ID: 1023282522

View in Genome Browser
Species Human (GRCh38)
Location 7:38585686-38585708
Sequence GGAAAATTCCACTGGCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023282522_1023282527 13 Left 1023282522 7:38585686-38585708 CCACCGTGCCAGTGGAATTTTCC 0: 1
1: 0
2: 0
3: 3
4: 122
Right 1023282527 7:38585722-38585744 TAGGCTATTTAAATGCAGCAAGG No data
1023282522_1023282525 -6 Left 1023282522 7:38585686-38585708 CCACCGTGCCAGTGGAATTTTCC 0: 1
1: 0
2: 0
3: 3
4: 122
Right 1023282525 7:38585703-38585725 TTTTCCTGTCTACTCTTAATAGG 0: 1
1: 0
2: 2
3: 55
4: 660
1023282522_1023282528 14 Left 1023282522 7:38585686-38585708 CCACCGTGCCAGTGGAATTTTCC 0: 1
1: 0
2: 0
3: 3
4: 122
Right 1023282528 7:38585723-38585745 AGGCTATTTAAATGCAGCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023282522 Original CRISPR GGAAAATTCCACTGGCACGG TGG (reversed) Intronic
900370694 1:2330845-2330867 GGAGAATTCCACAGGAACGGTGG - Intronic
905236274 1:36551756-36551778 GGAAAATTACACTGGATGGGAGG - Intergenic
905545219 1:38792367-38792389 GGAAACTTCCACTCCCACTGAGG + Intergenic
906077129 1:43060241-43060263 GAAAAATTACATTAGCACGGAGG - Intergenic
907531901 1:55107687-55107709 CAAAAATTACACGGGCACGGTGG + Intronic
912162811 1:107006985-107007007 GGAAAAGTCCAATTGCAGGGTGG - Intergenic
913189691 1:116403033-116403055 GGAAAATTACACTGAAAAGGGGG + Intronic
915971237 1:160356673-160356695 GGCAAATTTGACTGGCACAGTGG + Exonic
924567114 1:245208126-245208148 AGAAAATTTCCCTGGCACAGAGG - Intronic
1063247383 10:4236077-4236099 AGAAATTTCCACTGGCACTCTGG + Intergenic
1063796327 10:9517474-9517496 GCAAAATTCCACAGACAAGGTGG - Intergenic
1063949310 10:11207604-11207626 GGAAACTTACACTGGCAGCGTGG - Intronic
1064119115 10:12604002-12604024 GGATATGGCCACTGGCACGGTGG - Intronic
1065558268 10:26937620-26937642 GGACGAGTCCACTGGCAGGGCGG - Intergenic
1070682703 10:78459982-78460004 GGAAATTTCCCCTGTCACTGGGG - Intergenic
1070757301 10:79001283-79001305 TGAAAATCCCACAGGCATGGGGG + Intergenic
1073796640 10:106995543-106995565 GCAAAATTCCACAGCCACGCAGG - Intronic
1073882490 10:107999562-107999584 TGAAAATGCCACTGCCACTGTGG + Intergenic
1075901833 10:126049416-126049438 GGAAAAATCCAGTGTCAAGGAGG - Exonic
1076457000 10:130607229-130607251 GGGCAATTCTTCTGGCACGGTGG + Intergenic
1077210329 11:1368187-1368209 GGTAAATTGACCTGGCACGGCGG + Intergenic
1077656838 11:4027599-4027621 GGCCAATTCCCCAGGCACGGTGG - Intronic
1077675880 11:4192608-4192630 GGATAATTCCAATGGAAGGGAGG - Intergenic
1080498084 11:32841509-32841531 GGAAAATTTGCCTGGCATGGTGG + Intronic
1080630778 11:34073574-34073596 AGAAAATTAGACTGGCATGGTGG - Intronic
1081758714 11:45562208-45562230 GGAAAATTCCTGTGGGATGGGGG - Intergenic
1081761880 11:45582317-45582339 GGAAGACTGCACTGGCACAGGGG + Intergenic
1084129608 11:67123120-67123142 TGAAAATTACCCTGGCATGGTGG - Intronic
1093850115 12:24026382-24026404 AGAAAATCCCACTGGTACTGTGG + Intergenic
1097416072 12:59317900-59317922 GGAAAATTCCACTGGGGCCCAGG - Intergenic
1102530031 12:113539469-113539491 TGAAGATTCCACTGGGACTGGGG - Intergenic
1106458642 13:29949017-29949039 GGAAAACCCCACTGGCAGGAAGG + Intergenic
1106814713 13:33394737-33394759 AGTACATTCCACTGGCACAGAGG + Intergenic
1106906646 13:34416308-34416330 GGCAAATTCCACTCTCACTGTGG - Intergenic
1111082557 13:83330588-83330610 GGAAAATTTGTCTGGCATGGTGG + Intergenic
1111436266 13:88212483-88212505 GCAAAATCCCACTGACAAGGTGG + Intergenic
1111875054 13:93882430-93882452 GGAAAACTGCCCAGGCACGGTGG - Intronic
1115989293 14:39135431-39135453 GGAAAATTAGCCGGGCACGGTGG + Intronic
1122432711 14:101666076-101666098 GCAAAATTCCACAGGCTGGGTGG + Intergenic
1122496688 14:102161642-102161664 TGAAAATTCCACAGGTACAGTGG + Intronic
1122563287 14:102632565-102632587 GAAAAATTCCCCTTGCAGGGGGG - Intronic
1124973779 15:34514913-34514935 GGAAAATGGCAAGGGCACGGAGG + Intergenic
1127550361 15:60031667-60031689 GCAAAATACCACAGGCAGGGTGG - Intronic
1128254443 15:66186409-66186431 GGCAAATTCCAATGGCTTGGGGG - Intronic
1128961619 15:72012445-72012467 GGAAAATTAGCCTGGCATGGTGG - Intronic
1130704928 15:86224192-86224214 GGAAAACTTCACTGGCATTGAGG - Intronic
1131459075 15:92605788-92605810 AGAACATTCCAGTGGCAAGGGGG + Intergenic
1133213638 16:4277200-4277222 AAAAAATTAGACTGGCACGGTGG + Intergenic
1135079818 16:19424494-19424516 CGAAAATTAGACGGGCACGGTGG + Intronic
1137409683 16:48217441-48217463 GGAAAATTAGCCAGGCACGGGGG + Intronic
1138611308 16:58127434-58127456 TCCAAATTCCACTGGCACAGAGG + Intronic
1140532909 16:75682574-75682596 GGAAAATTCCACTGGGGCCTAGG - Intronic
1145230684 17:21171363-21171385 GGAACATGCCACAGGCACAGCGG + Intronic
1146190057 17:30757040-30757062 GGAAAATTAACCTGGCATGGTGG + Intergenic
1146334958 17:31961392-31961414 GGAAAATTAACCTGGCATGGTGG + Intronic
1146946110 17:36874748-36874770 GGAAAATACCACTCTCAGGGTGG + Intergenic
1149467719 17:56892953-56892975 GGAACATTTCACTGGCAGGCTGG + Intronic
1160936564 19:1598948-1598970 GGAAGATGCCACAGGCACTGTGG + Intronic
925367266 2:3319336-3319358 GGAAAAGGCCAATGGCACAGAGG + Intronic
926546852 2:14252097-14252119 CAAAAATTACCCTGGCACGGTGG - Intergenic
932149704 2:69359129-69359151 GGACAATTCCAAGGGCACGGTGG - Intronic
932688572 2:73893631-73893653 AGAAAATTCCACTTGCCCTGTGG + Intronic
933613017 2:84456947-84456969 GGAAAAGTGGCCTGGCACGGTGG - Intronic
933771826 2:85749509-85749531 GGCAGATTCCACTTGCAAGGAGG + Intergenic
933988215 2:87611843-87611865 GATCACTTCCACTGGCACGGTGG + Intergenic
935724409 2:106010444-106010466 GCAAAGTTCCACTGCCACAGCGG - Intergenic
936305625 2:111338965-111338987 GATCACTTCCACTGGCACGGTGG - Intergenic
940419698 2:153465611-153465633 GGAAAATTAAACTGGCTCAGAGG - Intergenic
944207276 2:197169842-197169864 GGTATATTCCACTGGCTCTGAGG + Intronic
945784738 2:214218846-214218868 GGTAAATTACACTGGGATGGAGG - Intronic
947879179 2:233490313-233490335 AAAAAATTCACCTGGCACGGTGG - Intronic
1173633612 20:44535351-44535373 GAAAAATTGGCCTGGCACGGTGG + Intronic
1174455565 20:50646278-50646300 CAAAAATTCCCCTGGCATGGTGG - Intronic
1177689873 21:24492093-24492115 TGAACTTTCCACTGGCACTGAGG + Intergenic
1183886159 22:40884480-40884502 GAAAAATTCCCCGGGCATGGTGG - Intronic
955909411 3:63844889-63844911 GGAAAATTGTACTGGCAGTGTGG + Intronic
956576132 3:70754745-70754767 TGAAAATGCCACTGGCACTGGGG - Intergenic
962270056 3:133971037-133971059 GGCAAATGCCACTGGCATGTGGG + Intronic
969236516 4:5869238-5869260 GGAAAATTGCCAAGGCACGGTGG - Intronic
970600384 4:17637179-17637201 CAAAAATTTCCCTGGCACGGTGG - Intronic
971197369 4:24482431-24482453 GGTAAATTCCCCTGGCCCGTGGG - Intergenic
976116414 4:81733084-81733106 GGGAAATTTGACTGGCAGGGAGG + Intronic
977526305 4:98150158-98150180 GGAAAGATCCACTGGAAGGGAGG - Intergenic
981966671 4:150612053-150612075 CAAAAATTCCCCTGGCATGGTGG - Intronic
982975899 4:162059649-162059671 GGAAAAGTCCAAAGGCACAGTGG + Intronic
984103472 4:175515571-175515593 AGAAAATTACACAGGCATGGTGG + Intergenic
998112549 5:139513467-139513489 GAAAAATTAGCCTGGCACGGTGG - Intergenic
999553942 5:152720766-152720788 GGAAACCTCCACTGGCAGAGAGG + Intergenic
1000778906 5:165454740-165454762 GGAAAATTAGCCTGGCATGGTGG + Intergenic
1001592749 5:172877654-172877676 GGAAAATGACACTGTCACAGGGG - Intronic
1002399062 5:178981134-178981156 GTAGGATTCCTCTGGCACGGAGG - Exonic
1006682069 6:35804528-35804550 GGAAAATTCCACTGGGCGTGGGG - Intergenic
1008539470 6:52534226-52534248 ATAAAATTAGACTGGCACGGTGG + Intronic
1009282359 6:61769161-61769183 AAAAAATTCCACTGGGAGGGAGG + Intronic
1013165877 6:107591544-107591566 GGAAAATAGCACAGGCATGGAGG + Intronic
1013711142 6:112900476-112900498 GAAAAATTCACCTGGCATGGTGG - Intergenic
1016551171 6:145281763-145281785 CAAAAATTCACCTGGCACGGTGG - Intergenic
1016574149 6:145548909-145548931 GGAAAATTCTACTGCTAAGGAGG + Intronic
1020697392 7:11430616-11430638 TGAAAATTCGCCTGGCATGGTGG - Intronic
1020747293 7:12093292-12093314 AGAAAATTCAACTGGCATTGGGG - Intergenic
1020858704 7:13460736-13460758 AGAAAATTACCCTGGCATGGTGG + Intergenic
1023282522 7:38585686-38585708 GGAAAATTCCACTGGCACGGTGG - Intronic
1026987918 7:74566493-74566515 GGAAAATTAGCCTGGCATGGTGG - Intronic
1030916212 7:115317004-115317026 GGAATATTTCACTGACACTGTGG - Intergenic
1032808104 7:135378696-135378718 GGAAAATTAGCCGGGCACGGTGG + Intronic
1033125029 7:138699885-138699907 GGCAAATTCCCCTGACACCGGGG - Intronic
1035339397 7:158150870-158150892 GGATAATTCCACCAGCACGTTGG - Intronic
1037124313 8:15327054-15327076 GGAAAATACCAGAGGGACGGAGG - Intergenic
1037197469 8:16208330-16208352 CGAAAATTACCCCGGCACGGTGG - Intronic
1039707541 8:40022884-40022906 GAAAAATTACTCTGGCATGGTGG - Intergenic
1039903117 8:41767121-41767143 GGAAAATTCCTCTGGCCTGAAGG - Intronic
1040740635 8:50570755-50570777 CAAAAATTCTACAGGCACGGTGG - Intronic
1041360048 8:57043251-57043273 GGAAAAATCAAGTGGCACTGGGG + Intergenic
1042207388 8:66343160-66343182 AAAAGATTCCACTGGCACAGTGG + Intergenic
1042905008 8:73763441-73763463 GGAAAGCTCAACTGGCACGTAGG + Intronic
1043329108 8:79091608-79091630 AGAAAATTCCAGTTGCACTGTGG + Intergenic
1047384533 8:124396704-124396726 GAAAAATTAGACTGGCATGGTGG - Intergenic
1047902598 8:129440386-129440408 AGAAAATTCAACTGGAAAGGTGG - Intergenic
1048956641 8:139542971-139542993 GAAAAAGTCCACAGGCACAGAGG - Intergenic
1052395857 9:27937099-27937121 GTAAAATACCACAGGCTCGGTGG - Intergenic
1053426448 9:38013449-38013471 AGAAAATTAGCCTGGCACGGTGG + Intronic
1057819127 9:98317784-98317806 GGTACATTCCAGTGGAACGGGGG + Intronic
1059006309 9:110406841-110406863 GTAACATTCCACTGTCACGAGGG - Exonic
1060095923 9:120790329-120790351 AAAAAATTCCCCTGGCATGGTGG + Intronic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1196337350 X:114552999-114553021 GAAAACTCCCACTGGCACAGTGG + Intergenic