ID: 1023291392

View in Genome Browser
Species Human (GRCh38)
Location 7:38672063-38672085
Sequence AGAAGGCAACTCTGAGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023291383_1023291392 29 Left 1023291383 7:38672011-38672033 CCATCAGGTGGGGCACCAGCTCC No data
Right 1023291392 7:38672063-38672085 AGAAGGCAACTCTGAGAGCATGG No data
1023291389_1023291392 0 Left 1023291389 7:38672040-38672062 CCTGGAACTCTGAGCTCCTGCAG No data
Right 1023291392 7:38672063-38672085 AGAAGGCAACTCTGAGAGCATGG No data
1023291386_1023291392 8 Left 1023291386 7:38672032-38672054 CCCAGCCACCTGGAACTCTGAGC No data
Right 1023291392 7:38672063-38672085 AGAAGGCAACTCTGAGAGCATGG No data
1023291385_1023291392 14 Left 1023291385 7:38672026-38672048 CCAGCTCCCAGCCACCTGGAACT No data
Right 1023291392 7:38672063-38672085 AGAAGGCAACTCTGAGAGCATGG No data
1023291387_1023291392 7 Left 1023291387 7:38672033-38672055 CCAGCCACCTGGAACTCTGAGCT No data
Right 1023291392 7:38672063-38672085 AGAAGGCAACTCTGAGAGCATGG No data
1023291388_1023291392 3 Left 1023291388 7:38672037-38672059 CCACCTGGAACTCTGAGCTCCTG No data
Right 1023291392 7:38672063-38672085 AGAAGGCAACTCTGAGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023291392 Original CRISPR AGAAGGCAACTCTGAGAGCA TGG Intergenic
No off target data available for this crispr