ID: 1023284853

View in Genome Browser
Species Human (GRCh38)
Location 7:38608435-38608457
Sequence CAGTGAAAAAAGGTGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 564}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023284853_1023284862 23 Left 1023284853 7:38608435-38608457 CCTTCTTCCACCTTTTTTCACTG 0: 1
1: 0
2: 4
3: 57
4: 564
Right 1023284862 7:38608481-38608503 TACTATTTTGACCCCTCTCTAGG No data
1023284853_1023284863 30 Left 1023284853 7:38608435-38608457 CCTTCTTCCACCTTTTTTCACTG 0: 1
1: 0
2: 4
3: 57
4: 564
Right 1023284863 7:38608488-38608510 TTGACCCCTCTCTAGGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023284853 Original CRISPR CAGTGAAAAAAGGTGGAAGA AGG (reversed) Intronic
901556396 1:10034612-10034634 CAGTGAAGAAATGTGGAGGTAGG - Intronic
901574213 1:10187013-10187035 CTGTTCAAAAAGGTGGAAAATGG + Intergenic
902786076 1:18733577-18733599 CAGAGGGAAAAGGTGGAGGAGGG + Intronic
903047294 1:20574465-20574487 CAGCTAAAAGAGGTGGAAGCTGG + Intergenic
903395294 1:22997435-22997457 AAGAGAAAATAGGAGGAAGAAGG - Intergenic
904496331 1:30888883-30888905 CAGACAAAAAGGCTGGAAGAAGG + Intronic
905358999 1:37405360-37405382 CAGAGAAAAAGGCTGGGAGAGGG + Intergenic
906001036 1:42425177-42425199 CAGTGAAAAAAGGTGGTTCATGG - Intergenic
906420770 1:45664986-45665008 CTGTTAAAAAAGATGAAAGATGG + Intronic
907745177 1:57206225-57206247 CAGGGAGAAAAGGAGGGAGAGGG + Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
907909365 1:58813640-58813662 GAGTGTAGAAAGATGGAAGAAGG + Intergenic
908162654 1:61426283-61426305 CAGTCAAAAAAGGGGGAAGAGGG - Intronic
909058006 1:70845400-70845422 CCGTGAAAAAAGCCAGAAGAGGG + Intergenic
909219877 1:72943835-72943857 CAGTGAAAACTGCTGGAATATGG - Intergenic
911220290 1:95238166-95238188 CAGATAAAAAAGTTGTAAGATGG + Intronic
911276461 1:95865651-95865673 CAGTAAAAAAAGGTTAAAAAGGG - Intergenic
911527206 1:99002363-99002385 CTCTGAAAGAAGGTGGAAGCTGG - Intronic
911634772 1:100222744-100222766 CAGTGAAAGGAGGAGAAAGAGGG - Intronic
911636295 1:100239474-100239496 CATAGAAAAAACATGGAAGATGG + Intronic
911735444 1:101331693-101331715 GAGTAAAAAAAGGCGGTAGAGGG + Intergenic
912040839 1:105388042-105388064 CAGGGCAAAAAGGTGGAATCTGG - Intergenic
912253333 1:108033270-108033292 CACTGAAGAAAGGAGGAATAAGG - Intergenic
912434451 1:109650679-109650701 AAGTGAAAAAATCTGGAAGTGGG + Intergenic
912565780 1:110586218-110586240 CAGTGAGGCGAGGTGGAAGAGGG - Intergenic
913441496 1:118903072-118903094 CAGGGAAAAAATGAGCAAGAGGG - Intronic
914851182 1:151315531-151315553 CAGAGACAAAAGGTGGTAGAGGG - Intronic
917379197 1:174385098-174385120 AAGGGAACAAAGGTGGAAGCAGG + Intronic
917717120 1:177749517-177749539 GAATGAAAAAAAGTAGAAGAGGG + Intergenic
917726432 1:177832088-177832110 ATGTAAAAAAAGGTGGGAGAGGG + Intergenic
917889860 1:179425467-179425489 CAGAGACAAAGGGTAGAAGAAGG - Intronic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
918735380 1:188055509-188055531 CAGTGAAATAATTTGAAAGATGG - Intergenic
919411998 1:197257239-197257261 CAGAACAAAAAGGTGGAAGAAGG - Intergenic
919556822 1:199066400-199066422 CACTGAAAATTGGTTGAAGATGG + Intergenic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920155957 1:203951503-203951525 GAGTGAAAAAATGTGAAAAATGG + Intergenic
920441624 1:205984750-205984772 CAGGGAAAAAAGGAGAAAGCAGG - Intronic
920729784 1:208472568-208472590 TAGTGAAAAAAAGTGGATGGGGG + Intergenic
920939719 1:210470231-210470253 GAGTGACAAAAGGTGAAAGACGG + Intronic
921243422 1:213210484-213210506 CTGTGAGAAAAGGTGGAAACAGG - Intronic
921665812 1:217869461-217869483 CAGTGAAAAGATGTGAAAAAAGG + Exonic
921748072 1:218760271-218760293 AAGTGAAAAAAGGTAGATAAGGG - Intergenic
922027060 1:221760074-221760096 CCATGAAGAATGGTGGAAGATGG - Intergenic
923225354 1:231934104-231934126 CAATGAAGAAAGTGGGAAGAGGG + Intronic
923295000 1:232585653-232585675 AAGAGAACAAAGGAGGAAGAAGG + Intergenic
923869931 1:237980875-237980897 AAGTGACATAAAGTGGAAGATGG + Intergenic
1063107530 10:3006316-3006338 CAGTGAACAAAAGGTGAAGAAGG - Intergenic
1063540585 10:6929961-6929983 AAGAGAAAAAAGATGAAAGAAGG + Intergenic
1065694287 10:28365661-28365683 AAGTGAAAAAAGGAGGAAGAAGG + Intergenic
1065968588 10:30788065-30788087 AAGGGAAAAAAGGTGCAGGAGGG - Intergenic
1066170857 10:32843327-32843349 TAGTGCAAAAATGTTGAAGAAGG + Intronic
1066239861 10:33523152-33523174 CAGGGAAAAAAGTGGGAAGCTGG + Intergenic
1067517128 10:46960336-46960358 CAGAGAAAAAAGGTAGATGAGGG - Intronic
1067645121 10:48091493-48091515 CAGAGAAAAAAGGTAGATGAGGG + Intergenic
1067895193 10:50171523-50171545 CAAGGAAAAAGGGTGGAAAAAGG + Intergenic
1067953792 10:50770453-50770475 CAAGGAAAAAGGGTGGAAAAAGG - Intronic
1068340204 10:55691906-55691928 AAGAGAGAACAGGTGGAAGAAGG - Intergenic
1069445893 10:68472770-68472792 TATTGAAAAAAGGTGGAAAGAGG - Intergenic
1070282837 10:75062371-75062393 CAGTGATCAAAGGAGGCAGACGG - Intergenic
1070699810 10:78593504-78593526 TAATAAAAAAAGGTGGAGGAAGG - Intergenic
1071432062 10:85613877-85613899 CAGTGGAATAGGGTGGGAGAGGG - Intronic
1071746557 10:88426432-88426454 CAGTAAAAAAAGGGGGAATTGGG - Intronic
1072036636 10:91568934-91568956 TAGAACAAAAAGGTGGAAGAAGG - Intergenic
1072144604 10:92623346-92623368 CAGAGAAAACAAGGGGAAGAAGG + Intronic
1072242635 10:93511458-93511480 CAGTGAGAAGAGGTGGCATAAGG + Intronic
1072529520 10:96305872-96305894 AAGAGAAATCAGGTGGAAGAAGG - Intronic
1073580591 10:104662216-104662238 CAGAGCAAAAGGGTGGGAGAAGG + Intronic
1073636621 10:105205555-105205577 CAGTCAGAAAAGGTGCAAGAGGG + Intronic
1073951991 10:108820342-108820364 TAGTGAAAATATGTGGTAGAAGG - Intergenic
1074047000 10:109848401-109848423 TAGGGAGAAAAGGTGGAAGGGGG - Intergenic
1075524356 10:123170505-123170527 CACTGAAGAAAAGTGGAAAATGG - Intergenic
1076621822 10:131793870-131793892 CTGGAAAAAAAGGTGGAAAAGGG - Intergenic
1077005355 11:352723-352745 CAGTCACACAAGGTGGAAAATGG - Intergenic
1078048026 11:7935797-7935819 AAGTGAAAAAAAGAGAAAGAGGG - Intergenic
1079097010 11:17517480-17517502 CAGGGAAAAGAGGAGGAAGCTGG + Intronic
1079253110 11:18802129-18802151 CACTGAAAAGAGGGGAAAGAGGG - Intergenic
1079984120 11:27182311-27182333 CAGTGATTAAGGGTGGAAGCAGG + Intergenic
1080131021 11:28793952-28793974 CAGTAAAAAAAGGTTAAAGAAGG - Intergenic
1080219828 11:29888289-29888311 CAGTGAAAAAAGCCAGAATATGG - Intergenic
1080685938 11:34514777-34514799 CAGTGGCAAAAGGAGGAAGTGGG + Intergenic
1080858092 11:36129670-36129692 CAGTCAGAAAATGTGGAAGGAGG + Intronic
1082659806 11:55895719-55895741 AAAGGAAAAAAGGTGGAACAGGG - Intergenic
1083021414 11:59511213-59511235 CAGAGAAAAAATGAGAAAGAGGG + Intergenic
1084345053 11:68541525-68541547 CAGTGAAATAAGATTGCAGAGGG + Intronic
1085065497 11:73491828-73491850 GAGTGAACAAAGGAGGTAGATGG - Intronic
1085652275 11:78278980-78279002 CAGTAAAAAAAAGTGGTAGAGGG - Intronic
1085658285 11:78337540-78337562 AAGAGAAAGAAGGTGGAAGTTGG + Intronic
1087666361 11:101053624-101053646 GAGGGAAGAAAGGAGGAAGAAGG - Intronic
1088390770 11:109312385-109312407 CACTGCAAGAAGGTGAAAGAAGG - Intergenic
1088489656 11:110374482-110374504 CAAAGAAAAAAGGAGGAAGGAGG - Intergenic
1088680452 11:112237096-112237118 CAGTGGAAATAGATGGAAGAAGG + Intronic
1089303444 11:117512452-117512474 CAGGGAAAAAATGGGGATGAGGG + Intronic
1091440927 12:511469-511491 AGGTGGAAGAAGGTGGAAGAAGG - Intronic
1091441006 12:511799-511821 AGGTGGAAGAAGGTGGAAGAAGG - Intronic
1091441114 12:512246-512268 AGGTGGAAGAAGGTGGAAGAAGG - Intronic
1091441116 12:512256-512278 AGGTGGAAGAAGGTGGAAGAAGG - Intronic
1091446460 12:546528-546550 GAGAGAAAAAGGGAGGAAGACGG - Intronic
1092116755 12:6014378-6014400 CAGGGGACAAAGGTGGAAGCTGG + Intronic
1092443618 12:8532195-8532217 CAGAGGAGAAAGGAGGAAGAAGG + Intergenic
1093046458 12:14451517-14451539 CAGTGAAAACAGTGGTAAGAAGG - Intronic
1093442431 12:19214520-19214542 TAGAGAGAAAAGGTTGAAGATGG + Intronic
1093709884 12:22318549-22318571 CAGGGAAAAGAGGGGGAAGGAGG - Intronic
1094112226 12:26873947-26873969 CAGTGACAAAAAGTGGCACATGG - Intergenic
1094143012 12:27199918-27199940 AGGTGAAAAAAGGGGGAAAAAGG + Intergenic
1094383824 12:29872405-29872427 GAGGGAAAGAATGTGGAAGAAGG + Intergenic
1096360503 12:50981806-50981828 AAGGAAAAAAAGATGGAAGAGGG + Intronic
1096373732 12:51090125-51090147 CAGAGAAAAAAGCTACAAGAGGG + Intergenic
1097603821 12:61728480-61728502 AATTAAAAAAAGGAGGAAGAAGG - Intronic
1097869384 12:64587615-64587637 AAGTGAAAAAGAGAGGAAGACGG - Intergenic
1097996785 12:65896547-65896569 CAGGGAGAAGAGGAGGAAGAAGG - Intronic
1098013562 12:66080357-66080379 CAGTGAAACAAGGGAGAAGTGGG + Intergenic
1098211640 12:68172392-68172414 CAGAGAAGAAACATGGAAGATGG - Intergenic
1099284351 12:80697640-80697662 GAGTAAAAGAAGGAGGAAGAGGG - Intergenic
1099670934 12:85691121-85691143 AAGAGGACAAAGGTGGAAGAAGG + Intergenic
1100039909 12:90302934-90302956 GAGAACAAAAAGGTGGAAGAAGG - Intergenic
1100067668 12:90669668-90669690 CAGTGAAAAGAGGAAGAAGAGGG - Intergenic
1101321640 12:103678099-103678121 CTGTGGAAAGAGGTGGAAGCAGG - Intronic
1102005450 12:109586594-109586616 CAGTTACAAAAGGTGCAGGAGGG - Intronic
1102159940 12:110760415-110760437 CTGTGAAGACAGGTGGAAGACGG + Intergenic
1102490608 12:113287775-113287797 CAGTGAAGAAGGGTGGCAGGGGG - Intronic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104726715 12:131082154-131082176 CAGAAACAAAAGGTGGAGGAAGG - Intronic
1104870253 12:131990005-131990027 CCGTGAAGAAAGGGGGAAGAAGG + Exonic
1106221948 13:27753624-27753646 TAGAAAAAAAAGGTGGAAGAAGG - Intergenic
1106355833 13:28982169-28982191 CAGTGAAGACAGATGGAAAAAGG + Intronic
1106897923 13:34325038-34325060 TGGTGGAAAAAGGTGGAAAAAGG + Intergenic
1106986940 13:35364313-35364335 CACTGAAAATAGTTTGAAGATGG + Intronic
1107694045 13:42982760-42982782 CAGGGGAAAAAGATGGGAGAAGG - Intronic
1108285406 13:48902440-48902462 CTTTGAAAAAAGGGGGATGATGG + Intergenic
1108301406 13:49080392-49080414 CAGTGAATAATGGTTAAAGAAGG - Intronic
1108716490 13:53084060-53084082 CTGTAAAAAAAGGGGGGAGAGGG - Intergenic
1108882819 13:55142102-55142124 AGGTCAAAACAGGTGGAAGAAGG + Intergenic
1109120909 13:58455740-58455762 CAGTAAAAAAAGGACAAAGAAGG + Intergenic
1109168982 13:59073015-59073037 CAGGGGAGAAAGGTGGAAAAGGG - Intergenic
1109209108 13:59514243-59514265 CAGAGATTAAAGGTGGAAGGAGG - Intergenic
1109640219 13:65181616-65181638 TAGAACAAAAAGGTGGAAGAAGG + Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1110817425 13:79877374-79877396 AGGTGAAAAAAGGGCGAAGATGG - Intergenic
1111000261 13:82169736-82169758 CAGGGAAAAAGGGAGGAAGTAGG + Intergenic
1111331317 13:86763878-86763900 AAACTAAAAAAGGTGGAAGACGG - Intergenic
1111671909 13:91342017-91342039 TATTGAAACAAGGAGGAAGATGG - Intergenic
1112948788 13:104963583-104963605 CAGTGAAAAAATATGAAATAGGG - Intergenic
1113293877 13:108936570-108936592 CAGTAAAAAAAGGACAAAGAAGG - Intronic
1113325399 13:109276778-109276800 CAGGGGAGAATGGTGGAAGAAGG - Intergenic
1114455149 14:22849160-22849182 AAGGGGAAAGAGGTGGAAGATGG + Intergenic
1114552997 14:23544859-23544881 CAGAAAAAAAAGGTGGGAGAAGG - Intronic
1114751750 14:25211845-25211867 CAGGAAAAAAAGTTGGAAGAGGG - Intergenic
1115088753 14:29548892-29548914 CAGTGACAAAAAGTTGATGATGG - Intergenic
1115167490 14:30465213-30465235 CAGTGCAAAAAGGTAGAGAAAGG - Intergenic
1115834548 14:37385162-37385184 CTGTAAAATATGGTGGAAGAGGG + Intronic
1116692306 14:48124640-48124662 CAGTAGAAATAGGAGGAAGAGGG - Intergenic
1116694477 14:48154913-48154935 AAGTGAAAGATGGTAGAAGATGG - Intergenic
1116900822 14:50361157-50361179 CAGTGATAAAAGGTAAAAGGAGG + Intronic
1117226487 14:53666119-53666141 CTGTGGAAATAGGTAGAAGAAGG - Intergenic
1118139012 14:63059385-63059407 CAGTGGAAACAGATAGAAGATGG + Intronic
1118464284 14:66016765-66016787 TAGTGAACAAAAGGGGAAGAGGG - Intergenic
1118979071 14:70701601-70701623 TAGGGAAAAGAGGGGGAAGAGGG + Intergenic
1119597252 14:75946766-75946788 CAGTGAAAGAAGGTAGAGAATGG + Intronic
1119705043 14:76778060-76778082 CAGTGAAAGACGGTGAGAGAGGG + Exonic
1120222344 14:81748565-81748587 CAGTGAAGAAGAGAGGAAGAAGG + Intergenic
1120286647 14:82510951-82510973 CAGGGAAAAAAGAGGGAAAAAGG - Intergenic
1120739530 14:88092179-88092201 CAATGAAAAAAGGAGGATGTGGG + Intergenic
1121049023 14:90807991-90808013 CAGTGAAACTAGTTGGAAGTGGG + Intronic
1122105337 14:99449110-99449132 AAGTAAATAAATGTGGAAGAAGG + Intronic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1124388900 15:29235321-29235343 CAGCAAAAAAAGGTAAAAGAAGG - Intronic
1124630484 15:31334057-31334079 CAGTCAAGGAAGCTGGAAGATGG - Intronic
1124823074 15:33067050-33067072 CACTGAAAAAAGCTGGAAGTTGG + Intronic
1126643422 15:50851401-50851423 CATTGAAAAAAAGGTGAAGATGG - Intergenic
1126942397 15:53780941-53780963 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
1126976110 15:54183113-54183135 AAGTTAAAAAAGGTGAAATAGGG + Intronic
1127039504 15:54958707-54958729 CAGTGCAAAATGGTGGTAAAAGG - Intergenic
1127559060 15:60117935-60117957 CAGGGAAAAAAGGTTGAAGGAGG + Intergenic
1128537573 15:68502482-68502504 CAGTGAAACAGCGTGGCAGAAGG + Intergenic
1129354299 15:74979049-74979071 CATTGCAAGAAGCTGGAAGAAGG - Intronic
1130068405 15:80626253-80626275 CAGAGAAAGGAGGTGGAAGGAGG - Intergenic
1130224990 15:82049760-82049782 AAATGAACAAAGGTGGCAGAGGG + Intergenic
1130359317 15:83167253-83167275 CAGTAAAAAAAGGACAAAGAAGG + Intronic
1130364951 15:83226892-83226914 CAATGAAAAAAAGTGAATGATGG - Intergenic
1131012836 15:89032653-89032675 CATTGACAAAAGGTTGAACAAGG - Intergenic
1131444199 15:92482571-92482593 ATTTAAAAAAAGGTGGAAGAGGG + Intronic
1131988974 15:98074284-98074306 CAGTAAAAAAAGGACAAAGAAGG - Intergenic
1133201389 16:4206624-4206646 CAGGGACAGAAGGTGGCAGAGGG - Intronic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134774169 16:16837527-16837549 CATTAAAAAATGGTGGAAGATGG + Intergenic
1135235748 16:20754177-20754199 CAGTGAAATAAGAGGGGAGAAGG + Intronic
1135524180 16:23201268-23201290 CAGTTTGAAAAGGGGGAAGAGGG - Intronic
1136318593 16:29468047-29468069 CATAGAAAAAAGGTGGGAGGGGG - Intergenic
1136433165 16:30207393-30207415 CATAGAAAAAAGGTGGGAGGGGG - Intronic
1137380258 16:47991828-47991850 CATTGGGAAAAGGTGGGAGATGG + Intergenic
1137723977 16:50644838-50644860 CAGTGAAGAAAGGAGGGAGGAGG - Intergenic
1137912025 16:52387353-52387375 CTGTAAAGAAAGGTGGCAGAGGG + Intergenic
1138150183 16:54649685-54649707 CAGAGGAAAAAGGGGGCAGATGG + Intergenic
1138192640 16:55028162-55028184 CAGGGGAAAACGGTGGGAGATGG + Intergenic
1138750979 16:59420672-59420694 TAGTAAAAGCAGGTGGAAGAGGG - Intergenic
1139868957 16:70088283-70088305 CAGTGAGAATAGGGGGGAGATGG - Intergenic
1140065597 16:71608777-71608799 AAGGGAAAAAAGGCAGAAGAGGG - Intergenic
1140386430 16:74543889-74543911 CAGTGAGAATAGGGGGGAGATGG + Intronic
1140499465 16:75421239-75421261 AAGGGAAAAAAGGGGGAACAGGG - Intronic
1140684748 16:77422609-77422631 GAGAGAAAAAAGGAGGAAGAAGG + Intronic
1141459555 16:84169932-84169954 CAGAGAAACAAGGCAGAAGATGG + Exonic
1141862710 16:86728888-86728910 AAGTGAAAAGAGGTGGATGCTGG + Intergenic
1142887890 17:2924563-2924585 GAGGGAAGGAAGGTGGAAGATGG + Intronic
1143543115 17:7581231-7581253 CAGTGATAAAAGGGGGAAACTGG - Intronic
1144038951 17:11391429-11391451 AAGTGTAACAAGGAGGAAGAGGG - Intronic
1144613772 17:16749845-16749867 CAGCCAAAAAAGGATGAAGAAGG - Intronic
1144898941 17:18565821-18565843 CAGCCAAAAAAGGATGAAGAAGG + Intergenic
1145133436 17:20379898-20379920 CAGCCAAAAAAGGATGAAGAAGG - Intergenic
1146099431 17:29965180-29965202 CAGTGAAAAAAGGGCTCAGATGG - Intronic
1146661137 17:34665859-34665881 CATAGAAAAACGGAGGAAGATGG + Intergenic
1147499496 17:40949037-40949059 AAAAAAAAAAAGGTGGAAGAGGG + Intergenic
1149626199 17:58082817-58082839 CAAAGAACAAAGGAGGAAGAAGG + Intergenic
1149923398 17:60679279-60679301 AAGGGAAAAAAGGAGGAAGTAGG - Intronic
1150105649 17:62460705-62460727 GAGAGGAAAAAGGAGGAAGAAGG - Intronic
1150611113 17:66733805-66733827 AAATAAAAAAAGGTGGAAGTTGG + Intronic
1151735507 17:75937632-75937654 CAGTGAACACAGGTGGAAATTGG + Intronic
1152731241 17:81971837-81971859 TAGAACAAAAAGGTGGAAGAAGG + Intergenic
1153434663 18:5056687-5056709 CAGAGAAAAACAGTGGTAGAGGG + Intergenic
1153612302 18:6898879-6898901 CAGGGGCAAAAGGGGGAAGAGGG + Intronic
1154479464 18:14804598-14804620 GTGGGAAAAAATGTGGAAGAAGG + Intronic
1155406863 18:25498324-25498346 CAGTGAAAAAAATTAGAAGCCGG + Intergenic
1155783051 18:29863416-29863438 CTGTGAAAAACAGTGGCAGAAGG - Intergenic
1156041341 18:32826394-32826416 CAGAGAAAAAAGGTAAAGGAAGG - Intergenic
1156083737 18:33374147-33374169 CAGTGGAAACATCTGGAAGAGGG + Intronic
1157115233 18:44856282-44856304 CTGTCAGAAAAGGTGGAAAAGGG + Intronic
1157467375 18:47958887-47958909 CAGAGATAAAAGGAGGCAGAGGG - Intergenic
1157982014 18:52392824-52392846 TCCTGAAAAAAAGTGGAAGATGG - Intronic
1158600427 18:58851702-58851724 CAGTGAATGAAGTTGGAGGAAGG + Intergenic
1158947462 18:62459465-62459487 CTGTCAACAAAAGTGGAAGAAGG - Intergenic
1159817567 18:73094731-73094753 CAGAACAAAAAGGTGAAAGAAGG + Intergenic
1160068842 18:75606561-75606583 CAAAAAAAAAAGGTGGAAGAGGG + Intergenic
1160467562 18:79094304-79094326 CAGTGGAGAAAGCTGGACGAGGG - Intronic
1160615835 18:80127511-80127533 AAGTGAAAGAAAGTGAAAGATGG - Intronic
1161520983 19:4723471-4723493 GAGGGAAAGAAGGTGGAGGAGGG + Intronic
1162180156 19:8863224-8863246 CAGAGAAATCAGGTAGAAGAGGG + Intronic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1163982629 19:20915422-20915444 CAGTGAAAAAAATTCTAAGATGG - Intergenic
1165298549 19:34949920-34949942 GAGAGAAACAAGGAGGAAGAGGG + Intergenic
1165454578 19:35903321-35903343 AAGAGAAAGAAGGTGGATGAGGG - Intronic
1165667450 19:37645223-37645245 AAGAAAAAAAAAGTGGAAGAAGG + Intronic
1166048678 19:40244958-40244980 CAGTGTCAAAATGTGGAAGAGGG - Intronic
1166331703 19:42081485-42081507 CAGTGCTAAGAGGTGGAAGGTGG - Exonic
1166672435 19:44718976-44718998 CAGGGCAAAAAGGGAGAAGAAGG + Intergenic
1168471524 19:56644046-56644068 CAGTGAATGGAGGAGGAAGAAGG - Intronic
924998949 2:388459-388481 GAGTGAAAGAAGGTGGGACAAGG - Intergenic
925579939 2:5400189-5400211 TAGAAAAAAAAGGTGGAGGAAGG - Intergenic
925934200 2:8737894-8737916 AAGTGAAAGAAGTTGGAAAAAGG - Intronic
926828383 2:16932772-16932794 CAGTCAGAAAAGGGGGAAGAGGG - Intergenic
926967426 2:18430169-18430191 AAGTGAGACAAGGTTGAAGATGG + Intergenic
927465904 2:23336249-23336271 TGGACAAAAAAGGTGGAAGAGGG - Intergenic
928016905 2:27665817-27665839 GAGTATAAAAAGGTAGAAGATGG + Intronic
928319530 2:30272024-30272046 CGGAACAAAAAGGTGGAAGAAGG + Intronic
928698481 2:33874392-33874414 ATAAGAAAAAAGGTGGAAGAGGG - Intergenic
928997935 2:37315597-37315619 CAGAGAAAACAGGAGGTAGAGGG - Intronic
929827630 2:45321728-45321750 CAGTGAGAAAAGCAGCAAGACGG + Intergenic
930414659 2:51076237-51076259 GAGAGAAAATAGGGGGAAGAAGG + Intergenic
931047261 2:58369261-58369283 CAGAGCAAAACTGTGGAAGAGGG - Intergenic
931099844 2:58984857-58984879 CAGTGAAAAAAAACTGAAGATGG - Intergenic
931364256 2:61605200-61605222 CTGAGAACAAAGGTGAAAGAAGG - Intergenic
931794950 2:65700287-65700309 CACTGAGAAAAGGTGGAAATTGG + Intergenic
931905099 2:66833994-66834016 CAGTGAAAGAAAGAGGCAGAAGG - Intergenic
932611271 2:73202302-73202324 CAGTGAGCAAAGGAGAAAGACGG + Exonic
932893104 2:75612882-75612904 AAGGGACAAAAGGAGGAAGATGG + Intergenic
933195235 2:79382109-79382131 TAGAACAAAAAGGTGGAAGAAGG + Intronic
933200573 2:79443389-79443411 CAGAAAAAAAAAGTGGAGGAAGG - Intronic
933236645 2:79871556-79871578 CAGAACAAAAAGGTGGAGGAAGG - Intronic
933273619 2:80260290-80260312 CAGTGAAGAAAGATGGCAGAGGG + Intronic
933530610 2:83505800-83505822 AAGTCAAAAAAAGTGGAAGGGGG - Intergenic
933811091 2:86033192-86033214 CAGTGACAAAAAGGGGAAGAGGG - Intronic
933860931 2:86466997-86467019 CAGTCAGAAAAGTTGAAAGAAGG + Intronic
933917314 2:87008958-87008980 CAATTACAAAAGGTGGAACATGG + Intronic
934005682 2:87760956-87760978 CAATTACAAAAGGTGGAACATGG - Intronic
934859454 2:97751795-97751817 CGGTGAGAAAGGGAGGAAGAGGG + Intergenic
935424658 2:102907363-102907385 CAGTGAAAGAAGGTGGCCTATGG + Intergenic
935768637 2:106395056-106395078 CAATTACAAAAGGTGGAACATGG - Intronic
935911465 2:107900872-107900894 CAATTACAAAAGGTGGAACATGG + Intergenic
935959856 2:108414204-108414226 CTGTTAATCAAGGTGGAAGAAGG - Intergenic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936133245 2:109865930-109865952 CAATTACAAAAGGTGGAACATGG + Intergenic
936211452 2:110505555-110505577 CAATTACAAAAGGTGGAACATGG - Intergenic
936768452 2:115882720-115882742 CAGAGAAAAAATGTAGAAGTGGG - Intergenic
936834193 2:116687220-116687242 CAGTGAAAAAGAGTGTGAGAGGG + Intergenic
937539507 2:122931259-122931281 CAGTGAAAAAGGAGGGCAGAAGG + Intergenic
937792398 2:125976146-125976168 AAGTGTTAAAAGGTGGGAGACGG - Intergenic
938253072 2:129831270-129831292 CAGTTTAAAAAGGAGGAAAATGG - Intergenic
938609283 2:132930466-132930488 AAAGGTAAAAAGGTGGAAGAAGG + Intronic
939629017 2:144512834-144512856 CAGAGAAAAAAGGATGGAGATGG + Intronic
939737371 2:145865353-145865375 CAGAGAGAAAAGATGGTAGAGGG - Intergenic
940065553 2:149623556-149623578 CAGTGAAACCAGGTAGAAAAGGG + Intergenic
940376698 2:152966047-152966069 CAGTTAATAAAGGAGCAAGAGGG - Intergenic
940485862 2:154294914-154294936 CAGGGTAGAAAGGTGGGAGAAGG + Intronic
940552219 2:155174150-155174172 CAGTGGGAAAAGGTGGGAAAGGG - Intergenic
941204704 2:162557499-162557521 CAGTGGCAAAAGATGGGAGATGG + Intronic
941770378 2:169338419-169338441 AAAAGAAAAAAGGAGGAAGACGG + Intronic
941833443 2:169988931-169988953 CAGAGAAAAAAGGGGTAAAAGGG - Intronic
941985880 2:171511337-171511359 GAGTGGATAAAAGTGGAAGAGGG + Intergenic
943179061 2:184519443-184519465 CAGTGCAAAAGGGTGGATAAAGG - Intergenic
943569471 2:189556195-189556217 CAGTGAGGAAAGTTGGCAGAAGG - Intergenic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
944618700 2:201489370-201489392 CTCGGAAAAAAGGTAGAAGATGG - Intronic
945171246 2:206997860-206997882 AAAACAAAAAAGGTGGAAGAAGG + Intergenic
945584300 2:211639464-211639486 CTGTGAAGAAAAGTGGGAGAGGG + Intronic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
945920754 2:215752634-215752656 CAGAGAACAAAGGTGGAAAAGGG - Intergenic
946469225 2:219940835-219940857 CAGTGCAAAATGGATGAAGATGG + Intergenic
946565168 2:220956536-220956558 CAGAGAAAAGTGGTGAAAGAGGG - Intergenic
947218572 2:227771335-227771357 CAGTTAAACAAGGAGAAAGAAGG - Intergenic
947389486 2:229624268-229624290 AAGAGAAAAAAGCAGGAAGATGG + Intronic
947454474 2:230241260-230241282 CAATGAAAAAAAGGGGAACAAGG + Intronic
948136159 2:235637919-235637941 GAGGGCAAAAAGGTGGAGGAAGG - Intronic
948286238 2:236787602-236787624 AAGAGAAAAAATGAGGAAGATGG - Intergenic
948876259 2:240831143-240831165 CAGTGAAAAAAACGGGATGAGGG - Intergenic
1168789449 20:566387-566409 CATGGAAGAAAGGTGGGAGAAGG - Intergenic
1169240486 20:3974406-3974428 CAGTGCAATAAGGTAGAAAAGGG + Intronic
1169660169 20:7970432-7970454 GAGAGAAAAAAAGTGGCAGAAGG + Intergenic
1170390178 20:15864090-15864112 AAATGAAGAAAGGTGAAAGAAGG - Intronic
1170706499 20:18749010-18749032 CAGGCAAAAGAGGAGGAAGAGGG + Intronic
1171466190 20:25329409-25329431 CAGTGAAAACTGGGGGAAGCAGG - Intronic
1171528286 20:25833261-25833283 CAGAGAAAAACAGTGTAAGAAGG + Intronic
1171548540 20:26022617-26022639 CAGAGAAAAACAGTGTAAGAAGG - Intergenic
1172060702 20:32185413-32185435 ATGTGAAAGGAGGTGGAAGAAGG + Intergenic
1173497469 20:43529944-43529966 CAGTGAGAGAAGGTAGCAGAGGG + Intronic
1174251710 20:49224813-49224835 CTGTGAAACAAGGTTGACGATGG + Intronic
1174769355 20:53283991-53284013 GGGTGAAAGAAGGTGGCAGAAGG + Intronic
1175354403 20:58352044-58352066 CATGAAAACAAGGTGGAAGAAGG + Intronic
1176920369 21:14680482-14680504 CAGTGAAAATAGGTGGACATGGG - Intergenic
1177004044 21:15648725-15648747 CAGTGAGAAAAGGAGGAAGAGGG - Intergenic
1177955104 21:27588486-27588508 CAAGGAAAAAAGATGGAAGAAGG + Intergenic
1178055670 21:28796009-28796031 CAGAGAAAACAGGAGGTAGAGGG - Intergenic
1178769755 21:35492126-35492148 CAGTGAGAAATAGAGGAAGAAGG - Intronic
1178973599 21:37202809-37202831 CAGTGAACAAAGGCAGAGGAAGG - Exonic
1179006947 21:37523419-37523441 CCCTGAACAAAGGTGGAAGTAGG + Intergenic
1179240573 21:39587144-39587166 CAAAGATAAAAGGTGAAAGAGGG - Intronic
1179516106 21:41908075-41908097 CAGTGACAAAAACTGGAAGATGG + Intronic
1180568178 22:16692867-16692889 CAGGGGACAAAGGTGGAAGCTGG + Intergenic
1180930778 22:19589412-19589434 AATTGAAAAGAGGTAGAAGAAGG - Intergenic
1181507240 22:23367898-23367920 AAGGGAAAAATGGTGGTAGATGG + Intergenic
1181778391 22:25176177-25176199 CAGTGAAAGAGGGGGAAAGACGG - Intronic
1182326337 22:29516032-29516054 CAGGGAGCTAAGGTGGAAGAAGG + Intronic
1182524592 22:30907389-30907411 AAGTGAAAAAATGATGAAGACGG + Exonic
1182772666 22:32806473-32806495 CTATGACAAAAGGTAGAAGAAGG - Intronic
1183166993 22:36155592-36155614 CACTGAACAAAGCAGGAAGAAGG - Intronic
1183172967 22:36201566-36201588 CAGTGAACAAAGCAGGAAGAAGG - Intronic
1183177729 22:36236924-36236946 GAGTGAACAAAGCAGGAAGAAGG - Intronic
1183180309 22:36255412-36255434 CAGTGAACAAAGCAGGAAGAAGG + Intronic
1183843942 22:40524724-40524746 CAGTTAAAAGAGGAAGAAGATGG - Intronic
1184702451 22:46185185-46185207 GAGTGAAAACAGATGGAACATGG - Intronic
949427239 3:3930873-3930895 TAGTGAAAAAATATGGAGGATGG + Intronic
949871900 3:8596168-8596190 GAGTGAAAAACAGTGGAAAATGG + Intergenic
949996427 3:9620833-9620855 CAGAGAAAAAAGGAGACAGAAGG - Intergenic
950099193 3:10346720-10346742 CAGTGGAAAAGGGTGGGTGAAGG + Intronic
950401525 3:12772731-12772753 CAGCAGAAAAATGTGGAAGAGGG + Intergenic
951233140 3:20203094-20203116 CAGTCAGAAAAGGTGAAAGAAGG + Intergenic
951329404 3:21347883-21347905 CAGAGGAGAAAGGTGTAAGAAGG - Intergenic
951630001 3:24709325-24709347 CTGTGAAAAAAGTGGGGAGAGGG + Intergenic
951899307 3:27641308-27641330 CAATGCAGAGAGGTGGAAGAGGG + Intergenic
951964997 3:28372058-28372080 AAATGAAGAAAGGAGGAAGAAGG - Intronic
952620899 3:35340889-35340911 CTGTGAAAAAAGGTACAAAATGG - Intergenic
952711890 3:36439940-36439962 CTGTCAAAGAAGGGGGAAGAAGG - Intronic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
953453831 3:43025998-43026020 AAGTGAGAAAGAGTGGAAGAGGG + Intronic
953888486 3:46733625-46733647 CAGGGAAAAAAGGTGAGTGAAGG - Exonic
954211978 3:49102942-49102964 CAATAAAAAAAGGTGGGAGGGGG - Intronic
954390553 3:50266053-50266075 GAGTGAACACAGGTGGAGGAAGG + Intergenic
955096117 3:55800025-55800047 TATTGAAACAAGATGGAAGATGG + Intronic
955316127 3:57940672-57940694 CAGATTAAAAAGGGGGAAGAAGG + Intergenic
956596636 3:70974169-70974191 GATTCAAAAAAGTTGGAAGAAGG + Intronic
957294426 3:78318828-78318850 CAGTGGAAAAGGGTTGGAGAAGG + Intergenic
958270144 3:91489664-91489686 CAGTGAAAAAATGGGGAATTAGG - Intergenic
959784442 3:110276754-110276776 AAGAGGAGAAAGGTGGAAGAGGG - Intergenic
960366874 3:116783402-116783424 CCATGAGAAAAGGAGGAAGATGG - Intronic
960609347 3:119541100-119541122 CTTAGAAAAAAGGTGGGAGATGG - Intronic
960744992 3:120877662-120877684 AAGGAAAAAGAGGTGGAAGAGGG - Intergenic
960762178 3:121084401-121084423 CAATGAAAACACGTGGAAGAAGG - Intronic
961495395 3:127287727-127287749 GAGAGAAAAAAGATGGAGGATGG + Intergenic
962306747 3:134294223-134294245 AAGGGAATAAAGGTGAAAGAAGG + Intergenic
962408865 3:135123900-135123922 AAGAGGATAAAGGTGGAAGAAGG - Intronic
962597422 3:136960797-136960819 CATTAAAACAAGGTAGAAGAAGG + Intronic
962600006 3:136984516-136984538 TTGTGAAAGATGGTGGAAGAAGG + Intronic
962771049 3:138610405-138610427 CAGTGAAAGTAAGTGGAATATGG + Intronic
962853577 3:139325675-139325697 CAGTGGAAACAGGTGCAAGGAGG + Intronic
963244917 3:143048888-143048910 AAGTGAAAATAGATGGAAAAAGG + Intronic
964192429 3:154018786-154018808 CCATGAAAACAGTTGGAAGAGGG + Intergenic
964346638 3:155760430-155760452 CAGGAAAGAAAGGTGGCAGAAGG + Intergenic
964519173 3:157544430-157544452 TAAGGAAAAAAGGTGGGAGATGG + Intronic
964601038 3:158501604-158501626 CAGTTAAAAAAAGACGAAGAGGG - Intronic
965279749 3:166734680-166734702 CAGAGACAAAAGGTGGAAGTGGG + Intergenic
965413781 3:168366724-168366746 GAGAGAAAAAAAATGGAAGATGG + Intergenic
965939894 3:174166937-174166959 CAGTAAAAAAAGGACAAAGAAGG - Intronic
967404578 3:189101144-189101166 CTGTGAAAAGAGTTGGAAGGGGG - Intronic
967648963 3:191962143-191962165 AAGTGAAAAAAGGTGATCGAAGG + Intergenic
968294711 3:197567062-197567084 AAGAGAAAACAGGGGGAAGAAGG - Intronic
968301008 3:197614628-197614650 AAGAGAAAATAGGTGGAGGAAGG + Intergenic
968819362 4:2837922-2837944 CAGTGAGAATGGCTGGAAGATGG - Exonic
969519565 4:7668050-7668072 CAGTAAATAAATGTGGAGGAAGG - Intronic
970049757 4:11900398-11900420 CAGGGAAAAAAATGGGAAGAAGG - Intergenic
970072840 4:12181692-12181714 CAGAGCAAAAAGGTAGAGGAGGG + Intergenic
970172850 4:13306457-13306479 CACAGAAAGAAGGTGGGAGATGG + Intergenic
970545726 4:17128177-17128199 CAGTGAAAAAAGGCTGATGAGGG + Intergenic
971806341 4:31362746-31362768 TAATGAGAAAAGGAGGAAGATGG + Intergenic
972491086 4:39587749-39587771 CAAAGAAGAAAGGAGGAAGAAGG + Intronic
972920843 4:43939180-43939202 CAGAAAAAAAAGGTGGGAGGAGG + Intergenic
973624959 4:52762421-52762443 CTGTGAATAAAAGAGGAAGAGGG - Intergenic
974237384 4:59199414-59199436 CAGTGAAAAAAGGGGCCAGAAGG - Intergenic
974361731 4:60889707-60889729 TAGTCAAACAAGATGGAAGAAGG + Intergenic
974812621 4:66964717-66964739 CAGTGAAGAAAGGTAGGAGAAGG + Intergenic
975808653 4:78140957-78140979 CAATGATAAAAGGTGGGTGATGG + Intronic
976136368 4:81941175-81941197 CAGTGAATAAAAGTGAAAGAGGG - Intronic
976575348 4:86663527-86663549 CAGAGGAAAAGGGTGGGAGAAGG + Intronic
976808924 4:89079093-89079115 TAGAACAAAAAGGTGGAAGAAGG - Intronic
977014034 4:91670161-91670183 CTGTGAAAGCAGCTGGAAGAAGG - Intergenic
977277549 4:94996556-94996578 CAGTGTCAAAATGTGGAAGCTGG + Intronic
977937271 4:102821427-102821449 CAGGGAATAAATGAGGAAGATGG - Intronic
978044936 4:104114367-104114389 CCATGAAAACAGGTGGGAGAGGG - Intergenic
978415409 4:108470357-108470379 CACTGAAAACAAGTGTAAGAAGG - Intergenic
978437326 4:108699514-108699536 CAGTGACAAAAGGTGACAGTGGG - Intergenic
978815831 4:112903976-112903998 CAGTTATAAAAGGAAGAAGAAGG + Intronic
979115949 4:116823191-116823213 CATATAAAAAAGGTGGAATATGG - Intergenic
979537295 4:121837802-121837824 CAATTAAAAAAAGAGGAAGACGG + Intronic
979813945 4:125075211-125075233 CAGATAAATAAGGTGGAAGGAGG - Intergenic
979833114 4:125325908-125325930 CAGTGAACAAAGGCAGAGGATGG + Intronic
980269681 4:130567912-130567934 AAGAGAAAATAGGAGGAAGAAGG + Intergenic
980298751 4:130959715-130959737 CACAGAAATAAGTTGGAAGATGG - Intergenic
980742693 4:136973142-136973164 CAGTGAAAACAGCTGGGAGGGGG - Intergenic
981348879 4:143705130-143705152 GTGTGAAAAAAGAGGGAAGAGGG + Intergenic
981569620 4:146137616-146137638 CAGTGATCAAAGTAGGAAGATGG + Intergenic
982126067 4:152184913-152184935 AAAAGAAAAAAGGTGGAGGAGGG + Intergenic
982475013 4:155839825-155839847 CAGAAAAAAAAGATGGTAGATGG + Intronic
983612479 4:169664158-169664180 TAGTGTAGAAAGGTGGAAGTTGG + Intronic
984170422 4:176351768-176351790 AAGAGAAAATAGGGGGAAGAAGG + Intergenic
984970269 4:185182502-185182524 CTGTGAGAAATAGTGGAAGAAGG - Intronic
985533117 5:445288-445310 CAGTTAAAAAAGGGGGAAATGGG + Intronic
986918157 5:12650345-12650367 CACTGAAAAGAGCTGAAAGAAGG + Intergenic
987436373 5:17898977-17898999 CAGTGAAAAAGGGAGAAAGAAGG - Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988072621 5:26313631-26313653 CAGTGAGAAAAGGAGGGACATGG + Intergenic
990021319 5:51130384-51130406 ATGTAAAAAAAGGTGGAAGGTGG - Intergenic
990122291 5:52470145-52470167 CAGTGCTAAAAAGTGGAAGCTGG - Intergenic
990152482 5:52834958-52834980 CAAAGAAGAAAGGTAGAAGAAGG + Intronic
990468942 5:56095586-56095608 CAGTGAACGAAGGTGAAGGAAGG - Intergenic
990778155 5:59327013-59327035 TGCTAAAAAAAGGTGGAAGATGG - Intronic
990799009 5:59578555-59578577 CAGTCAAACAAGTTGGAAAAAGG - Intronic
992194533 5:74326186-74326208 CAATGAATAAAGGTGGGAGGAGG + Intergenic
992272440 5:75079182-75079204 CACTGAAGAAAGTTGTAAGATGG + Intronic
992284852 5:75224233-75224255 CACTAACAAAAGTTGGAAGAAGG + Intronic
992323027 5:75632691-75632713 TGGTGAGAAATGGTGGAAGAAGG - Intronic
992464434 5:76989858-76989880 GAGCAAAAAAAGGTGGAAGAAGG - Intergenic
993038702 5:82787481-82787503 CAGAGTAAAAAGGTGGAGGAAGG + Intergenic
993593686 5:89826673-89826695 CAGAGAGAAAAGCTGGAAGATGG + Intergenic
995056369 5:107763731-107763753 CAGTCATTAAAGATGGAAGAAGG + Intergenic
995156080 5:108915059-108915081 CAGTGAACAAAGGACTAAGAAGG + Intronic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995727416 5:115196041-115196063 CAGTGAAAATAGATGGCACACGG + Intergenic
996321288 5:122220260-122220282 AAGTGAAAAAAGCTGGGTGAAGG + Intergenic
996354580 5:122581605-122581627 CTGGGAAAAAAAGAGGAAGAGGG + Intergenic
996898519 5:128516019-128516041 AAGTCAAAAAAGTTGAAAGAAGG + Intronic
997557796 5:134816017-134816039 CAATGAAACAGGCTGGAAGAAGG - Intronic
998731690 5:145084525-145084547 AAGTGATAAAAGGTGAAAAAAGG + Intergenic
998957175 5:147450680-147450702 CAATAAAAATAGGTGGAAGGAGG + Intronic
1000489833 5:161897672-161897694 GAGAGAAAAGAGGGGGAAGATGG + Exonic
1000673703 5:164093861-164093883 AAGAGAAAAAATGAGGAAGAGGG - Intergenic
1000679926 5:164170928-164170950 CAGTGAATGAAGGTGGATGTGGG + Intergenic
1001134053 5:169087971-169087993 CAGAGAAAAAGGGTGGTAGGAGG - Intronic
1001876477 5:175206157-175206179 CAGAGGAGAAAGGTGGAAAAGGG + Intergenic
1002041710 5:176519569-176519591 CCATGAAAAAAGCTGGAAGCTGG - Intergenic
1002209050 5:177585099-177585121 CAGAGAAAGAAGGAGGAGGAAGG + Intergenic
1002342657 5:178527093-178527115 AAGTCAAAAAAGGGGGAAGTTGG + Intronic
1002941442 6:1720152-1720174 CAAGGAAAAAAGGAGGAAGTTGG + Intronic
1003071933 6:2951729-2951751 CAGTGAAGAAGGGTGAAGGAAGG - Intronic
1003418830 6:5938006-5938028 CAGTTAAAAAAGGCTTAAGAAGG + Intergenic
1004293653 6:14390555-14390577 CAGGGGAAAAAGATGGTAGAAGG + Intergenic
1005080403 6:21951659-21951681 CACAGAACAAAGGTGGAGGAAGG - Intergenic
1005349016 6:24916131-24916153 CTGAGGAAAAAGGTGGAAGCAGG - Intronic
1007281840 6:40718730-40718752 CAAACAAAAAAGGTGGAGGAAGG - Intergenic
1007875513 6:45096480-45096502 AAGTGGAAAAGAGTGGAAGAAGG + Intronic
1007969729 6:46038469-46038491 CAGTGAAGAATGGTGTAAGCTGG - Intronic
1008746986 6:54684012-54684034 CCCTAAAAAAAGGTGTAAGATGG + Intergenic
1008828294 6:55726547-55726569 CTGTGAAAAATGGAGGAAGAGGG - Intergenic
1008898191 6:56581544-56581566 GAGGAAAAAAAGGTGGAAGCAGG + Intronic
1009173053 6:60424630-60424652 CAGTGAAAAAATGGGGAATTAGG + Intergenic
1010292432 6:74153299-74153321 TAGAGCAAAAAGGTGCAAGAAGG + Intergenic
1010525800 6:76898934-76898956 AAGTGAAAATTGGTGGGAGATGG + Intergenic
1010959838 6:82133350-82133372 TAGTACAAAAAGGGGGAAGAGGG - Intergenic
1010971776 6:82270546-82270568 AAGTGAGAAGAGTTGGAAGAGGG + Intergenic
1011168454 6:84478118-84478140 AAGAAAAAAAAGGTGGAAGTGGG + Intergenic
1011940110 6:92832699-92832721 AAGAGAAAATAGGGGGAAGAAGG - Intergenic
1011955492 6:93019905-93019927 CAGTAAAAAAAGGATGAGGAAGG + Intergenic
1013027287 6:106288388-106288410 CAATGAGAAAAGCTTGAAGAAGG + Intronic
1014515773 6:122376764-122376786 CAGTGACGAAAGGTGGCAGGTGG + Intergenic
1014554715 6:122831635-122831657 CAGGGTAGAAAGGTGGAAAAAGG - Intergenic
1015473380 6:133632149-133632171 CAGTGAAATTAAGTGGAAAAAGG + Intergenic
1015660396 6:135567872-135567894 CAGAGAAAAAGGGTGGGGGAGGG - Intergenic
1016053212 6:139551721-139551743 AAATGAAAAAAGCTGGGAGATGG + Intergenic
1017367035 6:153655139-153655161 CAGTGTAAAAAGGTGGATGGGGG - Intergenic
1018570946 6:165209356-165209378 CACTGCAAAAATGAGGAAGATGG - Intergenic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1019089940 6:169520068-169520090 CAGAGACAAAAGGGGGAAGTGGG + Intronic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1022876880 7:34543117-34543139 GAGTGAAATAAGGTGAAATAGGG + Intergenic
1023107581 7:36777513-36777535 CAGAGAAAAAGAGTTGAAGAAGG + Intergenic
1023284853 7:38608435-38608457 CAGTGAAAAAAGGTGGAAGAAGG - Intronic
1023358727 7:39394540-39394562 CAGAGAAAGAAGGTGGGAGAAGG - Intronic
1024221759 7:47294241-47294263 CACTGAAAAGAGCTGGAAGGAGG + Intronic
1024229966 7:47356225-47356247 TAGTGATAAAAGGTGGACAATGG - Intronic
1024860775 7:53837296-53837318 CAGTGAAAACAGCAGTAAGAGGG + Intergenic
1024878776 7:54060228-54060250 CAATGAATAAAGATTGAAGAAGG - Intergenic
1026291934 7:69015083-69015105 CAGGGGAGAAAGGTGGGAGAAGG - Intergenic
1026456257 7:70575166-70575188 CAGTGAACAGATGGGGAAGATGG - Intronic
1026971416 7:74470690-74470712 CAGTGAAAAAGGATGAATGATGG + Intronic
1027715250 7:81661344-81661366 CAGTTAAAAAAGGACAAAGAAGG + Intergenic
1027832645 7:83199601-83199623 CACTGTAAAAATGTGAAAGAAGG - Intergenic
1028001723 7:85506792-85506814 AAGTGAAAAAATAGGGAAGATGG + Intergenic
1028418007 7:90599621-90599643 CAATGAAGAAAGGAGGATGATGG - Intronic
1028465489 7:91146850-91146872 CAAAGAAAAAAGGAGGCAGATGG - Intronic
1028569716 7:92273613-92273635 AAGGGAAAACAGATGGAAGATGG + Intronic
1028905003 7:96143648-96143670 AACTGAAAAAAAGTGGAAAATGG - Intronic
1029941235 7:104482767-104482789 CAGTGGGAAAAGGTGGCATATGG - Intronic
1030401447 7:109056345-109056367 CAGTGCAGAAAGGATGAAGATGG - Intergenic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1031072769 7:117180286-117180308 AGGAGAAAAAATGTGGAAGAGGG + Intronic
1031559498 7:123221128-123221150 GAGAACAAAAAGGTGGAAGAGGG - Intergenic
1031566671 7:123306898-123306920 CATTGAAAAAAGATGAAAGTGGG - Intergenic
1031754850 7:125625763-125625785 CAGTGAAAAAATGTGGTGGCAGG + Intergenic
1031981662 7:128130913-128130935 CAGGGAGAAAAGGAGGAAGGAGG - Intergenic
1032034807 7:128513905-128513927 GAGAGGAAAAAGGAGGAAGAAGG - Intergenic
1032190034 7:129759596-129759618 TAGTGAGGAAAGGAGGAAGAAGG + Intergenic
1032510282 7:132466754-132466776 AAGTTAAAAAAGGAGGAAAATGG - Intronic
1033231760 7:139603703-139603725 CAGTGAAAGAATGCAGAAGAGGG - Intronic
1033326592 7:140384212-140384234 AAGTGAAAAAAAGTGGGAGCCGG + Intronic
1033999358 7:147392503-147392525 CAGGGAAGAAAGGTGGGAGAGGG - Intronic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1034753469 7:153592419-153592441 CAGAACAAAAAGGTGGAATAAGG - Intergenic
1036065473 8:5376373-5376395 CAGTGATAGAATGCGGAAGAAGG - Intergenic
1036727612 8:11233429-11233451 CCCTGAATAAAGGTGGAAGTTGG - Intergenic
1037017642 8:13928403-13928425 CCGGGGAAAAAGGTGGGAGAAGG + Intergenic
1037154381 8:15682420-15682442 CAGTTAAAAAAGGACAAAGAAGG - Intronic
1037640350 8:20736553-20736575 GAGAGAGAAAAGGTGGAAGAGGG + Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1041118232 8:54561047-54561069 CAGTGTAAATGGGTGGAAGTGGG + Intergenic
1041350907 8:56946975-56946997 GAGTGAAAGAAGGCAGAAGAGGG - Intergenic
1041691395 8:60691486-60691508 CAGTGAGAAAAGGAGGATGGGGG - Intronic
1042478218 8:69274233-69274255 GAGTGAAAAATGGTGGAGGAGGG + Intergenic
1043038969 8:75235493-75235515 CAGTTACAAAAGGTAGATGAGGG + Intergenic
1043104202 8:76087774-76087796 CAGTTAAAAAAAGTCAAAGAGGG - Intergenic
1043277054 8:78411300-78411322 CAGTGAAGAAAAATGGAATATGG + Intergenic
1043730125 8:83667588-83667610 GAGTGAGAAAAAATGGAAGAGGG + Intergenic
1044208222 8:89517449-89517471 CAGTAAAACAAGGTAGAAAAAGG - Intergenic
1045796378 8:106050020-106050042 CAGCCTAAAAAGGTGTAAGATGG - Intergenic
1045891306 8:107161040-107161062 CAATGAAAAAAGATGGAAGAAGG - Intergenic
1046035841 8:108840369-108840391 CAGAACAAAAAGGTGGAGGAAGG - Intergenic
1046041237 8:108907497-108907519 GAGAGAAAAAAGGTGTAAAATGG + Intergenic
1048439188 8:134447495-134447517 CTGTGTAGAAAGGTGGGAGAGGG + Intergenic
1048557919 8:135499088-135499110 CAGGTAAAAGAGGTGGAACATGG + Intronic
1048599214 8:135901077-135901099 GAGTGAAAAAAGTTGGATCATGG + Intergenic
1048651130 8:136479316-136479338 CAGTGCAAACAGGTCTAAGAAGG - Intergenic
1048871994 8:138806829-138806851 CAGTGGAACAGGATGGAAGATGG + Intronic
1049399945 8:142420631-142420653 CAGTGAACAGAGGTATAAGAGGG + Intergenic
1049867456 8:144948037-144948059 ATGTGAAGAAAGGTGGCAGAAGG + Intronic
1050135511 9:2459469-2459491 CAATTTAAAAAGGTGGAGGAGGG + Intergenic
1050223200 9:3420169-3420191 CAGTGCAAAAATCTGGAAGAAGG - Intronic
1050635766 9:7610845-7610867 CAGTGAGAAAGGGTGGGAAAGGG - Intergenic
1050721581 9:8597541-8597563 CAGTGAAAATAAAAGGAAGAAGG + Intronic
1050774861 9:9247104-9247126 CCTAGAAGAAAGGTGGAAGAAGG - Intronic
1050775088 9:9249605-9249627 AAGAGAAAGAAGGAGGAAGAGGG - Intronic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1053621888 9:39828037-39828059 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053837821 9:42159895-42159917 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1053883197 9:42616235-42616257 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1053889472 9:42678064-42678086 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1054222221 9:62423708-62423730 CAGAGAGAGAAGGGGGAAGATGG + Intergenic
1054228492 9:62485464-62485486 CAGAGAGAGAAGGGGGAAGATGG - Intergenic
1055624948 9:78166836-78166858 CAGGGAAAAAAGCAGGAAGAAGG - Intergenic
1055704919 9:78987778-78987800 GAAAGAAAAATGGTGGAAGAAGG + Intergenic
1056298773 9:85220812-85220834 GAGTGGAAACAGGTGGATGAAGG + Intergenic
1056704306 9:88939118-88939140 CAGAGAAAAATGTTGGAAAAGGG + Intergenic
1057193519 9:93100579-93100601 CACTGAAAAAATGGGTAAGAAGG - Intronic
1057473305 9:95377128-95377150 TAGAACAAAAAGGTGGAAGAAGG + Intergenic
1058531231 9:105906698-105906720 CAGTGAGAAAGAGTGGAGGAAGG + Intergenic
1058888911 9:109344134-109344156 CAGTGAAAAAAGGTGGCCTTGGG + Intergenic
1058938722 9:109793278-109793300 CAGAGAAAAAGGGTAGAGGAGGG - Intronic
1059143161 9:111873611-111873633 AAGTGAAAAAAGGAGTAAAAGGG - Intergenic
1060434637 9:123582997-123583019 CAGTGTAGAAAGTTGGAAGGTGG - Intronic
1060731562 9:126040147-126040169 CAGTGAGGAAAGGTGGGTGAAGG + Intergenic
1060799424 9:126534318-126534340 CAGTGACAGAAGTAGGAAGAAGG + Intergenic
1061279459 9:129588900-129588922 AAGGGAAAAAAGGTGGATTAAGG + Intergenic
1062147200 9:134996283-134996305 AAGTAAACAAATGTGGAAGAAGG + Intergenic
1062343277 9:136103306-136103328 CACTGGAAGAAGGTGGAGGAGGG - Intergenic
1185931456 X:4207868-4207890 GAGATAAAAAAGGTGGAGGAAGG + Intergenic
1186540281 X:10393304-10393326 GAGAGGAGAAAGGTGGAAGATGG - Intergenic
1187007614 X:15247870-15247892 CAGTGAGAGTAGGAGGAAGAAGG + Intronic
1187427212 X:19188972-19188994 AGGTGAAAGAAGGTGGAAAAGGG + Intergenic
1188680182 X:32994197-32994219 CAGAGGAAAATGGTGGCAGAAGG + Intronic
1188999976 X:36933552-36933574 GAGTGAAAACAGGAGGAAAAAGG - Intergenic
1189027041 X:37406419-37406441 CAGTGAATAAATGTGGTTGATGG - Intronic
1189113834 X:38323661-38323683 GACTGAATTAAGGTGGAAGAAGG - Intronic
1189510726 X:41658620-41658642 CAGTGTGAAGAGGTGGGAGAGGG + Intronic
1189878326 X:45461165-45461187 CAGTAAAAAAAGGACAAAGAAGG - Intergenic
1190070723 X:47277080-47277102 GAGTGAGAAAAGCAGGAAGAAGG + Intergenic
1191006218 X:55714100-55714122 AAGAGGAAAAAGGAGGAAGAGGG - Intergenic
1191044244 X:56119241-56119263 AAGTGGGAAAAGGAGGAAGAGGG + Intergenic
1193019167 X:76771060-76771082 CAGAGAAAAAAGTTCTAAGAGGG + Intergenic
1193082604 X:77420931-77420953 CATTGAAAAAGGGTGGAGGTGGG + Intergenic
1193535303 X:82708040-82708062 CAGAGGAGAAAGCTGGAAGATGG + Intergenic
1194001592 X:88436382-88436404 CAATAAAAAAAGGTCAAAGAAGG + Intergenic
1194173064 X:90612570-90612592 CAGTGAAAAGGGGAGGAAGTAGG - Intergenic
1194879099 X:99227667-99227689 CAGAGAGAAAAGGGAGAAGAAGG + Intergenic
1195431938 X:104798715-104798737 CAGTGAAAGAAGATGGAAATGGG - Intronic
1195487091 X:105421608-105421630 AAGAGAAAATAGGGGGAAGAGGG + Intronic
1196367984 X:114944479-114944501 CAGAGAAGAAAGGTGAGAGAAGG + Intergenic
1196871854 X:120120225-120120247 AAGGGAGAAAAGGTGGAAGGAGG + Intergenic
1197026229 X:121753130-121753152 CAGTGAACAAATGTGGATTAGGG - Intergenic
1197517726 X:127456477-127456499 AAGTAAAGAAAGGTAGAAGAAGG - Intergenic
1198184484 X:134240055-134240077 CAGTGAAAAAGGGTGGAGAATGG + Intronic
1198393110 X:136196221-136196243 CAGAGAAGGAATGTGGAAGAAGG + Intronic
1198806346 X:140499251-140499273 CAGTGAGAACAGGTAGAAGAAGG + Intergenic
1198880836 X:141279393-141279415 CAATGAAACAAAGCGGAAGAGGG + Intergenic
1198912875 X:141633906-141633928 CTGTGAAAACAGCTGGGAGAGGG + Intronic
1199254914 X:145708737-145708759 CAGTATAAAAAGGTGGGGGAAGG + Intergenic
1199371434 X:147054472-147054494 AAGTCCTAAAAGGTGGAAGAAGG - Intergenic
1199373306 X:147077123-147077145 CAGAGCATAAAAGTGGAAGAAGG + Intergenic
1199571557 X:149271803-149271825 AAGTGAAAGGAGGTGAAAGAAGG - Intergenic
1199597416 X:149517165-149517187 CAGTAAAAAAAGGACAAAGAAGG + Intronic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic