ID: 1023289658

View in Genome Browser
Species Human (GRCh38)
Location 7:38656239-38656261
Sequence CAGCTCAGACAGCTTGGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 3, 2: 11, 3: 35, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023289658_1023289665 11 Left 1023289658 7:38656239-38656261 CCAAAGCCAAGCTGTCTGAGCTG 0: 1
1: 3
2: 11
3: 35
4: 189
Right 1023289665 7:38656273-38656295 GCAGCTAGCCAAGCAGGACATGG 0: 1
1: 0
2: 18
3: 33
4: 189
1023289658_1023289662 5 Left 1023289658 7:38656239-38656261 CCAAAGCCAAGCTGTCTGAGCTG 0: 1
1: 3
2: 11
3: 35
4: 189
Right 1023289662 7:38656267-38656289 CGCCCTGCAGCTAGCCAAGCAGG 0: 1
1: 0
2: 11
3: 25
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023289658 Original CRISPR CAGCTCAGACAGCTTGGCTT TGG (reversed) Intergenic
900466092 1:2826171-2826193 GAGCAGAGACAGCTTGGCTGTGG + Intergenic
900917714 1:5650347-5650369 CAGCTCTGCCAGCCTGGCTGGGG + Intergenic
901863465 1:12089160-12089182 CAGCTCAGAGGTCTTGGCTCTGG + Intronic
903751504 1:25624249-25624271 TAGCTCAGACAGCAGGGTTTTGG + Intronic
904036987 1:27564262-27564284 CAGCTCAGCCTCTTTGGCTTCGG + Intronic
905803482 1:40860740-40860762 GAGTTCAGACAGCCTAGCTTTGG - Intergenic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
906807120 1:48789834-48789856 CAGCAGAGACGGGTTGGCTTGGG - Intronic
908439164 1:64136237-64136259 GGGCTCAGACAGCTTGCCTAAGG + Intronic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
910182729 1:84503860-84503882 CACCTCAGACACCTTCCCTTAGG - Intronic
910626195 1:89310605-89310627 GAGCTCAGACACCTTCGCTTTGG + Intergenic
911453716 1:98097141-98097163 CAGAACAGAAAGCTTGGCTTTGG - Intergenic
912521021 1:110244702-110244724 CAGTGCAGACACCTTGGATTGGG - Intronic
912746354 1:112248638-112248660 CAGCTCAGACAGTTCGGCCTGGG + Intergenic
914878476 1:151529842-151529864 CAGCTCAGACCCCAGGGCTTGGG - Intronic
914932817 1:151949895-151949917 CAGCTCTGCCAGCGTGGCGTTGG + Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
916812726 1:168319649-168319671 CAGCTCAGACAGCGTAGATGGGG + Intergenic
918005027 1:180533947-180533969 CAGAACAGACACCTTGGCTTGGG + Intergenic
922220338 1:223553418-223553440 CAGCTCAGCTAACCTGGCTTGGG - Intronic
922672470 1:227521590-227521612 CAGCTCAGCCTGTTTGGGTTTGG - Intergenic
923189365 1:231605816-231605838 CAGCTCATAGTGCCTGGCTTGGG + Intronic
923211602 1:231808654-231808676 CAGGTCAGACAACTAGGCATTGG - Intronic
1063714539 10:8514070-8514092 CAGCTCAGACACCTTGGTGTTGG + Intergenic
1067177716 10:43961941-43961963 CAGAACAGAGAGCTTGGCTGAGG + Intergenic
1067853519 10:49770092-49770114 GGGCTGGGACAGCTTGGCTTTGG + Intergenic
1069630629 10:69895146-69895168 CAGCTCAGAGAAGGTGGCTTGGG + Intronic
1070218916 10:74419560-74419582 CAAAGCAGACAGCTTGGCATTGG - Intronic
1070866405 10:79710207-79710229 CATCTGAGACAGCATCGCTTGGG - Intronic
1070880198 10:79848338-79848360 CATCTGAGACAGCATCGCTTGGG - Intronic
1071633314 10:87232428-87232450 CATCTGAGACAGCATCGCTTGGG - Intronic
1071646763 10:87364646-87364668 CATCTGAGACAGCATCGCTTGGG - Intronic
1072458384 10:95597246-95597268 AAGGTAAGACAGGTTGGCTTTGG - Intergenic
1072717647 10:97762304-97762326 CAGCTCCCACAGCCTGGCGTGGG + Intergenic
1073664790 10:105518975-105518997 CATCTCAAACAGCTTGTCTGGGG + Intergenic
1074071339 10:110072901-110072923 CAACTCTTACACCTTGGCTTTGG + Intronic
1074352929 10:112755824-112755846 CAGCTAAGACAGGTTGGCCTAGG + Intronic
1076593428 10:131608374-131608396 CAGCTCAGTCAGGTAGGTTTCGG - Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1081776738 11:45680981-45681003 GAGGTCAGACAGTTTGGCCTTGG - Intergenic
1083436758 11:62648250-62648272 CAGGTCAGACAGATGGGCTGAGG + Exonic
1084169867 11:67395921-67395943 CATCTCAGTCACCATGGCTTTGG - Exonic
1086033850 11:82393077-82393099 CAGCTAAGACAGCTTCCTTTTGG - Intergenic
1088619916 11:111671337-111671359 CAGCTCCACCAGCTTGGCATTGG + Intronic
1089599225 11:119603238-119603260 CAGCTCCGACAGCTCGGCGTTGG + Intergenic
1090131027 11:124142184-124142206 CAGCTCACACAGCTTGCCTGCGG + Intronic
1093115224 12:15201319-15201341 CAGCTCAGGCAATTTGGCTCTGG - Intronic
1094812140 12:34148810-34148832 CAGCTCAGCCTGTTTGGGTTTGG + Intergenic
1096547411 12:52350177-52350199 CAGCTCAGCCAGCTTGCAGTGGG - Intergenic
1096578273 12:52568303-52568325 CAGCTCATCCAGCTTGGCCTGGG + Exonic
1096581389 12:52587765-52587787 CAGCTCATCCAGCTTGGCCCGGG + Exonic
1096584440 12:52610749-52610771 CAGCTCATCCAGCTTGGCCCTGG + Exonic
1096587192 12:52630399-52630421 CACCTCAGCCAGCTTGTCCTGGG + Intergenic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1097615571 12:61880368-61880390 CAGCTCCAACAGCTTGGTGTTGG - Intronic
1097902086 12:64883280-64883302 AAGCTGAGACAAATTGGCTTTGG - Intergenic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1101233276 12:102763723-102763745 AGGCTCAGACAGCTTGGAGTGGG + Intergenic
1101436604 12:104669636-104669658 GAGGTCAGAGAGCCTGGCTTTGG + Intronic
1101747914 12:107558185-107558207 CAACTGAGACAGACTGGCTTGGG + Intronic
1102422328 12:112813807-112813829 AGGCTCAGACAGCTTAGCTGGGG + Intronic
1103341918 12:120225274-120225296 CGGCTCAGACAGCCTGGCCCTGG + Intronic
1104774713 12:131384439-131384461 CTGCTCAGACAGCCGGGCTGGGG + Intergenic
1104993568 12:132640507-132640529 CAGGCCAGACAGCTAGGCATTGG + Intronic
1106504164 13:30356631-30356653 TAGCTCAGTCAGCTGGGCATGGG + Intergenic
1109388794 13:61667169-61667191 CACCTTAAACTGCTTGGCTTAGG - Intergenic
1114265974 14:21072811-21072833 CCGCTCTGAGACCTTGGCTTTGG - Intronic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1116556626 14:46319051-46319073 CAACACAGCCAGCGTGGCTTGGG - Intergenic
1116909281 14:50441642-50441664 CAGCTCAAACTCCTGGGCTTGGG - Intronic
1118114706 14:62762131-62762153 GAGCCCAGAGAGTTTGGCTTGGG + Intronic
1119043983 14:71301288-71301310 CAGATCAGACTTCTTGGTTTTGG - Intergenic
1119574560 14:75707476-75707498 CTGCTCACACACCTTGACTTCGG - Intronic
1120504369 14:85336216-85336238 GAGGCCAGACAACTTGGCTTTGG - Intergenic
1121683241 14:95811875-95811897 GACATCAGACAACTTGGCTTAGG - Intergenic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1126106168 15:45148304-45148326 CACCTCAGCCAGCTGGGCCTTGG - Exonic
1126467319 15:48972950-48972972 CAGCTCGGACAGCTTAGTCTTGG - Intergenic
1127670265 15:61188116-61188138 AAGCCCAGACAGCTTGGGGTTGG - Intronic
1128526910 15:68418774-68418796 GAGCTCAGACAGTTTGGTTTTGG + Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1129672732 15:77616160-77616182 CACCTCAGACAGCCTGGCATTGG + Intronic
1129890466 15:79068358-79068380 CAGTTGAGACAGTGTGGCTTGGG + Intronic
1130028455 15:80290293-80290315 CAGCTCTCACAGCTTTCCTTGGG - Intergenic
1130983898 15:88832118-88832140 CAGCTCAGCCAGGTGGTCTTTGG - Intronic
1131423947 15:92330216-92330238 TAGCTGAGACATCTGGGCTTAGG - Intergenic
1132026056 15:98405369-98405391 GAGCTCAGACAGGCTGGCCTTGG - Intergenic
1132214762 15:100054326-100054348 CAACTCAGATAGCTGGGGTTAGG + Intronic
1132332469 15:101022386-101022408 CAGGTAAGACAGCATTGCTTTGG - Exonic
1133403268 16:5504131-5504153 CAGCACAAGCAGCTTGGCTCAGG + Intergenic
1136227695 16:28870085-28870107 GTGCACAGACAGCATGGCTTGGG - Intronic
1137233054 16:46586137-46586159 CATCTCTGACATCTTGGTTTTGG - Intronic
1138503604 16:57464526-57464548 CAGCTCAGAGAGTTTGGATTAGG + Intronic
1139243663 16:65419835-65419857 CAACTCATCCAGCTTGGGTTGGG + Intergenic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1142608386 17:1094921-1094943 CAGCTCACCCACCTGGGCTTGGG - Intronic
1142898460 17:2997215-2997237 CTGCTCACCCAGCTTGGCGTAGG - Intronic
1143997526 17:11020299-11020321 CAGCACAGACAGATGTGCTTAGG - Intergenic
1144585182 17:16483351-16483373 CAGCACAGACAGGTTGGCCTCGG + Intronic
1144658177 17:17051412-17051434 CAGCTGAGAAAGAGTGGCTTGGG - Intronic
1145908432 17:28528935-28528957 CCCCTCAGACAGCTCTGCTTTGG + Intronic
1147896559 17:43755357-43755379 CAGCTCGGCCTGGTTGGCTTTGG + Exonic
1150120899 17:62601368-62601390 CAACTCTAACAGCTTAGCTTGGG + Intronic
1150516378 17:65814291-65814313 CAGAGCAGACAGCTTGGTTTTGG - Intronic
1151172562 17:72259645-72259667 CTGCTGAAACAGCCTGGCTTAGG - Intergenic
1151565384 17:74894479-74894501 CATCTCAGAGGGCTTGGCTGAGG - Intergenic
1152114529 17:78377417-78377439 CATCTCACACAGATTTGCTTAGG + Intergenic
1152377507 17:79926454-79926476 CAGGCCACACAGCTGGGCTTTGG + Intergenic
1156988974 18:43383153-43383175 AAGCCCAGATGGCTTGGCTTGGG - Intergenic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157580939 18:48773794-48773816 CAGCTCAGGCAGGTTGGTATGGG - Intronic
1160894256 19:1395309-1395331 CAGCGCAGCCGGCTCGGCTTTGG - Intronic
1161125758 19:2556347-2556369 CAGCTCAGGAAGCTGGGCCTGGG - Intronic
1163361137 19:16847094-16847116 CACCAGAGACCGCTTGGCTTCGG - Exonic
1164489176 19:28690961-28690983 CATCTCTGACATCTTGGTTTTGG - Intergenic
925909418 2:8563902-8563924 CAGCTCAGACAGACTTGGTTTGG - Intergenic
929428031 2:41863823-41863845 CAGGTCACACAGCTTGGGTCCGG - Intergenic
932224968 2:70032323-70032345 CTGCTCAGACACCTTGGCTTAGG + Intergenic
932958884 2:76388870-76388892 CAGATGAGAGAGGTTGGCTTTGG + Intergenic
934911137 2:98255394-98255416 CAGCTCAGAAAGCCTGCTTTTGG + Intronic
935795295 2:106635074-106635096 GATCTCAGACATCTTGCCTTCGG + Intergenic
939806112 2:146777421-146777443 CAGCTCTAACAGCTTGCATTTGG - Intergenic
940690006 2:156904678-156904700 CAGGTTGGACAGCTTGGATTGGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
943064431 2:183071424-183071446 CAGCTCAGACAGCTTGGCGCTGG + Intergenic
944706170 2:202291143-202291165 CAACTCAGAAAGCTTGGCAGAGG - Exonic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
945447931 2:209960169-209960191 TAACTCAGCCAACTTGGCTTGGG + Intronic
946320879 2:218953774-218953796 CAGCTCAGACAGCTTGGTGTTGG + Intergenic
946577261 2:221089118-221089140 CAGCGCAGACAGCTATGCATTGG + Intergenic
947572884 2:231249599-231249621 CAGCTGTTTCAGCTTGGCTTAGG + Intronic
948041430 2:234904715-234904737 GGGCTCAGACAGCTTGGGTCAGG + Intergenic
949069448 2:242015265-242015287 CAGCTCAGTCATCTTAGCATGGG + Intergenic
1169288916 20:4332172-4332194 CAGCTAAGACAGCTTCCCTGTGG + Intergenic
1169525215 20:6417082-6417104 CGGCTCAGTCAGATTGGGTTTGG - Intergenic
1170029678 20:11931818-11931840 CAGATAAGTCAGCTTGGGTTTGG - Intergenic
1170207780 20:13817924-13817946 AAGCTCAGACAGCTTAGGATAGG + Exonic
1171332939 20:24357356-24357378 CAGCACAGAGGGCTAGGCTTTGG + Intergenic
1175869357 20:62200911-62200933 GAGCTGGGACAGATTGGCTTGGG - Exonic
1176409750 21:6442222-6442244 CAGCTCACACAGGGAGGCTTGGG - Intergenic
1178178273 21:30129764-30129786 CAGCGCAGACGGCCAGGCTTCGG - Intergenic
1179090130 21:38257098-38257120 CAGTCCAGACAGGTTGCCTTGGG - Exonic
1179685243 21:43050544-43050566 CAGCTCACACAGGGAGGCTTGGG - Intergenic
1180079229 21:45478980-45479002 CATCGCAGGCAGCTTGGCTGTGG - Intronic
1181021674 22:20106801-20106823 CAGCACACACAGCTGGGCTCAGG - Intronic
1184723971 22:46332365-46332387 GAGCTCAGACTGGGTGGCTTCGG - Intronic
1185288816 22:50014117-50014139 CAGCTCAGCCAGCCTGGGATAGG - Intergenic
950262607 3:11553695-11553717 GAGCTCAGATAGTTTGGCCTCGG + Intronic
950611760 3:14131508-14131530 CAGCCCAGAAAGCCTGGCTCAGG - Intronic
951187468 3:19730445-19730467 CAGCCCAGACAGTTTTGGTTTGG + Intergenic
951337753 3:21444923-21444945 CAGGTCACACACCTTGACTTGGG + Intronic
951451123 3:22839810-22839832 CAGCTCAAAGACTTTGGCTTAGG + Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
953577973 3:44128466-44128488 GAGCTCAGACAGGTGGGCTGTGG - Intergenic
953863588 3:46565212-46565234 CCGCCCAGGCAGCTTGGCCTTGG - Intronic
953905471 3:46866304-46866326 CAGCTCAGACATCAGAGCTTTGG - Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957966175 3:87324309-87324331 CAGCTCATACAGCTTGGTGTTGG - Intergenic
960057138 3:113283789-113283811 CAGCTCACAGACCTCGGCTTGGG + Intronic
961365362 3:126395990-126396012 TATCTCAGACATCTTGGCTGAGG - Exonic
961983981 3:131113055-131113077 CACCTCTGCCAGCTTGGTTTAGG - Intronic
962390676 3:134969562-134969584 CATCTCAGCCAGCTCTGCTTGGG + Intronic
962390925 3:134972031-134972053 CATCTCAGCCAGCTCTGCTTGGG - Intronic
962443592 3:135445347-135445369 AAGATCAGACAGCTGGTCTTTGG - Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
963828699 3:149983874-149983896 CAGCTCTGACACCTTGATTTTGG - Intronic
964682006 3:159351852-159351874 CAGGTCACACAGCTTGTCTAGGG + Intronic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
965605779 3:170496477-170496499 CAGCTCCGACCGCTTGGCGCTGG - Intronic
967545450 3:190721410-190721432 CAGCTAAGAAAGCTTGGCTAAGG + Intergenic
967887816 3:194345265-194345287 CAGCTCTGGCAGCCTGGCTGGGG - Intronic
968626985 4:1630172-1630194 CAGCTCCGACAGCTTGGAAGGGG - Intronic
973830790 4:54756872-54756894 CAGCTCAAACAGCTCCTCTTCGG - Intergenic
974279650 4:59775957-59775979 AAGCCAAGACAGTTTGGCTTCGG + Intergenic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
981542198 4:145857677-145857699 GAGCTCAGAGAGATTAGCTTTGG + Intronic
988488050 5:31683127-31683149 CAACTTTTACAGCTTGGCTTTGG + Intronic
990714970 5:58626523-58626545 GAACTCAGACAGCCTGGCTTTGG - Intronic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
994002226 5:94793669-94793691 CTCCTCTGTCAGCTTGGCTTTGG + Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
995972582 5:117990444-117990466 CAGCTCACAGAGGATGGCTTTGG + Intergenic
996511789 5:124324750-124324772 CACCACAGACAGCTTGCTTTTGG - Intergenic
996662870 5:126025580-126025602 TAGCTCAGAGTGCTTGGCATTGG - Intergenic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1007789122 6:44298850-44298872 CACCTCAGACAGCCAGACTTTGG - Intronic
1008639580 6:53448109-53448131 CAGCTCAGAAGGCTGGGCTGAGG - Intergenic
1011810541 6:91127860-91127882 GAGTTCAGACACCTTGGTTTTGG - Intergenic
1012253720 6:97008521-97008543 CAGCTCAGAGAGTTTGGCATGGG - Intronic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1015790718 6:136961829-136961851 GAAGTCAGACTGCTTGGCTTTGG + Intergenic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019126363 6:169843084-169843106 CAGCTCACACCTCTTTGCTTGGG - Intergenic
1019854125 7:3587033-3587055 CAGTGCAGACATCTGGGCTTTGG + Intronic
1020080552 7:5283705-5283727 CAGCTTAGACCGCTGGGCTGCGG + Intronic
1021049712 7:15967636-15967658 CAGTACAGACAGAATGGCTTAGG + Intergenic
1022189116 7:27999798-27999820 CAGCTCAGACAGCTCTGCCTTGG + Intronic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1025198367 7:56948475-56948497 CAGCTTAGACCGCTGGGCTGCGG - Intergenic
1025673583 7:63628458-63628480 CAGCTTAGACCGCTGGGCTGCGG + Intergenic
1029282219 7:99443129-99443151 CTGCTCAGGCAGCTAGGTTTGGG - Intronic
1029453957 7:100657902-100657924 CAGCTCTGACAACTTGGGGTAGG + Intergenic
1030267530 7:107635571-107635593 CAGCTCAGACAACTTTGGGTGGG + Intergenic
1030688460 7:112509418-112509440 AACCTCAGACAGCATGGTTTTGG - Intergenic
1034385699 7:150738946-150738968 CCACTCAGAAAGCTTGGATTGGG + Intronic
1036771206 8:11579350-11579372 CAGCTCATCCAGATTGGCTGCGG - Intergenic
1041013325 8:53566411-53566433 CAGCTCAGACAGTTAGGGTTAGG + Intergenic
1041739882 8:61146740-61146762 AAGCTCAGCCAGCATGGCTGGGG - Intronic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1045058538 8:98391523-98391545 CTGGTCAGAAAGCTGGGCTTTGG + Intergenic
1048982381 8:139709723-139709745 GAGCTCAGCCAGCCTGGCCTCGG - Intergenic
1050118791 9:2287517-2287539 GGGCTCAAACAGCCTGGCTTTGG + Intergenic
1055453481 9:76452503-76452525 CTGCACAGAAAGCATGGCTTGGG + Intronic
1057354042 9:94320750-94320772 CATCTGAGACAGCATCGCTTGGG + Intronic
1057653723 9:96936885-96936907 CATCTGAGACAGCATCGCTTGGG - Intronic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1058337079 9:103843379-103843401 CAGCCAAGTCAGCTTGGCTCAGG - Intergenic
1059948421 9:119437035-119437057 TAGCTCAGCCAGGTTGGCTCTGG + Intergenic
1060864580 9:126985310-126985332 CAGCTCTGCCAGGTTGGCTTTGG - Intronic
1061288795 9:129639322-129639344 AAGCACAGCCAGGTTGGCTTGGG + Intronic
1062419720 9:136474373-136474395 CAGCTCCGAAAACATGGCTTTGG + Exonic
1186280987 X:7992909-7992931 CAGCTCACACTGCATGCCTTTGG + Intergenic
1186716182 X:12254406-12254428 CAGCTGAAACAGCTTGCTTTGGG + Intronic
1187173296 X:16871225-16871247 CAGCTCCGCCAGCTTGGGGTGGG - Intergenic
1189057444 X:37713179-37713201 CAGCTGAGGCAGCTTGACTAGGG + Intronic
1189328976 X:40131131-40131153 CAGGTCAGACAACCTGGTTTGGG - Intronic
1189478470 X:41375167-41375189 CAGCACAGTCAGCCTGGCCTGGG + Intergenic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1191785690 X:64915142-64915164 TGCCTCAGACAGCTTGGCTAAGG - Intergenic
1196725548 X:118892038-118892060 AAGCTCAGAAGGCTTTGCTTTGG - Intergenic
1197570758 X:128147601-128147623 CAGCAGTGACAGCCTGGCTTAGG - Intergenic
1201757283 Y:17499882-17499904 CAGCTCAGCCTGTTTGGGTTTGG + Intergenic
1201844271 Y:18406100-18406122 CAGCTCAGCCTGTTTGGGTTTGG - Intergenic