ID: 1023282258

View in Genome Browser
Species Human (GRCh38)
Location 7:38583091-38583113
Sequence TTGAAAATGAATAAGCGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 202}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023282258 Original CRISPR TTGAAAATGAATAAGCGGGA TGG (reversed) Intronic
901593402 1:10365703-10365725 TTGAAAATGAATAAACCGAGAGG - Intronic
902240461 1:15085070-15085092 TTAAAAATGAATAAAAGGGTGGG + Intronic
903879975 1:26501529-26501551 TTGAAACTGAATATGAAGGAGGG - Intergenic
905409828 1:37761125-37761147 ATGAAAATAAATAAACGAGAAGG + Intronic
911042941 1:93606468-93606490 TGGAAAATGAATAGGAGGAAGGG + Intronic
911333907 1:96557979-96558001 GAGAAAATGAATAAGCTAGAAGG - Intergenic
911680172 1:100706233-100706255 TTGTAAGTGAATAAACGGAAGGG + Intergenic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
914857041 1:151360164-151360186 TAGAAAATGAACAAAAGGGATGG - Intergenic
918081106 1:181208371-181208393 TTAAAGATGAATAAGAGGGCAGG - Intergenic
920415753 1:205798348-205798370 TGCAAAATGAAGAAGCGGGTGGG - Intronic
922497398 1:226069533-226069555 TTCAAAATGAGTAAGCAGGCCGG + Intronic
922956598 1:229607113-229607135 TTGAAAATAAATAAGTCAGAAGG - Intronic
924652209 1:245939906-245939928 TTGAAAAAGAAGAAGAGAGAGGG + Intronic
1063336335 10:5218727-5218749 CTGAAAATGGATAATCAGGATGG - Exonic
1064594583 10:16930696-16930718 TATAAAATGAATAAGCAGGTGGG + Intronic
1066505943 10:36043259-36043281 TTGAAAATGAATAATAGAGTTGG - Intergenic
1067454786 10:46411669-46411691 TTGAGAATGAGAAAGCAGGAAGG + Intergenic
1067632418 10:47972965-47972987 TTGAGAATGAGAAAGCAGGAAGG - Intergenic
1068385004 10:56315274-56315296 TTGAAAATGAGTAAGTGAAATGG - Intergenic
1068928131 10:62560786-62560808 ATGAAAATGAATAACAGGAACGG - Intronic
1074028257 10:109659436-109659458 TTGAAAATGTATCAGAGAGAAGG - Intergenic
1074605965 10:114966419-114966441 TTGAAAAAGAACAAGTTGGAGGG - Intronic
1078501630 11:11885216-11885238 TTAAAAAAGAGTAAGAGGGAGGG + Intronic
1079995121 11:27287621-27287643 TTGAAAATTAAAAAGAGAGAAGG - Intergenic
1083334302 11:61913827-61913849 TTGGAAATGAGGTAGCGGGAGGG - Intronic
1085985132 11:81777454-81777476 TTGAAAATGATTAAAGGGGTAGG - Intergenic
1086577624 11:88358497-88358519 TTTAAAATGAAAATGTGGGAAGG + Intergenic
1088150972 11:106744580-106744602 ATGAAAAGTAATAAGCAGGAAGG + Intronic
1090296248 11:125591195-125591217 TTAAAAATAAAAAAGCGGGGAGG - Intergenic
1092737760 12:11599428-11599450 ATGATAATGATTAAGCGGAATGG + Intergenic
1092991416 12:13905595-13905617 TTGAAAATGAAGGAGTGGGGAGG + Intronic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093807607 12:23453966-23453988 TTAAAAATGAATCAGCAGCAGGG + Intergenic
1094700387 12:32864726-32864748 TTGAAAAAGAATAAAATGGATGG + Intronic
1094794288 12:33952478-33952500 TTGAAAATGAGTAAGGAAGATGG - Intergenic
1096665212 12:53159906-53159928 GAGGAAATGAAGAAGCGGGAAGG - Exonic
1097945283 12:65360925-65360947 TTGGAAATGTTTAAGAGGGAAGG - Intronic
1099663711 12:85598673-85598695 CTGAAAATGAAAATGAGGGAAGG + Intergenic
1108269463 13:48745321-48745343 TTGAAAAAGAATAAATTGGAAGG - Intergenic
1108615807 13:52130851-52130873 TTGAAGATGACTAAGAGGTATGG + Intergenic
1109398163 13:61788643-61788665 GTGAAAAAGAATAAGAGCGAGGG - Intergenic
1109977646 13:69860482-69860504 TTAAAAATGAATAAGTTGAAGGG + Intronic
1111992353 13:95129258-95129280 TTGAAATTGAATAACCCAGATGG + Intronic
1112578569 13:100659167-100659189 ATGAAAAGGAATTAGGGGGATGG + Intronic
1113210954 13:107980241-107980263 TGGAAAATGAAAAAGTTGGAGGG - Intergenic
1113509617 13:110842760-110842782 TTTAAAATGAATAAAGGTGAGGG - Intergenic
1114712155 14:24789500-24789522 TTGAAACTGAATAAAGGGGATGG - Intergenic
1115109225 14:29801436-29801458 ATGAACATGAATAAGCAGTAGGG + Intronic
1115405514 14:33011264-33011286 CTGAATTTGAATAAGCGGGTTGG - Intronic
1115586190 14:34815562-34815584 TTGTGAATGAATAATCGGAATGG - Intronic
1118749004 14:68793242-68793264 TTCAAAAGGAAGAAGGGGGAGGG + Intronic
1120540888 14:85748969-85748991 TTGAAAATGAAGAAGGTGAAGGG + Intergenic
1125551569 15:40548903-40548925 TGGAACATGAATGAGTGGGATGG + Intronic
1128019369 15:64376883-64376905 CTGAAAATAAATATGCAGGAGGG - Exonic
1128935290 15:71741193-71741215 TAGAAATTGAATAAGCGGCCGGG + Intronic
1129204742 15:74030209-74030231 TTGAAAATGAGTGAGTGGCAGGG - Intronic
1133397059 16:5456541-5456563 TTTAAAATGAACAAGTGGGTGGG - Intergenic
1136051922 16:27657225-27657247 TTGAGAAGGAAAAAGTGGGAGGG + Intronic
1139158339 16:64471860-64471882 TTCAAAATGGATAATTGGGATGG - Intergenic
1141059784 16:80855380-80855402 TTGTAAATGAAAAAGAGAGATGG + Intergenic
1144735039 17:17550668-17550690 TTGAACTAGAATAAGCGGGCTGG - Intronic
1149194010 17:54097938-54097960 TTGAAAATGAATAAGTATAAAGG - Intergenic
1149930517 17:60749869-60749891 TTGAAAATTAATCAATGGGATGG + Intronic
1150916284 17:69440452-69440474 TTGAAAAGGAAGAAGCCAGAGGG - Intronic
1156996744 18:43478380-43478402 TTGACAATGGATAAGGAGGAAGG - Intergenic
1157744682 18:50124767-50124789 TTCAAAATGATCAAGCGGGGTGG - Intronic
1159979279 18:74756259-74756281 TTGAAAAAGAATAAGGTTGAAGG - Intronic
1160065543 18:75570801-75570823 ATAAAAATGAATAAGCTGGCTGG + Intergenic
1165643324 19:37409025-37409047 TTGAAAATGAATAATAGGTCAGG + Intergenic
927743581 2:25594200-25594222 TTGAAAATGCATATTCGGGGGGG + Intronic
928938834 2:36707366-36707388 TTGGAAATGAACAAGGGGGCAGG - Intronic
930253618 2:49064160-49064182 TTGAAAATGGATGAGGGAGAGGG + Intronic
930746227 2:54885905-54885927 TTGAAAATCAAAAAGTGGGCTGG - Intronic
933207133 2:79519799-79519821 TTCAAAATGAAAGAGAGGGAAGG - Intronic
935926420 2:108074537-108074559 TGGAAAATGGATAGGCAGGAAGG - Intergenic
938857150 2:135325296-135325318 TTGAAAATTAATAAATGAGAAGG + Intronic
940091106 2:149918383-149918405 TTGAAAATGAATAGTGGTGATGG + Intergenic
940625097 2:156165151-156165173 TTAAAAAAGAATAAGGGAGAGGG + Intergenic
941047742 2:160695537-160695559 TTGAAAATGAAGATGGGAGAAGG + Intergenic
941283826 2:163584422-163584444 TTAAAAATGAGCAAGTGGGATGG - Intergenic
942601844 2:177648607-177648629 TTGAAAAAGAATAATAAGGAAGG + Intronic
942903157 2:181146852-181146874 GTGAAAATTAAACAGCGGGATGG - Intergenic
943823241 2:192354740-192354762 TTTTCAATGAATAAGAGGGAGGG + Intergenic
944472091 2:200064658-200064680 TTCAAAATGAATGAGTGGGCTGG + Intergenic
945877681 2:215295377-215295399 TTTAAAAGGAATAAGGGAGAAGG + Intergenic
946464768 2:219902288-219902310 TTATAAATGAATAAGAGGGCGGG - Intergenic
946505215 2:220292830-220292852 TTGTAAAAGAATAAACTGGATGG - Intergenic
1169964502 20:11199654-11199676 GTGAAAATGACTACGCAGGAAGG - Intergenic
1170127524 20:12981706-12981728 TTGAAAATGATTAAGATGTAGGG - Intergenic
1170582330 20:17708674-17708696 TTGCAAATGAAAAAGCCAGAGGG - Intronic
1172132059 20:32662300-32662322 TTAAAAATAAATAAACGGGCTGG + Intergenic
1173016392 20:39229727-39229749 TTCAAAATGATTCAGTGGGAAGG - Intergenic
1173573129 20:44091091-44091113 TTGGAAGTGAACAAGCTGGAAGG + Intergenic
1174310176 20:49646910-49646932 TTTAAAATGGATAAAGGGGAGGG - Intronic
1177668155 21:24188718-24188740 TTGAACATGAACAAGCATGAGGG - Intergenic
1177788483 21:25696529-25696551 TAGAAAATGAATAAACTGGCCGG - Intronic
1178218351 21:30626279-30626301 TTGAAACTGGATAAGAGGTAGGG - Intergenic
1178330630 21:31687755-31687777 TTGATACTGAATAATCTGGATGG + Intronic
1178972244 21:37190427-37190449 TTGAAAATGAAGAAGGGGCCGGG - Intronic
1178997040 21:37412149-37412171 TTGAAAATGGATAGGCAAGAAGG + Intronic
949685905 3:6570474-6570496 TTGAAACTGAAAATGCAGGAAGG - Intergenic
950128462 3:10525952-10525974 TTGAAGATGAGTAAACTGGAAGG - Intronic
952924545 3:38311459-38311481 TGGAAAATGAATAAACAGCATGG + Intronic
955570241 3:60297082-60297104 TTGAAAAAGAATAAGGTGGTAGG - Intronic
957461818 3:80532039-80532061 TTGCCAATGATTAAGGGGGAAGG + Intergenic
958815922 3:98915461-98915483 TTGAAATTGTGAAAGCGGGATGG - Intergenic
959065667 3:101654405-101654427 TGGAAAATGAAGAAGAGGGGGGG + Intronic
959150269 3:102599548-102599570 CAGAAAATGAATAAGGGTGAGGG - Intergenic
959812754 3:110638047-110638069 TTTAAAATGACTTAGCGGGAGGG - Intergenic
959840440 3:110968815-110968837 TTGTAAATCAAAAAGCAGGAAGG - Intergenic
960000109 3:112722588-112722610 TTGAAAATGAAAAACAGAGAGGG - Intergenic
960240723 3:115338870-115338892 TTGAAAATGAATAGAGGGGGTGG - Intergenic
960321096 3:116237584-116237606 GTGAAAATGAATAAAAGGGATGG - Intronic
960562876 3:119104881-119104903 TTGAGAATGCATATGCTGGAGGG - Intronic
963817361 3:149846599-149846621 TAGAAAATGAATAAGGGGCTGGG - Intronic
965350097 3:167600583-167600605 TTGAAAATGTAAAATAGGGATGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
968169247 3:196495921-196495943 TTGAAAGTGAATTAGTGTGACGG - Intronic
968349806 3:198044792-198044814 TTTAAAATGAATTAGGGAGATGG + Intergenic
970333520 4:15006530-15006552 TTGAAAATGAATCAACTTGATGG + Intronic
970784185 4:19776094-19776116 TGCATAATGAATAAGCGGGTGGG + Intergenic
971612366 4:28742120-28742142 ATGAAAATAAATGAGCAGGAAGG - Intergenic
971694480 4:29881636-29881658 TTGAAAATGAATAATTGTGTAGG - Intergenic
972801435 4:42479768-42479790 AGTAAAATGAATAAGAGGGATGG + Intronic
973297824 4:48545503-48545525 TTGAAAATCATTAAGCTGGGAGG - Intronic
975477178 4:74836575-74836597 TTGCAATGGAATAAGAGGGAAGG - Intergenic
977242565 4:94590879-94590901 TAGAAAATGAAGAAGCAGGGAGG + Intronic
978470297 4:109058894-109058916 TGGAAAATGAATAAACAGAAAGG + Intronic
980490980 4:133528327-133528349 ATCAAAATGAAAAAGCGGCAAGG + Intergenic
981826514 4:148948211-148948233 TTGAAGATGAATTAGGGGGAGGG + Intergenic
981902725 4:149885642-149885664 CTGAAAATGAATATGTGGGTTGG - Intergenic
982735520 4:159002954-159002976 TGGAAATTGAAGAAGCAGGAAGG - Intronic
982928754 4:161375042-161375064 ATGGAAATGAATAAGCAGCACGG + Intergenic
983640759 4:169942127-169942149 TTGAAAAAGCAGAAGCAGGAAGG + Intergenic
983752253 4:171289624-171289646 AAGAAAATGAATAAGCAGGCCGG + Intergenic
984558973 4:181246059-181246081 TTGAAAATGAGAGAGAGGGAGGG - Intergenic
985014765 4:185622847-185622869 TGGAAAATGAAAGAGCTGGAGGG + Intronic
985028730 4:185767200-185767222 TTGAAAATGAAAGAGCTGGCCGG + Intronic
986399438 5:7365974-7365996 TTGAAAATGAATAACCTTGGAGG - Intergenic
987427895 5:17794375-17794397 TTGAGAATGAATCAGCTGCAAGG + Intergenic
988692618 5:33588014-33588036 TTGGAAATCAGTAAGCTGGAAGG - Intronic
988997026 5:36724620-36724642 TTGAAAATAAGGAAGAGGGAGGG + Intergenic
989232159 5:39099107-39099129 TTTAAAATGACTGAGTGGGAGGG + Intergenic
990477998 5:56180355-56180377 TTGAAAAAGAATAAAGTGGAAGG - Intronic
992184840 5:74233926-74233948 TTCAAAATGCAGAAGAGGGATGG + Intergenic
992664554 5:78994360-78994382 TGAAAAATGAATAAGAGGTAAGG - Intergenic
994243437 5:97450617-97450639 GTGAAAAAGAAGAAGTGGGAAGG - Intergenic
994593451 5:101802520-101802542 TTGAAACTCAATTAGCAGGAAGG - Intergenic
994724597 5:103419439-103419461 TTGGAACTGAGTAAGTGGGAAGG - Intergenic
995864388 5:116675939-116675961 GTGAAAATGAACAAACGTGAGGG - Intergenic
995879999 5:116833885-116833907 TTTAAAAGGAAGAAGAGGGAGGG - Intergenic
995950546 5:117707347-117707369 TTGAAAATGAATATTCCAGATGG - Intergenic
1000284950 5:159819006-159819028 TAGAAAATGAACAAGCAGGCAGG + Intergenic
1000923571 5:167167011-167167033 TTGAAAGTGAAGAATCGAGAAGG - Intergenic
1002992665 6:2252195-2252217 ATGAAAATGAATGAGAGAGAAGG + Intergenic
1003209009 6:4042425-4042447 TTTAAAATGTATAAGGGGTATGG + Intronic
1004172082 6:13302928-13302950 CTGAAAATGAAGAACCTGGAGGG - Intronic
1004385829 6:15171918-15171940 TTGCAAATGAAAAGGCGGGAGGG + Intergenic
1005357448 6:24998036-24998058 TTGAAATTGAATAGGCGGTGGGG + Intronic
1007005027 6:38353380-38353402 TGAAAAATGAATAAGGGAGAGGG + Intronic
1007271215 6:40638629-40638651 CAGAAAATGAATAAGGGAGAAGG + Intergenic
1008682375 6:53886645-53886667 CTGAACTGGAATAAGCGGGATGG - Intronic
1011114371 6:83874189-83874211 TTCAAAAAAAATAAGAGGGAAGG - Intronic
1011818984 6:91228182-91228204 TTGAAAAACAACAAGTGGGATGG - Intergenic
1012271837 6:97222689-97222711 GTAAAAATGAAAAAGGGGGATGG + Intronic
1015722132 6:136253573-136253595 TTGAAAATGAATAATTAGGCCGG + Intergenic
1020618251 7:10487000-10487022 TTGAAAATGAAAAAGCAAGCGGG + Intergenic
1020783267 7:12542065-12542087 TTGAAAATTAATAAAAGGGGAGG + Intergenic
1021345601 7:19524448-19524470 CTGAAAATGAAGAAGCAGAAAGG + Intergenic
1021836978 7:24686680-24686702 ATGACAATGAATAAGAGAGAGGG - Intronic
1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG + Intronic
1022416724 7:30184741-30184763 TTGTAAATGAATGAGGGTGACGG - Intergenic
1023263660 7:38382499-38382521 TTGAAAATGAAGGAGATGGAGGG - Intergenic
1023282258 7:38583091-38583113 TTGAAAATGAATAAGCGGGATGG - Intronic
1023949519 7:44831533-44831555 TTGAAAAAAAAGAAGCGGGGGGG - Intronic
1025621861 7:63180332-63180354 TTGAAAAGGAATAAAATGGAGGG + Intergenic
1026203841 7:68238391-68238413 AAGAAAATAAGTAAGCGGGATGG + Intergenic
1026445852 7:70484197-70484219 TTGAAAATGAAAAGGATGGATGG - Intronic
1026592061 7:71705633-71705655 TTGAAAATGAATAAACAAAATGG + Intronic
1028509462 7:91607838-91607860 TTTAAAATGAATAGAAGGGAAGG + Intergenic
1028557636 7:92140534-92140556 TTGAAAATGAATAAGAAAGTTGG - Intronic
1032023062 7:128420893-128420915 TTGAAAATGAAAGCGAGGGAGGG - Intergenic
1033049779 7:137993719-137993741 TGGAAAATGGATAAGCTGGGTGG - Intronic
1033065893 7:138153603-138153625 TTGAAAAAGAATAATAGTGAGGG - Intergenic
1033304591 7:140215164-140215186 TGGAGAATGAATGAGAGGGAAGG + Intergenic
1033821690 7:145142059-145142081 TTGAATATGAAAAAACGTGATGG + Intergenic
1034075970 7:148231549-148231571 ATGAGAATGAAAAAGAGGGAGGG - Intronic
1039664972 8:39516176-39516198 TTGGAAATGAAGAAGTGTGATGG + Intergenic
1039765173 8:40620921-40620943 TTGGAAATGAATAAGCAGTAGGG - Intronic
1041768283 8:61443679-61443701 TTGAAAAAGAATAAAGTGGAAGG - Intronic
1041991287 8:63995043-63995065 TTGAAGATGAATAAGTATGAAGG + Intergenic
1042757937 8:72238236-72238258 TATAAAATGAATAATAGGGAGGG + Intergenic
1043058567 8:75471600-75471622 TTGGAAATTAATAAGAAGGAAGG - Intronic
1044560265 8:93605719-93605741 TTAAAAATGAATACGGGAGAAGG - Intergenic
1046208466 8:111036182-111036204 GTGAAAATGAATAAGAGGTCAGG + Intergenic
1050068919 9:1790281-1790303 TTGAAAATAAATGAGCTGGTAGG - Intergenic
1050228377 9:3488170-3488192 TTGAAAGAGAAAAAGAGGGAAGG + Intronic
1051481365 9:17564788-17564810 CTGAAAAGGAACAAGGGGGAAGG + Intergenic
1052464350 9:28811198-28811220 TTGATATTGAATATGCGAGATGG - Intergenic
1055760064 9:79597678-79597700 TGGCTAATGAATAAGAGGGAAGG - Intronic
1056467849 9:86876570-86876592 ATGAATATGAAGCAGCGGGAAGG - Intergenic
1058606077 9:106724849-106724871 TTGAAAAAGTATAAGCAGGCTGG + Intergenic
1059042298 9:110827822-110827844 TTAAAAATGAATAAATGGGTTGG + Intergenic
1060015638 9:120084112-120084134 TAGAAAATAAATAAGAAGGAAGG + Intergenic
1186997565 X:15140012-15140034 ATAAAGATGAATAAGCAGGAGGG + Intergenic
1187508123 X:19893689-19893711 CTGAAAAGGAAAAAGAGGGAAGG - Intergenic
1187575663 X:20551576-20551598 TTGAAAATGAAAAAGATGAAAGG + Intergenic
1191974327 X:66853537-66853559 TTGAAAATGAATCAGAGGACTGG - Intergenic
1195237995 X:102920749-102920771 TCAAAAATTAATAAGTGGGAGGG - Intergenic