ID: 1023282743

View in Genome Browser
Species Human (GRCh38)
Location 7:38588263-38588285
Sequence CTATTAATTAAGATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 207}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023282740_1023282743 -6 Left 1023282740 7:38588246-38588268 CCTGGCCTTATTAATTACTATTA 0: 1
1: 1
2: 3
3: 47
4: 477
Right 1023282743 7:38588263-38588285 CTATTAATTAAGATGGAAGATGG 0: 1
1: 0
2: 2
3: 24
4: 207
1023282736_1023282743 30 Left 1023282736 7:38588210-38588232 CCCAAAATGCTAGGATTACAGGC 0: 859
1: 27058
2: 259919
3: 279715
4: 216306
Right 1023282743 7:38588263-38588285 CTATTAATTAAGATGGAAGATGG 0: 1
1: 0
2: 2
3: 24
4: 207
1023282739_1023282743 -1 Left 1023282739 7:38588241-38588263 CCACGCCTGGCCTTATTAATTAC 0: 1
1: 1
2: 15
3: 133
4: 1040
Right 1023282743 7:38588263-38588285 CTATTAATTAAGATGGAAGATGG 0: 1
1: 0
2: 2
3: 24
4: 207
1023282737_1023282743 29 Left 1023282737 7:38588211-38588233 CCAAAATGCTAGGATTACAGGCG 0: 342
1: 13623
2: 161773
3: 297514
4: 240959
Right 1023282743 7:38588263-38588285 CTATTAATTAAGATGGAAGATGG 0: 1
1: 0
2: 2
3: 24
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023282743 Original CRISPR CTATTAATTAAGATGGAAGA TGG Intronic
901173425 1:7280644-7280666 CTATTTATTAAACAGGAAGAAGG - Intronic
905938694 1:41845221-41845243 ATATTATTTAAAATGGAAGGTGG - Intronic
906420770 1:45664986-45665008 CTGTTAAAAAAGATGAAAGATGG + Intronic
906644914 1:47467740-47467762 CTATTAATTCAGCTGGGAAAGGG - Intergenic
907348995 1:53810755-53810777 CTACTAATCATGATGGCAGATGG + Intronic
907806092 1:57821796-57821818 CTCTTAAAAAAAATGGAAGAAGG - Intronic
908623472 1:66012734-66012756 CTATTATTTAACATGGCAAAAGG - Intronic
908769615 1:67584059-67584081 CAATCATTGAAGATGGAAGATGG + Intergenic
910041278 1:82854640-82854662 CTTATAATTATGCTGGAAGAAGG - Intergenic
911037011 1:93561208-93561230 ATATTATTTAAAATAGAAGAAGG + Intergenic
912153353 1:106885156-106885178 AGAATAATTAACATGGAAGAAGG + Intergenic
912670021 1:111616887-111616909 CTATTAAAGGAGATAGAAGAAGG - Intronic
913646908 1:120865721-120865743 CTATTAACAAAGAAGGAAGAGGG + Intergenic
914079740 1:144397142-144397164 CTATTAACAAAGAAGGAAGAGGG - Intergenic
914174641 1:145265680-145265702 CTATTAACAAAGAAGGAAGAGGG - Intergenic
914529368 1:148507168-148507190 CTATTAACAAAGAAGGAAGAGGG - Intergenic
916344031 1:163768220-163768242 CTATTAACTTGGATGCAAGAGGG - Intergenic
916636093 1:166670314-166670336 ATATTAATTGATACGGAAGAAGG + Intergenic
917127569 1:171701691-171701713 ATATTATATAAGATGGAGGAAGG - Exonic
917616768 1:176753888-176753910 CCATAAAATAAGAAGGAAGAAGG + Intronic
917750900 1:178052551-178052573 CTATAAATTAAGGAGCAAGATGG + Intergenic
918531495 1:185527245-185527267 CTCTTAATTATGAAGTAAGATGG + Intergenic
919486047 1:198148354-198148376 ATTTTAAATAAGATGGTAGACGG - Intergenic
921228014 1:213039658-213039680 CTGTTAATTAACATGGAAAATGG - Intergenic
921982225 1:221271370-221271392 ATATTAATTAACCTTGAAGAAGG + Intergenic
923831878 1:237567203-237567225 CTATTAAGTTGGATGGAAGCTGG + Intronic
1063617766 10:7616524-7616546 CTTTTAATTAAAATGGAACATGG + Intronic
1063673515 10:8118993-8119015 ATATTATTTAAGACTGAAGAAGG - Intergenic
1063908287 10:10803013-10803035 ATATAAATTAAGACGGAAAATGG - Intergenic
1066536512 10:36397880-36397902 CTATTACTTAAGTTAGAAAATGG - Intergenic
1068354494 10:55894254-55894276 CTTTTAATTAAGATAGGAGAAGG + Intergenic
1068382648 10:56277056-56277078 CTATCAATTCAGAGGGAAAAAGG + Intergenic
1071434079 10:85630587-85630609 CAATTTATAAAAATGGAAGAGGG + Intronic
1072007144 10:91263011-91263033 CTATAAACAAAGATGGAAGGGGG + Intronic
1073304173 10:102489952-102489974 CTCCTCATTAAGATGGTAGAAGG + Intronic
1073716076 10:106108877-106108899 CTCTTAATAAATAGGGAAGAGGG - Intergenic
1075314889 10:121444896-121444918 CTATTAATTAAGGTAGCAGATGG - Intergenic
1076046361 10:127297177-127297199 CCATTAATGGAGATGGAAGGAGG + Intronic
1078195930 11:9137236-9137258 ATAAAAGTTAAGATGGAAGAAGG + Intronic
1079065196 11:17285078-17285100 CCATTAATTGAAAAGGAAGAGGG + Intronic
1080060669 11:27953429-27953451 TAATTAATGAAGAAGGAAGAAGG + Intergenic
1080421391 11:32114045-32114067 CTTTTAATTCACATGGAAGCTGG + Intergenic
1081235183 11:40638609-40638631 CATTTAATTAAGATTGAAAATGG - Intronic
1082569636 11:54722350-54722372 CTAGTTTTGAAGATGGAAGAGGG + Intergenic
1086941411 11:92801948-92801970 TTATAAAGAAAGATGGAAGATGG + Intronic
1087457950 11:98410965-98410987 CTAAGAGTGAAGATGGAAGAGGG - Intergenic
1088045201 11:105442926-105442948 ATAATAAATAAGATTGAAGAGGG + Intergenic
1088356307 11:108947587-108947609 CTAATAAATTGGATGGAAGATGG - Intergenic
1094308730 12:29053015-29053037 TTATTGATAAAGATAGAAGATGG + Intergenic
1095238097 12:39822900-39822922 CGATAAATTAATATGGACGAGGG + Intronic
1095531881 12:43197169-43197191 GTAATTATTAATATGGAAGAAGG + Intergenic
1095916854 12:47488336-47488358 CTATTAATTAAGGCTCAAGATGG - Intergenic
1098050401 12:66446834-66446856 CTATTCATTTTGAAGGAAGATGG - Intronic
1098445702 12:70563764-70563786 CCATTAATTGAGATAGAAGAAGG - Intronic
1098683212 12:73384359-73384381 ATGTTAAATAAAATGGAAGAGGG - Intergenic
1098847010 12:75550186-75550208 CTTAGAATTTAGATGGAAGAGGG - Intergenic
1099579522 12:84425717-84425739 TTATTATTTAAGATGGGAAAGGG + Intergenic
1099767815 12:87012070-87012092 CTAGTAAATAAGTGGGAAGAAGG - Intergenic
1100112922 12:91267610-91267632 ATATTTATTAAGATGAAATATGG - Intergenic
1100277120 12:93081532-93081554 GCATTAATTAAGATGCAAAATGG + Intergenic
1106786441 13:33112741-33112763 CAATAAATTAAGATGAAAGAGGG + Exonic
1106932061 13:34677095-34677117 CTAGTAATTAATAAGGAGGAGGG - Intergenic
1109786360 13:67180727-67180749 CTATTAATTCTGAAGGTAGAAGG - Intronic
1110202056 13:72863229-72863251 CCATAAATTAAGATGGAAGAAGG + Intronic
1111079341 13:83281350-83281372 CAAATAATTATGATGGAGGAAGG + Intergenic
1111860078 13:93692614-93692636 CTAAAATTTAAGATGGTAGAAGG - Intronic
1112747829 13:102547415-102547437 TTTTTTCTTAAGATGGAAGAAGG - Intergenic
1114040282 14:18672064-18672086 CTACTAGTTGAGATTGAAGATGG + Intergenic
1114133796 14:19823461-19823483 TTAATATTTAAAATGGAAGATGG + Intronic
1114389072 14:22286407-22286429 CTAGTTTTGAAGATGGAAGAGGG - Intergenic
1114556069 14:23563013-23563035 TATTTAATTAAGATGGAAAAGGG + Intronic
1116398587 14:44476768-44476790 AAATTAAGAAAGATGGAAGATGG - Intergenic
1116756310 14:48953029-48953051 ATATCAATTAAGAAGGAAAAAGG - Intergenic
1118234675 14:63991683-63991705 CTATTAATTAACATGGTGGGAGG + Intronic
1120385076 14:83834582-83834604 CTATCCATGAAGAAGGAAGAGGG - Intergenic
1120603027 14:86536355-86536377 CTATTAATTGAGTTGGGAGAGGG + Intergenic
1124060819 15:26292254-26292276 CTAATGATTAAGGTGGAACAAGG + Intergenic
1124243123 15:28047532-28047554 CTTATGCTTAAGATGGAAGATGG - Intronic
1124864826 15:33478762-33478784 CTATTAAGAAAGGTGGAAGTTGG - Intronic
1125419412 15:39489117-39489139 CTAGTAAGGAAGAAGGAAGAAGG + Intergenic
1127653948 15:61037793-61037815 CTATAATAGAAGATGGAAGAAGG + Intronic
1127892884 15:63270543-63270565 CTACTTATTATGATGGAAAAAGG - Intergenic
1128096133 15:64957302-64957324 TTATTATTTAAGGTGGAAAAAGG - Exonic
1134352715 16:13452836-13452858 ATATTCTTTAAGAGGGAAGAGGG - Intergenic
1135826995 16:25737801-25737823 CTATTAGCAAAGATGGGAGAAGG - Intronic
1136558054 16:31020320-31020342 CCATTATTTAAAAAGGAAGAAGG + Intergenic
1137583286 16:49647610-49647632 CTAGTATTGAAGATGGAAGGAGG + Intronic
1138426684 16:56938787-56938809 CTATAGATTCAGATGGAGGATGG + Intronic
1139416717 16:66817826-66817848 ATGTTAATTAATATGGAAGTGGG + Intronic
1139541467 16:67620548-67620570 CAAATAATGAAGAGGGAAGAAGG + Intronic
1140163233 16:72521446-72521468 CTATAAATAAAGAAGGAAGCAGG + Intergenic
1141391189 16:83665799-83665821 CTTTAGATTAACATGGAAGATGG - Intronic
1143396981 17:6607962-6607984 CTATAATTTAAGATAGAACACGG - Intronic
1146130292 17:30267608-30267630 TTAATAATGAAGATGGAAGAAGG - Intronic
1146474487 17:33152078-33152100 GTACTAATTAAGATGGTAGAGGG - Intronic
1146570140 17:33945387-33945409 CTGTTAACTCAGATGGAACAAGG + Intronic
1148985151 17:51614302-51614324 CTAATAATCCAGAAGGAAGAAGG + Intergenic
1149095885 17:52840024-52840046 CAAGTAATCAAAATGGAAGAAGG + Intergenic
1149185969 17:53998534-53998556 CTATTAATTAAAATATAAGAAGG - Intergenic
1149530943 17:57394774-57394796 CTATCAATTATGGGGGAAGAGGG - Intronic
1150253828 17:63727449-63727471 CTGTTAATTAAGAGGAAAAAAGG - Intronic
1151050715 17:70975790-70975812 TTATTGATAAAGATGGAACATGG + Intergenic
1153951090 18:10058334-10058356 CTGGTCATTAAGATGAAAGAGGG + Intergenic
1154276972 18:12970191-12970213 ATATTAATTAATCTGGATGAGGG + Intronic
1157016088 18:43715710-43715732 CTATTAATTAAGGTGAATCATGG - Intergenic
1163932024 19:20404227-20404249 CTATTAATTCAGATGAGAGCTGG - Intergenic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1168319207 19:55499275-55499297 CTAATCAGAAAGATGGAAGATGG + Intronic
1168530440 19:57123947-57123969 CAATAAATTAACATGAAAGATGG + Intronic
927001828 2:18803560-18803582 CTGTAAAATAAGATAGAAGAAGG - Intergenic
927751092 2:25671995-25672017 CTATTACTTGAGAAGGAAGAGGG - Intronic
927814589 2:26203478-26203500 TTATTAATTCAGAGGTAAGATGG + Intronic
929853642 2:45616193-45616215 CAATTTATTAAGGTGGAAGATGG - Intergenic
931895560 2:66725677-66725699 CTATGAATTAACAGGTAAGAAGG + Intergenic
932014457 2:68010261-68010283 CCACTGATCAAGATGGAAGAAGG - Intergenic
933109322 2:78377132-78377154 CTATTATTTATGATGGCAGGAGG + Intergenic
933975851 2:87508831-87508853 ATATGAATTAAGGTGAAAGAAGG + Intergenic
934670919 2:96212156-96212178 TTGTTAATGAAGATGGAAAAAGG - Intergenic
935959856 2:108414204-108414226 CTGTTAATCAAGGTGGAAGAAGG - Intergenic
935960379 2:108419890-108419912 CTAATAAGTTAGATGGAAGCTGG - Intergenic
936317972 2:111441982-111442004 ATATGAATTAAGGTGGAAGAAGG - Intergenic
936639497 2:114296296-114296318 GTTTTAATTAAGATAAAAGAGGG + Intergenic
938269903 2:129960426-129960448 CTACTAGTTGAGATTGAAGATGG - Intergenic
939690771 2:145257646-145257668 CTATAAAGTCACATGGAAGATGG + Intergenic
939711912 2:145532237-145532259 CAATTAATTAAGATATAAAAGGG + Intergenic
941662441 2:168209067-168209089 CTCTGAATTTAGGTGGAAGAAGG - Intronic
942381188 2:175392895-175392917 CTACTAATTAAATTTGAAGATGG - Intergenic
942440222 2:176026914-176026936 CTTTCAATTGAGATTGAAGATGG + Intergenic
943070604 2:183136535-183136557 CTATATCTGAAGATGGAAGATGG - Intronic
943332742 2:186579374-186579396 TTATTACTTAAGATGGAGGAAGG - Intergenic
947126601 2:226875059-226875081 AGATTAATTATGATGGAGGAAGG - Intronic
947256648 2:228173160-228173182 TTATTAAATAAAAAGGAAGAGGG - Intronic
947664572 2:231895798-231895820 TTCGTTATTAAGATGGAAGATGG + Intergenic
1170272657 20:14545497-14545519 CTCATAATTAAACTGGAAGATGG - Intronic
1170815730 20:19712625-19712647 CCATTAATGAAGATCGAGGAGGG - Intronic
1170878651 20:20274719-20274741 CTAGTTATTAATATGTAAGATGG - Intronic
1177967452 21:27745819-27745841 CCTTTCATTCAGATGGAAGATGG + Intergenic
1180463849 22:15593201-15593223 CTACTAGTTGAGATTGAAGATGG + Intergenic
1184030144 22:41888807-41888829 ATATTCAGTAAGATGGAAAAAGG + Intronic
1184677831 22:46053317-46053339 TGATTAATTAAGAAGGAAAAAGG - Intronic
949283236 3:2371054-2371076 CTATAATTTGAGATGGAAGTGGG + Intronic
949667483 3:6357129-6357151 CTATCAAGTATGATGCAAGAAGG + Intergenic
951866502 3:27314514-27314536 CTATTAATAAATATGAAAGTTGG + Intronic
952077827 3:29719660-29719682 CTATTGATTATCATAGAAGATGG - Intronic
953781386 3:45874128-45874150 ATATTAATGAAGAATGAAGATGG - Intronic
954978200 3:54716932-54716954 CTATGATTTAACATGGTAGAGGG - Intronic
956006765 3:64788165-64788187 TTATTACTTAAGCTGGATGATGG + Intergenic
956092098 3:65678953-65678975 CCATTATTCAAGTTGGAAGATGG - Intronic
956498352 3:69853538-69853560 CTATTTTTTAAGATGGATGGTGG - Intronic
956998405 3:74854558-74854580 CTATTAAATAACATTGAATAAGG + Intergenic
957288528 3:78247567-78247589 CCCTTAATTATGCTGGAAGAAGG + Intergenic
957651894 3:83018184-83018206 CTATTTTTTTGGATGGAAGAGGG - Intergenic
960422758 3:117467845-117467867 CTATCAATTCAGAAGGAAAATGG + Intergenic
960878033 3:122315975-122315997 CTGAGAATGAAGATGGAAGATGG - Intergenic
960926170 3:122796572-122796594 CTATAACATAAGATGGAAGAAGG + Intronic
961197573 3:125015582-125015604 CTATTGATGGGGATGGAAGAGGG + Intronic
961414149 3:126745195-126745217 TTATTAAAGAAGAGGGAAGAGGG + Intronic
962493904 3:135920571-135920593 CTATTTTTCCAGATGGAAGAGGG - Intergenic
965741102 3:171875336-171875358 CTATTAAAAAAAATGGAAGTGGG - Intronic
965966711 3:174500561-174500583 CTATTAATTATGATGTTAAATGG + Intronic
967477305 3:189936825-189936847 CAAATAATTAAGTTGGCAGATGG + Intergenic
968326148 3:197818423-197818445 TTATTAACAAAGATGGAAGATGG + Intronic
969068252 4:4508090-4508112 CTATTAAATAAAATGGATCATGG + Intronic
969952017 4:10846822-10846844 CTATTTAATAAAATGGAACACGG + Intergenic
971696421 4:29910281-29910303 CTTTTAATCAAGATGTAACAGGG + Intergenic
971754252 4:30686656-30686678 CTATCAATCAAGATGAAAGGTGG - Intergenic
975698548 4:77039313-77039335 ATATTAATTAAAAAGGAAAAAGG + Intronic
975871067 4:78778696-78778718 CTATTTATTAGGAAGGGAGAGGG - Intronic
976847434 4:89505973-89505995 CTATTCATTAAGAAGGAAAAAGG - Intergenic
977470456 4:97436519-97436541 CTCTGCATTAAGTTGGAAGACGG + Intronic
979202425 4:117994222-117994244 CTAGTTTTGAAGATGGAAGAGGG - Intergenic
979262853 4:118668020-118668042 GTATTAATAAATATGAAAGAAGG - Intergenic
979556290 4:122051278-122051300 CCAATTATTAAGATGGCAGAAGG - Intergenic
980018871 4:127683940-127683962 CTCTTAATTGAAATGGAGGATGG - Intronic
981992408 4:150938449-150938471 CTCTTTATTATTATGGAAGAAGG - Intronic
982288181 4:153756414-153756436 CTATTAACTGAGATGGGGGATGG - Intronic
982433513 4:155352599-155352621 CTATTAATGAATATGAAAAATGG - Exonic
982607680 4:157535843-157535865 CTAATAATCATGGTGGAAGAAGG - Intergenic
983579421 4:169292765-169292787 CTATCATTTAAGTAGGAAGACGG + Intergenic
988067348 5:26238175-26238197 CTATTAAGTAGGAAGGAAAAAGG - Intergenic
988072081 5:26304946-26304968 GTATAAAATAAGATTGAAGATGG - Intergenic
989977763 5:50607395-50607417 CTGTTAACAAAGAAGGAAGAGGG + Intergenic
990138000 5:52670525-52670547 CTATTGATTAAGAAGAAAGTCGG + Intergenic
993382841 5:87227543-87227565 GTATGAATGAAGATGAAAGAAGG + Intergenic
993684442 5:90921011-90921033 TTATTTATTAAAATGGAAGCAGG - Intronic
995164327 5:109021184-109021206 TTATTAATTAAAATGGTAGTAGG - Intronic
995288913 5:110426629-110426651 ATATTAATTAAGTTGGGAGAGGG - Intronic
997286580 5:132683634-132683656 CTAAAAATAAAAATGGAAGATGG + Intergenic
997911587 5:137879277-137879299 CTACTAAAAAGGATGGAAGAGGG + Intronic
999935846 5:156485325-156485347 CCATTAATAAAGGTGGAAAAAGG + Intronic
1002682446 5:180977780-180977802 CTTTTAATAAACATGGAAAACGG - Intergenic
1004780752 6:18905860-18905882 CTATTTATAAAGATGGAGGTAGG - Intergenic
1005156266 6:22810277-22810299 CTTTTAAGTAACATGAAAGAAGG + Intergenic
1005715336 6:28542166-28542188 CTATTAAGTACGATTCAAGAAGG - Intergenic
1008180913 6:48327759-48327781 ATATTATTTGAGATGGATGAAGG - Intergenic
1018306716 6:162464898-162464920 ATATTTATTAAGAAGGAGGAGGG - Intronic
1018835240 6:167478354-167478376 CTATTAAAAAAAATGGGAGAAGG - Intergenic
1019029798 6:169000398-169000420 CTATAAATTCTGAAGGAAGAGGG - Intergenic
1020577193 7:9947875-9947897 GAATAAATTAAGATGGAGGATGG - Intergenic
1021341867 7:19474686-19474708 CTATTAATTATAATTGAAAATGG - Intergenic
1022770698 7:33469496-33469518 TTACTAAATAAGATGGAAAATGG + Intronic
1023282743 7:38588263-38588285 CTATTAATTAAGATGGAAGATGG + Intronic
1024248403 7:47488161-47488183 CCATTAGTTAAGATTGAAAAAGG + Intronic
1024878776 7:54060228-54060250 CAATGAATAAAGATTGAAGAAGG - Intergenic
1026280675 7:68919248-68919270 CTAGAAATTATTATGGAAGAAGG - Intergenic
1027553425 7:79631506-79631528 ATATAAAATAAGATGGAAGTGGG - Intergenic
1028417104 7:90592853-90592875 ATAGTATATAAGATGGAAGAGGG + Intronic
1029792816 7:102863327-102863349 CTATGAAATAAGATGGAATGGGG + Intronic
1031400700 7:121323521-121323543 CTAGCAATTAAGGTTGAAGAAGG - Intergenic
1033768755 7:144524435-144524457 GTATTCCTCAAGATGGAAGATGG - Intronic
1035963945 8:4169332-4169354 CCATTTATCTAGATGGAAGAAGG - Intronic
1036159622 8:6374797-6374819 TTATTAATAAAAATGGAAGCAGG - Intergenic
1039668736 8:39569916-39569938 CAATTAATGAAGATTCAAGATGG - Intergenic
1041133408 8:54728577-54728599 TTATTTATTAAGAAGAAAGATGG + Intergenic
1041492404 8:58449029-58449051 CTGGTTTTTAAGATGGAAGAAGG - Exonic
1042244822 8:66699801-66699823 TTAAAAATTAAGGTGGAAGAAGG - Intronic
1042864925 8:73348808-73348830 GTGTTAATTAAGATAGTAGATGG - Intergenic
1043561486 8:81498886-81498908 CTATTTCTTAACATGGCAGAAGG + Intergenic
1044384271 8:91568687-91568709 CGATTGATGCAGATGGAAGAGGG - Intergenic
1045891306 8:107161040-107161062 CAATGAAAAAAGATGGAAGAAGG - Intergenic
1046468634 8:114638502-114638524 TTATTAATGAATAAGGAAGAGGG + Intergenic
1051310467 9:15765606-15765628 CTATCAATTGAGATGGAGGAAGG + Intronic
1055401943 9:75933236-75933258 TTATTAATTAAGTTGGTGGAAGG + Intronic
1057262609 9:93593819-93593841 CAACCAATTAAAATGGAAGACGG + Intronic
1057338911 9:94181636-94181658 CCATTCATGAAGATGGAAAAAGG + Intergenic
1057501507 9:95600475-95600497 CTATTCATTTAGATGGAAAGGGG - Intergenic
1057956516 9:99413012-99413034 ATATTTATTAACATGGAAAAGGG + Intergenic
1058838445 9:108880859-108880881 GTTTTAATTAGGATGGAGGAAGG + Intronic
1188872103 X:35385421-35385443 CTAGTTTTTAAGTTGGAAGATGG + Intergenic
1192749078 X:73969516-73969538 ATATTAATTAAAATGGATCATGG - Intergenic
1194628468 X:96254050-96254072 CTAATAATTAAGGTGGAAGAAGG - Intergenic
1194807895 X:98352194-98352216 CTATTAAATATTATGGAACATGG + Intergenic
1195025599 X:100874053-100874075 CTATTAATTAGGAAGGATTAAGG - Intronic
1195378875 X:104253267-104253289 CTGTTAAATAAGATAGAAAAAGG + Intronic