ID: 1023296252

View in Genome Browser
Species Human (GRCh38)
Location 7:38717798-38717820
Sequence GCTCAGAGCAGAGCTCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023296245_1023296252 1 Left 1023296245 7:38717774-38717796 CCTGACACATGGTCACCAGCCTT No data
Right 1023296252 7:38717798-38717820 GCTCAGAGCAGAGCTCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023296252 Original CRISPR GCTCAGAGCAGAGCTCCAGG GGG Intergenic
No off target data available for this crispr