTCCGAGGGTTCAGGG - Intergenic
1023276081 7:38519966-38519988 TCTTAGATTCAGAGGGTTCATGG - Intronic
1023585196 7:41722551-41722573 ACTAAGATTTAGAGGGTTAAGGG - Intergenic
1026329329 7:69338086-69338108 TCTCAGATTTGGGGGGTTCATGG + Intergenic
1027799605 7:82734935-82734957 CCTTTCATTCAGAGGGTTCTGGG - Intergenic
1027991003 7:85360885-85360907 TCCTAGATTCAGAGGATATATGG + Intergenic
1031632263 7:124058203-124058225 TTATAGATGAAGAGGGTTCAGGG + Intergenic
1032848190 7:135769751-135769773 TTTTAGATTCAGGGGGTACATGG - Intergenic
1033737849 7:144241452-144241474 TCTTAGAGTCTGAGGAGTCATGG + Intergenic
1033745206 7:144309505-144309527 TCTTAGAGTCTGAGGAGTCATGG - Intergenic
1034883836 7:154782728-154782750 TTTCAGATTCAGAGGGTCTAGGG + Intronic
1037198778 8:16224418-16224440 CCTTAGCTTGAGAGGGTTCCTGG - Intronic
1038268298 8:26052894-26052916 TCAAAGATTCAGAAGGTTGAGGG - Intergenic
1041804481 8:61835007-61835029 TCTTAGATTCTGAAGCTCCATGG + Intergenic
1042863949 8:73340525-73340547 TCTTGGGTTCAGGGGGTTTAAGG + Intergenic
1044952584 8:97448573-97448595 TTTTAGATTCAGGGGATACATGG + Intergenic
1044993803 8:97820045-97820067 TCTTAAAATCAGGGTGTTCATGG + Intronic
1045615244 8:103901283-103901305 CCTCAGATTCAGAGGGTTCAGGG + Intronic
1046280318 8:112020549-112020571 TTTTAGATTGAGAGGGTACATGG - Intergenic
1047119612 8:121886390-121886412 TTTTAGATACAGGGGGTACATGG + Intergenic
1050121550 9:2313813-2313835 CCATTGCTTCAGAGGGTTCAAGG + Intergenic
1050616680 9:7408436-7408458 TCTTAAATTCTGAGGCTTCGGGG + Intergenic
1050851096 9:10287467-10287489 ACTCAGATTCATAGGGTGCATGG - Intronic
1050866010 9:10500366-10500388 TTGAAGTTTCAGAGGGTTCATGG + Intronic
1053381569 9:37653304-37653326 TCTTTTTATCAGAGGGTTCATGG + Intronic
1057161196 9:92889490-92889512 CCTGAGATTCAGAAGGGTCAAGG - Intergenic
1058909145 9:109505218-109505240 CCAGAGATTCAGAAGGTTCATGG - Intergenic
1059460889 9:114429293-114429315 TCCTAGATTATGAGGGGTCATGG - Intronic
1059573448 9:115465515-115465537 GTTTAGATTCAGGGGGTACATGG - Intergenic
1060681395 9:125568178-125568200 TCTAAGATTTAGGGGGTTAAAGG + Intronic
1186993746 X:15097219-15097241 TGTTTGATACAGAGGATTCAGGG - Intergenic
1187269182 X:17764615-17764637 TCTGACATTCAGAGGGTTCTTGG - Intergenic
1187320335 X:18232048-18232070 TCTGACATTCAGAGGGTTCTTGG + Intergenic
1188177713 X:27012883-27012905 TTTTGGATTTAGAGGGTACATGG + Intergenic
1189506501 X:41616373-41616395 ACTGAGCTTCAGAAGGTTCATGG + Intronic
1190137851 X:47813609-47813631 CCTAAGATTTAGAGGGTTAAAGG - Intergenic
1190947408 X:55109268-55109290 TCTAAGATTCAGGGGGTTAGAGG + Intronic
1193237948 X:79131650-79131672 TTTTAGAGGCAGAGGGTGCAAGG - Intergenic
1193563682 X:83051400-83051422 TCATAGATTCAGAGACTACAAGG + Intergenic
1193677693 X:84476917-84476939 TCTTTGCTTCAGATGTTTCAGGG - Intronic
1194152767 X:90345491-90345513 GCTTAGCTTGAGAGGGTTCTTGG + Intergenic
1196426711 X:115577202-115577224 TATGAGTTTCAGAGAGTTCATGG - Intronic
1197035178 X:121865265-121865287 TATTAAATTGAGAGGGATCATGG - Intergenic
1197958892 X:131982460-131982482 TCTTAGAATCAGAGGATAAAAGG - Intergenic
1198563084 X:137872677-137872699 TCTTAGAATCAGTGGAGTCAAGG - Intergenic
1199718037 X:150520520-150520542 TTTTAGGTTCAGCGGGTACATGG - Intergenic
1199773625 X:150991714-150991736 TCTTAGTTTCAGATTGTTCATGG - Intergenic
1200499111 Y:3922236-3922258 GCTTAGCTTGAGAGGGTTCTTGG + Intergenic
1200514941 Y:4133005-4133027 TTTCAGATTCAGAGAGTACATGG + Intergenic
1200881115 Y:8211992-8212014 TCTTCCTTTCAGTGGGTTCATGG + Intergenic
1201541022 Y:15104795-15104817 TAATAGATTCAGAGGCTACATGG + Intergenic
1201648725 Y:16263106-16263128 TCTTAGTGTCAGAGGCTACAAGG - Intergenic
1201654084 Y:16322194-16322216 TCTTAGTGTCAGAGGCTACAAGG + Intergenic