ID: 1023279544

View in Genome Browser
Species Human (GRCh38)
Location 7:38555470-38555492
Sequence CCTCATTGATGGTACCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023279544 Original CRISPR CCTCATTGATGGTACCTGCA AGG Intronic
900181190 1:1311741-1311763 CCCCAGGGATGGGACCTGCAGGG + Exonic
901192624 1:7421713-7421735 CCTCATTGGTGGTACCAGGTGGG + Intronic
904544882 1:31261556-31261578 CTTCATTGATGGAGCCAGCATGG + Exonic
907395154 1:54184542-54184564 ACTCATTTATGGTACCTGCATGG - Intronic
909209662 1:72807751-72807773 CCTGAGTGGTGGTAGCTGCAGGG - Intergenic
909964673 1:81893578-81893600 CTGCATTGTTGGTACCTGTAGGG + Intronic
910787106 1:91011862-91011884 CCTCTTTGATGGTAGCTTCCAGG - Intronic
911660459 1:100496042-100496064 CCTCATTGGCAGTACCTGAAAGG - Exonic
917430089 1:174957449-174957471 CTTCTTGGTTGGTACCTGCAGGG - Exonic
917932460 1:179832437-179832459 GCTCATTGATGCTACCAGCTGGG + Intergenic
919821213 1:201473373-201473395 AGTCATTGATGCTACCTGCAAGG + Intergenic
1064810871 10:19196768-19196790 CTTCATAAATGGTACCTCCATGG + Intronic
1064953079 10:20875990-20876012 CCTATTTGATGATACCTGGAGGG - Intronic
1072710143 10:97711051-97711073 CCTTAGTGCTGGAACCTGCAGGG - Intergenic
1073445925 10:103580241-103580263 CCTGAATGATGGGACATGCAAGG + Intronic
1074170741 10:110933528-110933550 ACTCATTTATGTTACCTGCCTGG - Intronic
1074842542 10:117369647-117369669 CTTAATTGATGGTACTTGCCTGG - Intronic
1086743660 11:90399555-90399577 TCTCATTCATGGTAACTCCATGG - Intergenic
1087982085 11:104628029-104628051 CCTCATTGAATGTACTTCCATGG + Intergenic
1093412165 12:18879866-18879888 CCACATTGATGTTATCTGCTTGG - Intergenic
1098876064 12:75867497-75867519 CCTATTTGAGGGTTCCTGCAGGG - Intergenic
1102047810 12:109840741-109840763 CCTCATTGAAGGTCCCTGGCAGG - Intergenic
1106576915 13:30983269-30983291 CCTCATTTAGGTTACCTGCCAGG - Intergenic
1109215383 13:59583748-59583770 CCAAACAGATGGTACCTGCATGG - Intergenic
1111191958 13:84820361-84820383 CCACAGTGATGGTAACTGCATGG - Intergenic
1113360581 13:109627483-109627505 CCTCATTGATTGTGGCAGCATGG + Intergenic
1115158881 14:30370302-30370324 GCTCATTGCTGGTGCCTTCAGGG - Intergenic
1115789166 14:36859455-36859477 CCTCCTGGATGGTGCCTGGATGG - Intronic
1117426610 14:55605065-55605087 CCTCATTTATGGAACCTTCCAGG + Intronic
1118929711 14:70230221-70230243 CCTTATTCATGGGACCTGCCTGG + Intergenic
1118954873 14:70471202-70471224 CCTTATTCATGGGACCTGCCTGG - Intergenic
1122036334 14:98951744-98951766 CCTCACTCAGGTTACCTGCAGGG - Intergenic
1129868553 15:78926493-78926515 CCTCATTGGTGACACCTGCAGGG - Intronic
1132237253 15:100231474-100231496 CCTCATTCATGGTCCCTGTCAGG - Intronic
1132703616 16:1231928-1231950 CCTCATTCATGGAACCAGGACGG - Intergenic
1132704893 16:1239433-1239455 CCTCATTCATGGAACCAGGACGG + Intergenic
1132707902 16:1254467-1254489 CCTCATTCATGGAACCAGGACGG + Intergenic
1137398489 16:48134112-48134134 CTTCATTAATGGTACTTGCCTGG - Intronic
1137963552 16:52909298-52909320 CCTCATTGATTGTAGCTTGAGGG + Intergenic
1138550443 16:57744838-57744860 ACTCATTCATGTGACCTGCAGGG - Intronic
1139594122 16:67948290-67948312 CCTCATTGCTGCCACCTCCATGG + Intronic
1140495938 16:75388470-75388492 ACTCATTTATATTACCTGCATGG - Intronic
1143570222 17:7753461-7753483 CCGCATTGAAGGGAGCTGCAAGG + Intronic
1149514475 17:57269805-57269827 CTTCATAGATGGTATCTGCTTGG + Intronic
1152043216 17:77918496-77918518 CCCCAGTGATGCTACCTGTAGGG - Intergenic
1153646355 18:7199549-7199571 CCTCATAGATGGTACCATCTAGG + Intergenic
1156507756 18:37609241-37609263 CCTCCCTGATGGTACCGGAAGGG + Intergenic
1157339270 18:46764852-46764874 CCACATTGCTGCTACCTGGATGG + Intergenic
1158971129 18:62667653-62667675 CCTAATTTTTGGTACCTTCAAGG + Intergenic
1161844209 19:6702565-6702587 CCTCATCCAGGTTACCTGCAGGG + Exonic
1162503004 19:11065228-11065250 CCTCACTGTTGGAAGCTGCAGGG - Intronic
1163866787 19:19779843-19779865 CCTCATAGATGATACCTTCTTGG - Intergenic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
928241770 2:29592687-29592709 CCTAACCGCTGGTACCTGCAAGG + Intronic
930691620 2:54371307-54371329 CCCCAGTGGTGGCACCTGCAGGG - Intronic
932555420 2:72819785-72819807 CATCATTCATGCTACCTGCTAGG + Intronic
941624687 2:167818410-167818432 GCTCATTGATACCACCTGCATGG + Intergenic
944312211 2:198246055-198246077 CCTGAATTATGGCACCTGCAAGG - Intronic
944957144 2:204824939-204824961 TCTCATTGGTGGTTGCTGCATGG + Intronic
945575764 2:211526183-211526205 TCCCAGTGATGGTACCTACAGGG + Intronic
1169611550 20:7386143-7386165 CCTCATTTCCTGTACCTGCAGGG - Intergenic
1171194428 20:23186446-23186468 CCTCTTCGCTGGTACCTGCAGGG - Intergenic
1172915321 20:38439231-38439253 CCTCATGGATGGGACCTCCTGGG - Intergenic
1174288960 20:49493568-49493590 TCTTATTTATGTTACCTGCATGG + Intergenic
1174875420 20:54222334-54222356 CCTCATTTATATTACCTGCGTGG + Intronic
1175285255 20:57833460-57833482 GCTCAGGGCTGGTACCTGCAGGG - Intergenic
1183232280 22:36590501-36590523 CCTGATGGATGGAGCCTGCAGGG - Intronic
1184937943 22:47738833-47738855 CCTCTTTGATGCCACATGCATGG + Intergenic
952321105 3:32278478-32278500 ACTCATTTATGTTACCTGCTTGG + Intronic
952664634 3:35889368-35889390 CCTCATAGATGGTACCGTCTAGG - Intergenic
952699473 3:36310664-36310686 CCTCATAGATGGTACCACCTAGG - Intergenic
955400439 3:58587287-58587309 CCTTGTTGATGCTACCAGCATGG + Intronic
955877416 3:63506927-63506949 CATCATTTATGCTACTTGCATGG - Intronic
958136911 3:89505720-89505742 CCTGATTGATGGTTCTAGCAGGG + Intergenic
958139617 3:89544888-89544910 CCTTATTAAAGTTACCTGCAGGG - Intergenic
962193694 3:133337284-133337306 TCCCATTGATGGTAGCTACAGGG + Intronic
962382934 3:134911714-134911736 CCTCCTGGAGGGTAGCTGCATGG + Intronic
962700865 3:137998928-137998950 CATCATTGCTGCCACCTGCATGG + Intronic
964388683 3:156175925-156175947 CTTCATTGATGGAGCCAGCATGG + Intronic
966833280 3:184029398-184029420 CCTCATTTATGTTACCTGGTTGG - Intergenic
979714302 4:123818764-123818786 CCTGATTGACAGTCCCTGCATGG + Intergenic
986298250 5:6457056-6457078 CCTCCCTGATGCCACCTGCATGG + Intronic
986626818 5:9730498-9730520 CCCACTGGATGGTACCTGCACGG - Intergenic
986641364 5:9875196-9875218 CCTCATTGATTTTCCCTGCCTGG - Intergenic
988638050 5:33008843-33008865 GCTCATTCACTGTACCTGCAGGG - Intergenic
988832576 5:35002425-35002447 CCTCATTTCTGGAACCTTCAGGG + Intronic
990989592 5:61672371-61672393 TCTCAGTGACGGTAACTGCAGGG + Intronic
991998061 5:72407948-72407970 CCACATGGATGGGACCTGTAGGG + Intergenic
993269391 5:85774118-85774140 CCTCACAGATGGAACCAGCAGGG + Intergenic
994876403 5:105428113-105428135 ACTCATTTATGTTACCTGCCTGG + Intergenic
996042827 5:118835005-118835027 CCAAATTAATGGTACATGCATGG + Intergenic
1000125431 5:158239274-158239296 TCTCATAGTTGGAACCTGCAGGG - Intergenic
1001227786 5:169960335-169960357 GCTCATTTATGGTGCCTGAAAGG + Intronic
1002679117 5:180947656-180947678 CCTTATTCATGGTTCCAGCAGGG + Intronic
1006153991 6:32004359-32004381 CCTCCTGGATGGTACCTGAGAGG - Intergenic
1006160298 6:32037096-32037118 CCTCCTGGATGGTACCTGAGAGG - Intergenic
1007207420 6:40164107-40164129 CCTCATTCATGTGACTTGCAGGG - Intergenic
1009618583 6:66042798-66042820 CAGCATTGTTGGTACTTGCAAGG - Intergenic
1009708321 6:67284587-67284609 ACTCATTGATGGCACTTGCTGGG - Intergenic
1009990847 6:70841250-70841272 TCCCATTAATGGTTCCTGCAGGG + Intronic
1015360540 6:132334194-132334216 CCTCATTGATGTTGGCTTCATGG - Intronic
1015881059 6:137870164-137870186 CCTCTGTGTTGGTACCTGGAGGG + Intronic
1017597409 6:156044326-156044348 CCTCAATCAAGGTACCTCCATGG - Intergenic
1018918609 6:168154845-168154867 CCAGTTTGATGGTAACTGCAGGG + Intergenic
1021824561 7:24535981-24536003 CCTCAGTGATGCTGCCTTCAGGG + Intergenic
1023279544 7:38555470-38555492 CCTCATTGATGGTACCTGCAAGG + Intronic
1023303820 7:38802315-38802337 TCTCCTTGATGTTACCTGCCTGG + Intronic
1024197449 7:47073101-47073123 CCTCATTGTGGGTCCCTGCATGG - Intergenic
1030128506 7:106177729-106177751 GCTCGTTGATGCTACCTGCCTGG + Intergenic
1034463992 7:151214929-151214951 ACTCATTGATGGCATCTGCCAGG + Exonic
1034855583 7:154543362-154543384 CCTCATAGCTGGTCACTGCAAGG + Intronic
1042089961 8:65148156-65148178 CCTCATGGAGGGTAGCTGTAGGG - Intergenic
1043317286 8:78938349-78938371 CGTCATTGAAGGTACCTGGTGGG + Intergenic
1045205810 8:100039123-100039145 CCTGATTTATGGTAACAGCAAGG - Intronic
1049551235 8:143260960-143260982 GCTCAGGGATGGGACCTGCAGGG - Intronic
1054998294 9:71418542-71418564 CCCCATTGATGGGATCTGCTAGG - Intronic
1056712482 9:89001989-89002011 CCTCATTGATGTGGCCTGCAGGG + Exonic
1060093216 9:120763263-120763285 ACTCATTTATGTTACCTGCACGG + Exonic
1060137706 9:121173443-121173465 CCTCATTCATGGTAAATGGAAGG - Exonic
1192727814 X:73770177-73770199 CCTCATGCATGGGACCTGCCCGG + Intergenic
1194610433 X:96036305-96036327 CCAAATTCATGTTACCTGCATGG + Intergenic
1197968721 X:132093117-132093139 TCTCATTGATTGTCCCTGCCAGG + Intronic
1201703747 Y:16912774-16912796 GCTCATTGGTGGAACCAGCATGG + Intergenic