ID: 1023297926

View in Genome Browser
Species Human (GRCh38)
Location 7:38735890-38735912
Sequence CAATCCAAGGGGCAGTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023297913_1023297926 3 Left 1023297913 7:38735864-38735886 CCTGCTACCTAGCCCCGGCCAGG 0: 1
1: 3
2: 2
3: 14
4: 162
Right 1023297926 7:38735890-38735912 CAATCCAAGGGGCAGTTGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 132
1023297918_1023297926 -10 Left 1023297918 7:38735877-38735899 CCCGGCCAGGGTTCAATCCAAGG 0: 1
1: 0
2: 1
3: 13
4: 138
Right 1023297926 7:38735890-38735912 CAATCCAAGGGGCAGTTGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 132
1023297917_1023297926 -9 Left 1023297917 7:38735876-38735898 CCCCGGCCAGGGTTCAATCCAAG 0: 1
1: 0
2: 0
3: 10
4: 111
Right 1023297926 7:38735890-38735912 CAATCCAAGGGGCAGTTGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 132
1023297916_1023297926 -4 Left 1023297916 7:38735871-38735893 CCTAGCCCCGGCCAGGGTTCAAT 0: 1
1: 4
2: 6
3: 14
4: 119
Right 1023297926 7:38735890-38735912 CAATCCAAGGGGCAGTTGGGAGG 0: 1
1: 0
2: 0
3: 15
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023297926 Original CRISPR CAATCCAAGGGGCAGTTGGG AGG Intronic
900587370 1:3439775-3439797 GAATCCCAGGGGCAGTCTGGGGG - Intergenic
903859514 1:26356428-26356450 AAATCCAAAGGGGAGTGGGGAGG - Intergenic
906036355 1:42752466-42752488 CCACCCAAGGGGCACTTGGTGGG + Intronic
911714731 1:101118676-101118698 CATTGCCAGGGGCTGTTGGGAGG + Intergenic
913743004 1:121870119-121870141 CATTCCAAGGGGAATTTTGGAGG - Intergenic
914959751 1:152196063-152196085 CCATCCAAGAGGGAGGTGGGGGG - Intergenic
915239442 1:154509714-154509736 CAATCAAAGGGGCAGGTTGGGGG + Intronic
915745008 1:158149301-158149323 CAATTCTAGGGCCAGTTGGAAGG - Intergenic
919678530 1:200410141-200410163 CAATCACTGGGGCCGTTGGGCGG + Intergenic
919804503 1:201373122-201373144 GAATCCGAGGGACAGCTGGGAGG + Intronic
923056418 1:230429304-230429326 AAATCAAAGAGGAAGTTGGGTGG + Intergenic
924799413 1:247316731-247316753 AAGTCCAAGGGCCAGGTGGGTGG + Intronic
1064296371 10:14082572-14082594 CAATCCAAGCTGCAGTGAGGTGG + Intronic
1065025251 10:21534626-21534648 CCATCTAAGAGGGAGTTGGGGGG - Exonic
1067764681 10:49075916-49075938 CAAACCAGGAGGCAGCTGGGAGG - Intronic
1071006476 10:80889591-80889613 CAATCTAAGTGGCTTTTGGGAGG - Intergenic
1071353405 10:84768694-84768716 CCATACAGGGGGCAGGTGGGTGG + Intergenic
1071948760 10:90678680-90678702 CAAGCCAAGGAGCAGATGTGGGG - Intergenic
1073946861 10:108760951-108760973 AAATAAAAGGGGCAGTTGGAGGG - Intergenic
1074880647 10:117655223-117655245 CAATTCCTGGGGCAGTAGGGTGG - Intergenic
1076154367 10:128192302-128192324 AAAACCATGGGGCAGGTGGGTGG - Intergenic
1076383845 10:130043595-130043617 CAGACCAAGGGGCAGGTTGGGGG + Intergenic
1077431965 11:2520207-2520229 CAATCCAGGGGGCTTCTGGGGGG + Intronic
1078752690 11:14180036-14180058 CAATAGAAGGGTCAGATGGGAGG - Intronic
1079051755 11:17166965-17166987 AAAAAAAAGGGGCAGTTGGGGGG - Intronic
1079084306 11:17434136-17434158 CACTCCAAGGAGCAACTGGGAGG + Intronic
1079453104 11:20614455-20614477 CAGTACAAGGTGCAGTTGTGGGG + Intronic
1080101782 11:28467616-28467638 AAATCCAAGTGGCAAATGGGAGG - Intergenic
1086095217 11:83043386-83043408 AATTCCACGGGCCAGTTGGGTGG - Intronic
1087208218 11:95418804-95418826 GAATGGAAGGGGCAGTTAGGAGG + Intergenic
1087709515 11:101532897-101532919 GAATCCTTGGGGCAGCTGGGAGG - Intronic
1088896675 11:114083691-114083713 GGATCCAAGGGGAAGCTGGGTGG - Intronic
1089289631 11:117429825-117429847 CAATCCTAGGGGCTGTCGTGAGG - Intronic
1089464935 11:118678979-118679001 CAGTTCAAGGGGCAGCTTGGAGG + Intronic
1089466993 11:118691881-118691903 CAGTTCAAGGGGCAGCTTGGAGG + Intergenic
1096973407 12:55684875-55684897 CACTCTAAGGGGAAGTTGGGTGG + Exonic
1098783572 12:74720488-74720510 AATTCCAAGGGGCAGTAAGGTGG - Intergenic
1103367659 12:120394849-120394871 CCAGCCAACGGGCAGGTGGGAGG - Intergenic
1105438982 13:20400238-20400260 GCATCCAAGGGGCAGTTGGATGG - Intergenic
1110442922 13:75545284-75545306 CAGCCCTAGGGGCAGTTAGGTGG + Intronic
1114550186 14:23528294-23528316 CAATCCAAGGGAAAGTGGGGAGG - Intronic
1120754356 14:88228190-88228212 CAATGCAAGAGGTAGTTGGGCGG - Intronic
1122032562 14:98924178-98924200 CATTCCAAGGGACAGGTGGGGGG - Intergenic
1126456385 15:48866593-48866615 TAATCCCATGGGCAGATGGGTGG - Intronic
1127692823 15:61414601-61414623 CAATCAGAGGGGCAGGTAGGAGG - Intergenic
1131850259 15:96534984-96535006 CAATCCAAGTGACAGTTCAGTGG - Intergenic
1133522126 16:6568717-6568739 CATTTCAGGGGCCAGTTGGGTGG + Intronic
1138140530 16:54564578-54564600 TAATGCAAGGCACAGTTGGGAGG - Intergenic
1138201090 16:55089061-55089083 CCCTCAAAGGGGTAGTTGGGTGG - Intergenic
1139772922 16:69293794-69293816 CAATCCAAGGCACAGGTGAGGGG + Intronic
1141002299 16:80319348-80319370 CAATCCTTGGGTCTGTTGGGTGG + Intergenic
1144473715 17:15566085-15566107 CAATCCAACGTGCAGTTGATCGG - Intronic
1144922809 17:18778724-18778746 CAATCCAACGTGCAGTTGATCGG + Exonic
1146895605 17:36539388-36539410 CACTCCAATGTGCAGATGGGTGG + Intronic
1148587679 17:48792347-48792369 AAATCCAAGAGGCAGTGGTGGGG + Intronic
1149667098 17:58372682-58372704 CAATGCAAGGGGCCTATGGGAGG + Intronic
1152407263 17:80104839-80104861 CAATCGAAGCGGCTGTTGGGGGG - Intergenic
1158072310 18:53487172-53487194 CAATACAAGGGGAAGTGGTGGGG + Intronic
1158670033 18:59466316-59466338 CAATACAAGGGGCAGTTCTCCGG + Intronic
1158798201 18:60874263-60874285 CAACTCAAGAGGCAGTCGGGAGG - Intergenic
1161221225 19:3119133-3119155 CAGCCCAAGGGGCAGCTGGGGGG - Intronic
1161703223 19:5805827-5805849 GTCTCCAAGGGGCCGTTGGGGGG + Intergenic
1161838662 19:6665197-6665219 TACTCCAAGGTGCAGCTGGGCGG - Exonic
1162520403 19:11176140-11176162 CACCCCAAGGGGCAGCTGTGGGG + Intronic
1163842981 19:19622707-19622729 CAAACAAAAGGGCAGTGGGGAGG + Intergenic
1164815278 19:31194479-31194501 CCATCTAAGTGGCAGTGGGGTGG + Intergenic
1165872160 19:38980716-38980738 CAATCCAAGGGTGAGAAGGGTGG - Intergenic
1168492186 19:56820516-56820538 CAAACCAAGGGCCAGGTGGCTGG - Intronic
926293769 2:11552441-11552463 CACTCCATGCGGCATTTGGGAGG + Intronic
932021896 2:68095888-68095910 CAGTCCAAGGGCCAGTAGGCAGG - Intronic
934704182 2:96464861-96464883 TAATCCAAGAGACAGTGGGGAGG + Intergenic
935156587 2:100488662-100488684 AAGTCCTAGGGTCAGTTGGGAGG - Intergenic
935538137 2:104318311-104318333 AATTCCATGGGGCAATTGGGAGG + Intergenic
937344996 2:121119930-121119952 CAAGCCAAGGGACATCTGGGTGG + Intergenic
937967569 2:127525826-127525848 GAATCCAAGGGGCGTTGGGGCGG - Intronic
939172645 2:138713209-138713231 AAATCCAAAGGGCAGCTGGCAGG - Intronic
940581445 2:155585012-155585034 CAAGCCAGGGAGCAGATGGGAGG - Intergenic
940670202 2:156658286-156658308 CAGACCTAGGGGCAATTGGGAGG + Intergenic
944506188 2:200414086-200414108 CAATCCAAGTGGGGGTAGGGAGG - Intronic
945130820 2:206569997-206570019 CCATTCCAGGGGCAGTGGGGAGG - Intronic
945552526 2:211237764-211237786 CAAGCGAAGGGGAAGTTGGGTGG - Intergenic
945985436 2:216349937-216349959 CACTGCAAGGGACAGCTGGGTGG + Intronic
1169081810 20:2801787-2801809 CAATCCAAGGGCGAGTTGGATGG - Intergenic
1175735676 20:61385453-61385475 CAATCCAAGGGGGCGGGGGGCGG - Intronic
1178389574 21:32187328-32187350 CAATTCAAGGGCCAGGAGGGTGG + Intergenic
1179924934 21:44529183-44529205 CAACCCGAGGGGCAGTGAGGTGG - Intronic
1180971255 22:19816931-19816953 CCATCCAAGGGGCACTGAGGTGG + Intronic
1183315523 22:37135043-37135065 CAACCCGAGGGGAAGGTGGGAGG - Intronic
1183392381 22:37552767-37552789 TAATCCCAGGGGCATTTTGGAGG - Intergenic
1183671186 22:39273939-39273961 CAGTGCGAGGGGCATTTGGGAGG - Intergenic
949367531 3:3299332-3299354 AAATCTAAAGGGCAGTTGGAAGG - Intergenic
949400795 3:3663667-3663689 CAATTCAAGGGAAATTTGGGTGG - Intergenic
949900569 3:8811685-8811707 CAATCCAATGAGCAATTGGAAGG + Intronic
950124058 3:10500885-10500907 CACCCCAAGGGGCAGTGGGCAGG + Intronic
952817921 3:37461848-37461870 AAAGCCAAGGAGCAGATGGGAGG + Intronic
956885674 3:73556951-73556973 CAGTCCCAGGGGCATGTGGGAGG - Intronic
963874704 3:150462405-150462427 CAATTCCAGTGGCAGATGGGAGG + Exonic
966594986 3:181717778-181717800 CACTGCAAGGTGCAGTAGGGGGG + Intergenic
970889004 4:21020832-21020854 AAAGCCAAGGAGAAGTTGGGAGG + Intronic
982063190 4:151625056-151625078 CAAGCCAACGGACAGGTGGGAGG - Intronic
985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG + Intronic
985658327 5:1143351-1143373 CAGACCAAGGGGCTGCTGGGCGG + Intergenic
985739013 5:1603926-1603948 CTTCCCAAGGGGAAGTTGGGAGG - Intergenic
985767212 5:1786308-1786330 GACCCCAAGGGGGAGTTGGGTGG + Intergenic
986525839 5:8674057-8674079 CAATTCAAGGGGAATTTGGGTGG - Intergenic
993427112 5:87780245-87780267 CAATAAAAGGGGCTGTTGGTGGG - Intergenic
995624208 5:114058834-114058856 CTATCGGAGGGGCATTTGGGAGG + Intergenic
999542114 5:152585039-152585061 CAATCCTGAGGGCAGTGGGGTGG + Intergenic
1000130286 5:158290621-158290643 CTCCCCAAGGGGCAGTTGGCAGG - Intergenic
1001299661 5:170524529-170524551 CCATCCATGGGGTTGTTGGGAGG + Intronic
1003413222 6:5884377-5884399 CAATCCATGGGACAGGTGGGTGG - Intergenic
1006109200 6:31734687-31734709 CAATCCAAGGTGTCTTTGGGTGG + Intronic
1006244752 6:32721683-32721705 CAATTTCAGGGGCAATTGGGAGG - Intergenic
1018250173 6:161861694-161861716 CATTTCAAGGGACAGTTGGTAGG - Intronic
1020520658 7:9182121-9182143 AAAACCCAGGGGCAGTTTGGGGG - Intergenic
1023297926 7:38735890-38735912 CAATCCAAGGGGCAGTTGGGAGG + Intronic
1024038036 7:45525257-45525279 CAATCCCAGCTGCAGTTGGTTGG + Intergenic
1024698967 7:51886144-51886166 ATATACAAGGGGCAGTGGGGAGG + Intergenic
1026694062 7:72575108-72575130 AAATCCAAGGGCCAGGTGAGGGG + Exonic
1027058175 7:75064757-75064779 GAAACCCAGGGGCAGTTGGGGGG - Intronic
1028601003 7:92600395-92600417 CAATCCAAGGAGCAGGAGGGAGG + Intergenic
1028938032 7:96487530-96487552 TAATACAAAGGGCAGTTTGGAGG + Intronic
1033251652 7:139765803-139765825 CCATCCATGGGGCAGAAGGGGGG - Intronic
1033542097 7:142366613-142366635 CAATTCAAGGTGAAATTGGGTGG + Intergenic
1036607743 8:10322580-10322602 GCATCCAAGGGGCTGTTTGGAGG + Intronic
1036678532 8:10853783-10853805 AAGTCCCAGGGGCAGATGGGTGG + Intergenic
1039229439 8:35427145-35427167 AATTCAAAGGGGTAGTTGGGGGG - Intronic
1042224079 8:66501837-66501859 GAAGCCAAGGGTCAGTTGGTTGG - Intronic
1044628352 8:94256206-94256228 CAGGCCAAGGAGCAGGTGGGAGG - Intronic
1048712406 8:137226916-137226938 CAATTGAAGGGTCAGGTGGGTGG + Intergenic
1050110449 9:2209909-2209931 CAATCCAAGGGGAACTAGAGTGG - Intergenic
1050662292 9:7895733-7895755 GAATCCAAGGGATAGTTAGGAGG - Intergenic
1052763121 9:32612889-32612911 CATTCCAAGGAGCAGATTGGAGG + Intergenic
1052969090 9:34365497-34365519 CAAGCCAAGGGCCAGTTTGTTGG + Intergenic
1056770383 9:89474140-89474162 CAACCAAAGGGGGAGGTGGGAGG - Intronic
1058765116 9:108174878-108174900 CAATCATAGGGGCAGATAGGAGG - Intergenic
1059331386 9:113537789-113537811 CTATGCAGGGGGCAGTTGGGGGG + Intronic
1062006440 9:134240624-134240646 CAAGCCAAGAGGGAGTTGAGTGG + Intergenic
1062357507 9:136171803-136171825 CAGTCCAAGGGGCTCCTGGGTGG - Intergenic
1062527890 9:136985616-136985638 CAAAACAAGGAGCAGGTGGGCGG - Exonic
1186824696 X:13328073-13328095 AAATCCCAGGGGCAGTATGGGGG - Intergenic
1188147353 X:26630238-26630260 TATTCCAATGGGAAGTTGGGGGG + Intergenic
1189915174 X:45849940-45849962 CAATCCAAACAGCAGTTTGGTGG + Intergenic
1191849385 X:65574798-65574820 CAAGCGAAAAGGCAGTTGGGTGG - Intergenic
1192494441 X:71605787-71605809 CAGTCCACTGGGCACTTGGGTGG + Intronic
1195427429 X:104750291-104750313 GAAGCCAAAGGGCAGTTGGAGGG + Intronic
1196758164 X:119176252-119176274 CTATCCAGGGGGCAGTAGGTAGG + Intergenic
1199176252 X:144791033-144791055 CAATTCAAGGTGGATTTGGGTGG + Intergenic