ID: 1023295855

View in Genome Browser
Species Human (GRCh38)
Location 7:38714546-38714568
Sequence CCAGACAGTGAAGAATGATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023295855_1023295858 -5 Left 1023295855 7:38714546-38714568 CCGAATCATTCTTCACTGTCTGG No data
Right 1023295858 7:38714564-38714586 TCTGGCTCTGCTTCTGGATTTGG No data
1023295855_1023295859 21 Left 1023295855 7:38714546-38714568 CCGAATCATTCTTCACTGTCTGG No data
Right 1023295859 7:38714590-38714612 GCAAAATGATAAGATTAGAACGG No data
1023295855_1023295860 22 Left 1023295855 7:38714546-38714568 CCGAATCATTCTTCACTGTCTGG No data
Right 1023295860 7:38714591-38714613 CAAAATGATAAGATTAGAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023295855 Original CRISPR CCAGACAGTGAAGAATGATT CGG (reversed) Intergenic
No off target data available for this crispr