ID: 1023291390

View in Genome Browser
Species Human (GRCh38)
Location 7:38672046-38672068
Sequence ACTCTGAGCTCCTGCAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023291383_1023291390 12 Left 1023291383 7:38672011-38672033 CCATCAGGTGGGGCACCAGCTCC No data
Right 1023291390 7:38672046-38672068 ACTCTGAGCTCCTGCAGAGAAGG No data
1023291387_1023291390 -10 Left 1023291387 7:38672033-38672055 CCAGCCACCTGGAACTCTGAGCT No data
Right 1023291390 7:38672046-38672068 ACTCTGAGCTCCTGCAGAGAAGG No data
1023291386_1023291390 -9 Left 1023291386 7:38672032-38672054 CCCAGCCACCTGGAACTCTGAGC No data
Right 1023291390 7:38672046-38672068 ACTCTGAGCTCCTGCAGAGAAGG No data
1023291385_1023291390 -3 Left 1023291385 7:38672026-38672048 CCAGCTCCCAGCCACCTGGAACT No data
Right 1023291390 7:38672046-38672068 ACTCTGAGCTCCTGCAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023291390 Original CRISPR ACTCTGAGCTCCTGCAGAGA AGG Intergenic
No off target data available for this crispr