ID: 1023282462

View in Genome Browser
Species Human (GRCh38)
Location 7:38585160-38585182
Sequence ATGCCATGGGGTTCTTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 178}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023282462_1023282468 10 Left 1023282462 7:38585160-38585182 CCCTCACAAGAACCCCATGGCAT 0: 1
1: 0
2: 2
3: 27
4: 178
Right 1023282468 7:38585193-38585215 ATTATTCCATTTTTACAGTGAGG No data
1023282462_1023282470 29 Left 1023282462 7:38585160-38585182 CCCTCACAAGAACCCCATGGCAT 0: 1
1: 0
2: 2
3: 27
4: 178
Right 1023282470 7:38585212-38585234 GAGGATTCTGAGAATCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023282462 Original CRISPR ATGCCATGGGGTTCTTGTGA GGG (reversed) Intronic
901112890 1:6813067-6813089 ATCCCATGGGGGAGTTGTGAGGG + Intronic
901766738 1:11504755-11504777 ATGGCATTGGCTTCTGGTGAAGG - Intronic
902125836 1:14210190-14210212 TTCCCATGCTGTTCTTGTGATGG + Intergenic
904358352 1:29956110-29956132 TTCCCATGTTGTTCTTGTGATGG + Intergenic
905283180 1:36861962-36861984 AAGCCATGGAGTCCTTGTGCAGG - Intronic
905456813 1:38094030-38094052 ATGCCACGAGGTTGTTGTGAAGG + Intergenic
905756145 1:40510909-40510931 ATGCTATGAGGTATTTGTGAGGG - Intronic
907484637 1:54768718-54768740 ATCCCATGGGGCTGTTATGAAGG + Intergenic
912109319 1:106320755-106320777 ATTCCATGGGGTTATTTTAAAGG - Intergenic
913400341 1:118424893-118424915 AATCCATAGGGTGCTTGTGAAGG + Intergenic
914981386 1:152417673-152417695 CTACCATAGGGTTGTTGTGAGGG - Intergenic
916127675 1:161585829-161585851 ATGCTTTGGGGTTCTTGATAAGG + Intronic
916137593 1:161667633-161667655 ATGCTTTGGGGTTCTTGATAAGG + Intronic
916667790 1:166982394-166982416 ATTTCATAGGGTTGTTGTGAAGG + Intronic
916777678 1:167985063-167985085 TTCCCATGCTGTTCTTGTGATGG - Intronic
917496164 1:175542020-175542042 GTGCCAGGAGGTTCTTCTGATGG - Intronic
918415523 1:184302599-184302621 AACCCTCGGGGTTCTTGTGAAGG - Intergenic
920349038 1:205325443-205325465 ATGCCATGGGGGTCACGTGAGGG + Intergenic
921975760 1:221201223-221201245 ATGGGATGGGGATCTAGTGAAGG - Intergenic
922614140 1:226951202-226951224 TTGCAAGGGGGTTCTTGTAAAGG + Intronic
922669336 1:227496980-227497002 TTCCCATGCTGTTCTTGTGACGG + Intergenic
922670256 1:227504322-227504344 TTCCCATGCTGTTCTTGTGACGG - Intergenic
924883785 1:248189925-248189947 ATTGGATGGGGTTTTTGTGAAGG - Intergenic
1062808588 10:444338-444360 ATGCCGTGGGCTCCATGTGACGG - Intronic
1064888247 10:20137290-20137312 ATATCATTGGGTTGTTGTGATGG - Intronic
1065259702 10:23911844-23911866 GAGCCATGGGGTTCTTGACAAGG - Intronic
1065935241 10:30515307-30515329 ATGCCATGGGCTTACTGTGGAGG + Intergenic
1066016119 10:31245814-31245836 GTGCCATGGGGTTCTTGAGCAGG - Intergenic
1069712963 10:70501443-70501465 AAGCCATGGGCCTCTGGTGAGGG + Intronic
1069911519 10:71762578-71762600 TTGCCATGGGGTTCTGCTGTCGG - Intronic
1070659584 10:78294932-78294954 ACCTCATGGGGTTGTTGTGAGGG + Intergenic
1073026470 10:100490489-100490511 ATGCTATGGGATTGTTTTGAAGG - Intronic
1073265869 10:102228153-102228175 AAGGAATGGGGTTCTTGGGAGGG - Intronic
1073278142 10:102330763-102330785 ATGAAATGGGATTCTTGTGAGGG + Intronic
1074286393 10:112101852-112101874 TTCCCATGCTGTTCTTGTGATGG - Intergenic
1075186868 10:120270101-120270123 GTGTCATAGGGCTCTTGTGAGGG + Intergenic
1077733768 11:4765983-4766005 ATTCCTTGGTGTTCTTGTTAAGG + Intronic
1078056813 11:8015870-8015892 ATGCCCAGGGATTCTTGGGAAGG + Intergenic
1081859670 11:46325658-46325680 CAGCCATGGGGATGTTGTGATGG + Intergenic
1082779685 11:57277265-57277287 ACGTCATAGGGTTATTGTGAGGG - Intergenic
1086208977 11:84295361-84295383 ATGCCATGTGCTTTATGTGATGG - Intronic
1086824749 11:91482882-91482904 ATGACATGGGGTTATTCTGCTGG - Intergenic
1087496392 11:98895132-98895154 TTCCCATGCTGTTCTTGTGATGG - Intergenic
1089672333 11:120065071-120065093 AGGCCATGGGCTTCCTTTGAGGG + Intergenic
1089975637 11:122729310-122729332 ATGCCACGCGGTTCTTGTTGAGG + Intronic
1090332670 11:125943853-125943875 CTGCCATGGGGTTCCTGTTCTGG + Intergenic
1090580452 11:128153325-128153347 CTACCTTAGGGTTCTTGTGAGGG - Intergenic
1091547266 12:1509842-1509864 ATGCAAAGGGGCTCTGGTGAAGG - Intergenic
1091960696 12:4691784-4691806 AAGCCATGTGGATCCTGTGAGGG + Exonic
1095702454 12:45204387-45204409 CTTCCCTGTGGTTCTTGTGATGG + Intergenic
1100819242 12:98415853-98415875 ACTGCATGGGGTTGTTGTGAGGG + Intergenic
1102609124 12:114095783-114095805 AGGCTTTGGGGTTCCTGTGAAGG + Intergenic
1107767185 13:43749014-43749036 ATGCCATAGGGTTGTTATGAAGG + Intronic
1108580114 13:51820831-51820853 ATCCCATGGGGATGTTGTGATGG + Intergenic
1110500329 13:76219915-76219937 CTGTCAAGGGGTTATTGTGATGG + Intergenic
1110559893 13:76899482-76899504 TTCCCATGCTGTTCTTGTGATGG - Intergenic
1113977181 13:114236792-114236814 ATGTCCTGGGGTTCTTCTGGAGG - Exonic
1116706723 14:48312001-48312023 ATCCTATGCTGTTCTTGTGATGG - Intergenic
1117403763 14:55381776-55381798 ATGCCATGGGGTTTCTGTCTGGG + Intronic
1117977494 14:61312731-61312753 TTCCCATGCTGTTCTTGTGATGG - Intronic
1119228354 14:72961193-72961215 GTGCCGTGGGGTTAGTGTGAGGG - Intergenic
1120617348 14:86723661-86723683 AATCCATGGGGCTCTTTTGAAGG + Intergenic
1120675039 14:87411713-87411735 TTGCCATGTGCTTTTTGTGATGG - Intergenic
1120849924 14:89160452-89160474 ACGAGATGGGGTTCATGTGAAGG - Exonic
1120860480 14:89250788-89250810 TTCCCATGCTGTTCTTGTGATGG + Intronic
1120953918 14:90064685-90064707 CTGTCACAGGGTTCTTGTGAGGG + Intronic
1126462378 15:48927540-48927562 ATGCCAGGGGTTTCATGTGGTGG - Intronic
1129230737 15:74195969-74195991 AGGCCCTGGGGTTGGTGTGATGG - Intronic
1131851830 15:96551698-96551720 ATCTCATAGGGTTCTTGTGAAGG + Intergenic
1131851901 15:96552647-96552669 ATCTCACAGGGTTCTTGTGAAGG - Intergenic
1138160976 16:54754097-54754119 ACCCCATGCTGTTCTTGTGATGG - Intergenic
1138808079 16:60115970-60115992 ATGTCATAGCGTTCTTGTTAGGG + Intergenic
1145282443 17:21477852-21477874 ATCTCACGGGGTTGTTGTGAGGG + Intergenic
1145395027 17:22487903-22487925 ATCTCACGGGGTTGTTGTGAGGG - Intergenic
1146454636 17:32999358-32999380 TTGCCAAGGGGTTGTTGTTATGG + Intergenic
1147205772 17:38836290-38836312 GTGCCATGGGGTTAGTGTGAGGG + Intronic
1148932040 17:51134880-51134902 ATCTCATAGGGTTTTTGTGAAGG + Intergenic
1149337093 17:55646519-55646541 ATCCCATAGGGTTTTTGTGAAGG - Intergenic
1152005649 17:77678687-77678709 ACTCCATGGGGATGTTGTGAGGG + Intergenic
1153946039 18:10018319-10018341 AGGCCATGGTGTGATTGTGAAGG + Intergenic
1155076032 18:22356331-22356353 ACCTCATGGGGTTGTTGTGAAGG - Intergenic
1156233201 18:35175015-35175037 ATCTCAAGGGGTTGTTGTGAAGG - Intergenic
1157481161 18:48054657-48054679 ATGCCAGGCGGTTCTCGTGGTGG - Intronic
1157960115 18:52144027-52144049 TTCCCATGCTGTTCTTGTGATGG + Intergenic
1158835328 18:61324893-61324915 AACTCATGGGGTTCTTATGAGGG - Intergenic
1159548130 18:69866619-69866641 ATGTCATAAGGTTATTGTGATGG - Intronic
1160757090 19:763524-763546 CTGCCATGGCGTTCTTGTGACGG - Exonic
1163829658 19:19541557-19541579 ATGCCAGGGGGCTCTTGTGCAGG + Intronic
1164357539 19:27457932-27457954 ATGCAAAGGGGTAATTGTGAGGG + Intergenic
1164503861 19:28841885-28841907 AACACATGGGGTTCTTGTGAGGG + Intergenic
1164523432 19:28996219-28996241 TTGCCTTGCTGTTCTTGTGATGG - Intergenic
1164926028 19:32130646-32130668 ATGCTGTGGGGTTTATGTGAGGG - Intergenic
1165147707 19:33742184-33742206 ATGCCATGGGGTTCTTCTTGGGG + Intronic
1166410176 19:42551416-42551438 TTCCCATGCTGTTCTTGTGATGG + Intronic
1168635375 19:57992067-57992089 ATTCCATTGGGGTCTTGGGAGGG - Intronic
926922521 2:17953048-17953070 ATGCCTTGTGGCTTTTGTGAAGG - Intronic
928467355 2:31534834-31534856 ATGCCCTGGGCTTCATGTCAGGG + Intronic
928738544 2:34322025-34322047 AATCCATGGGGTCGTTGTGAAGG + Intergenic
929485838 2:42353466-42353488 ATGGCAAGGGGTTCTTGACAGGG - Intronic
930081322 2:47451356-47451378 TTCCCATGCCGTTCTTGTGATGG - Intronic
930754440 2:54960563-54960585 TTGTCATGAGGTTTTTGTGAGGG + Intronic
930930188 2:56873367-56873389 CTTCCCTGGAGTTCTTGTGAAGG - Intergenic
934496293 2:94803587-94803609 ATGCCAGGGTTTTCTTCTGAGGG - Intergenic
934952997 2:98592068-98592090 ATGCCATCGTGTTCCTGGGATGG + Intronic
935843109 2:107135013-107135035 ATGCCATAGGGATTTTGTTAGGG + Intergenic
935902195 2:107805108-107805130 CTGCCATGGGGGTTTTGTGAGGG - Intergenic
936145248 2:109976371-109976393 ATCTCACGGGGTTATTGTGAGGG - Intergenic
936199437 2:110395107-110395129 ATCTCACGGGGTTATTGTGAGGG + Intergenic
936688745 2:114860358-114860380 ATGCCATGGAGTTTATGTTACGG - Intronic
937378819 2:121357053-121357075 ATGCCATGGGTTTTTAGAGATGG - Intronic
937469707 2:122164755-122164777 ATGCCATTGGGTAGGTGTGAGGG + Intergenic
938988466 2:136603268-136603290 TTCCCATGCTGTTCTTGTGATGG - Intergenic
939182516 2:138820549-138820571 ATGTCTTGGGGTTGGTGTGAAGG + Intergenic
939637602 2:144601675-144601697 ATGCCACATGGTTCTTCTGATGG - Intergenic
940084968 2:149848865-149848887 ATGCCTTGGGGGACTTGGGAAGG + Intergenic
943277171 2:185882261-185882283 AAGTCATGGGCTTCTTGTGGAGG + Intergenic
1169947061 20:11000231-11000253 ATGCCTTGGGGTTCATGTCCAGG + Intergenic
1173566325 20:44041001-44041023 CTGAGATGGGGTTCTTGTGAAGG + Intronic
1175343587 20:58252165-58252187 ATGTCATAGGATTCTTGGGAAGG - Intergenic
1176193932 20:63828249-63828271 AGGCCATGGGGTCCATGGGAGGG - Intronic
1182815030 22:33154895-33154917 TTCCCATGCTGTTCTTGTGATGG + Intergenic
1184387770 22:44186095-44186117 ATCCCATGGGGTTGCTGGGATGG - Intronic
949665130 3:6330586-6330608 TTCCCATGCTGTTCTTGTGATGG + Intergenic
951091928 3:18584272-18584294 TTCCCATGCTGTTCTTGTGATGG - Intergenic
952322516 3:32291493-32291515 ATCTCATGGGGTTGTTTTGAGGG - Intronic
955649153 3:61174833-61174855 TTGCAATGGGATACTTGTGAGGG + Intronic
957136799 3:76298649-76298671 ATCCCATGAGGTTGTTTTGAGGG - Intronic
957502290 3:81072736-81072758 ATCCCATGCTGTTCTTGTGATGG - Intergenic
961651021 3:128416657-128416679 ATGTCATGGGGTTCTTTTGCTGG + Intergenic
965203500 3:165692017-165692039 TTCCCATGCTGTTCTTGTGATGG - Intergenic
967146721 3:186612709-186612731 ATGCCATGGGGTCTGTGAGAGGG - Intergenic
969540337 4:7784615-7784637 CTGCCCTGGGGTTCCTGTGGGGG - Intronic
975049233 4:69839264-69839286 ATGCCATTGGCATCTGGTGAGGG + Intronic
977578162 4:98696618-98696640 ATGCCATGGGGTTCTGAGGAAGG + Intergenic
978892062 4:113841698-113841720 ACCCCATTGGGTTCTTGTGAGGG - Intergenic
978994490 4:115132749-115132771 TTCCCATGTTGTTCTTGTGATGG + Intergenic
979502846 4:121459987-121460009 ATTCCATAGGGTTCTTGTAAGGG + Intergenic
979825260 4:125225332-125225354 TTGCAATGGGCATCTTGTGAGGG - Intergenic
984886125 4:184451455-184451477 ACCCCATGGGGTTACTGTGAGGG - Intronic
987280270 5:16406742-16406764 AAGCCATGTGGGTCTTGTGATGG - Intergenic
987927225 5:24358186-24358208 ATGCCATTGGGTTTTTGATAGGG + Intergenic
993293666 5:86108003-86108025 TTCCCATGCTGTTCTTGTGATGG + Intergenic
993809808 5:92462294-92462316 ATGTCATTGGGTTGTTGTGAAGG + Intergenic
994652828 5:102550531-102550553 TTCCCATGCTGTTCTTGTGATGG - Intergenic
994694566 5:103057934-103057956 TTTCCATGGTGTTCTTGTGATGG - Intergenic
996396736 5:123021249-123021271 ACCCCTTGTGGTTCTTGTGAAGG - Intronic
996515827 5:124368326-124368348 TCCCCATGGGGTTATTGTGAGGG + Intergenic
998818551 5:146037192-146037214 ACCTCATGAGGTTCTTGTGAGGG - Intronic
999428971 5:151509978-151510000 CTGCCATGGGCTCCTTGTTAGGG - Intronic
1000083552 5:157869371-157869393 TTCCCATGCTGTTCTTGTGATGG + Intergenic
1000766791 5:165301568-165301590 TTCCCATGCTGTTCTTGTGATGG + Intergenic
1001001990 5:168016149-168016171 ATCCCATAGGGTTGTTGTGAGGG - Intronic
1005809708 6:29506448-29506470 GTGCCATGGGCTGTTTGTGACGG + Intergenic
1006006432 6:31005736-31005758 ACTTCATGGGGTTATTGTGAAGG + Intergenic
1006437756 6:34035069-34035091 GTCCCATGGGGATCTTGTGAGGG + Intronic
1007660257 6:43480105-43480127 ATCGCATAGGGTTGTTGTGAAGG + Intronic
1007892102 6:45304948-45304970 AGGCCATGGTGTTCTTGAGTTGG - Intronic
1008411047 6:51180193-51180215 TTCCCATGCTGTTCTTGTGATGG + Intergenic
1008870072 6:56262394-56262416 ATGTCATTGGCTTATTGTGAGGG - Intronic
1010180796 6:73084769-73084791 GTGCCCTTGGGTTCTTGTGTGGG + Intronic
1011724767 6:90198908-90198930 TTCCCATGCTGTTCTTGTGACGG + Intronic
1013661095 6:112297876-112297898 TTCCCATGCTGTTCTTGTGATGG - Intergenic
1017237038 6:152127327-152127349 ATGTCATGGGATTCTTGTGAGGG + Intronic
1019115693 6:169760160-169760182 ATGCCCTGGGGTTGTTGTGGGGG + Intronic
1020835649 7:13147162-13147184 ACTTCATGGGGTTGTTGTGAGGG - Intergenic
1021093846 7:16512638-16512660 ACGTGATTGGGTTCTTGTGAGGG - Intronic
1021192863 7:17642697-17642719 TTCCCATGTTGTTCTTGTGATGG + Intergenic
1023282462 7:38585160-38585182 ATGCCATGGGGTTCTTGTGAGGG - Intronic
1024709799 7:52002730-52002752 ATGCCAGTGGGTTCATTTGATGG + Intergenic
1027172154 7:75880018-75880040 ACGTCATGGGATCCTTGTGAGGG - Intronic
1030196358 7:106857452-106857474 AAGCCATGGTGTTCCTGAGAAGG - Intergenic
1031282442 7:119820630-119820652 ATGCCATTGGGATGTTGAGAAGG + Intergenic
1031717543 7:125126867-125126889 ACGCCATGGGGAGCTTGTGGAGG - Intergenic
1032738081 7:134711150-134711172 TTGCCTCGGGGTTCCTGTGAGGG + Intergenic
1034490048 7:151388382-151388404 TTGACCTGGGGTCCTTGTGAAGG - Intronic
1034966465 7:155394527-155394549 ATGCCATGGGGTCATGGTGGCGG - Intronic
1035259436 7:157652339-157652361 TTCCCCTGGGGTTCCTGTGAGGG - Intronic
1036390489 8:8320281-8320303 GTGCCCTGGGGTTCCTCTGAGGG - Intronic
1037797759 8:22010652-22010674 ATGCCCTAGGGTTCGTGGGAGGG + Intergenic
1039779094 8:40766152-40766174 ATGCCAAGGGGCTCTGGTCAGGG - Intronic
1044261671 8:90131921-90131943 AAAACATGAGGTTCTTGTGAGGG + Intergenic
1045000279 8:97872155-97872177 ATGTCATAGGGTTGTTGTAAGGG + Intronic
1045047916 8:98296387-98296409 ATGCCATGGGGTTATGGGGGAGG + Intergenic
1046917682 8:119694288-119694310 ATGTCATGAGGTTCTTGTATTGG - Intergenic
1047565717 8:126041360-126041382 TTCCCATGCTGTTCTTGTGATGG + Intergenic
1049255660 8:141612319-141612341 ATGCCCTGGGGCACTTGTCAGGG + Intergenic
1049423330 8:142526389-142526411 AGGCACTGGGGTTCCTGTGATGG + Intronic
1050394970 9:5186032-5186054 ATGACAGGGGGTTTCTGTGAGGG - Intergenic
1057476761 9:95409525-95409547 ATACCATGGGGTTATTCTGAGGG - Intergenic
1057766061 9:97920310-97920332 TTTCCATGAGGTTCTTGTGCTGG - Intronic
1058323203 9:103659377-103659399 CTCCCATGCTGTTCTTGTGATGG + Intergenic
1060049764 9:120369916-120369938 ACCCCATGGGGTTGTTGAGATGG + Intergenic
1060699352 9:125737363-125737385 ATCTCATAGGGTTGTTGTGAAGG + Intergenic
1061689919 9:132318921-132318943 ATGTGATTGGGTTCTTGGGATGG - Intronic
1062512422 9:136914139-136914161 GTGCCCTAGGGTTCCTGTGAGGG - Intronic
1186657695 X:11633018-11633040 ATCCCACGGGGTGCTTGGGAGGG - Intronic
1187023964 X:15413411-15413433 ATGCCATGAGGTTCTTGATGAGG - Intronic
1187144951 X:16628988-16629010 GCCTCATGGGGTTCTTGTGAGGG - Intronic
1188393720 X:29654575-29654597 TTCCCATGCTGTTCTTGTGATGG - Intronic
1188610333 X:32088254-32088276 ATCTCATGGGGTTCATGTGAAGG - Intronic
1189040906 X:37541951-37541973 AAGGCATGGGCTTATTGTGAGGG - Intronic
1191880612 X:65841063-65841085 TTCCCATGGGGTACTGGTGAAGG + Intergenic
1194358795 X:92920733-92920755 CTGACATTTGGTTCTTGTGAAGG + Intergenic
1195004489 X:100672456-100672478 ACCTCATAGGGTTCTTGTGAAGG - Intergenic
1197861643 X:130977634-130977656 AGGCCCTGGGGTTCATGTAAAGG - Intergenic
1197969920 X:132104070-132104092 ATCTCATAGGGTTGTTGTGAGGG + Intronic
1198847175 X:140924697-140924719 TTCCCATGCTGTTCTTGTGATGG - Intergenic
1200666960 Y:6036427-6036449 CTGACATTTGGTTCTTGTGAAGG + Intergenic