ID: 1023291383

View in Genome Browser
Species Human (GRCh38)
Location 7:38672011-38672033
Sequence GGAGCTGGTGCCCCACCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023291383_1023291390 12 Left 1023291383 7:38672011-38672033 CCATCAGGTGGGGCACCAGCTCC No data
Right 1023291390 7:38672046-38672068 ACTCTGAGCTCCTGCAGAGAAGG No data
1023291383_1023291393 30 Left 1023291383 7:38672011-38672033 CCATCAGGTGGGGCACCAGCTCC No data
Right 1023291393 7:38672064-38672086 GAAGGCAACTCTGAGAGCATGGG No data
1023291383_1023291392 29 Left 1023291383 7:38672011-38672033 CCATCAGGTGGGGCACCAGCTCC No data
Right 1023291392 7:38672063-38672085 AGAAGGCAACTCTGAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023291383 Original CRISPR GGAGCTGGTGCCCCACCTGA TGG (reversed) Intergenic
No off target data available for this crispr