ID: 1023298228

View in Genome Browser
Species Human (GRCh38)
Location 7:38739194-38739216
Sequence CAAGAACCATTCAGTAATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023298228_1023298231 -10 Left 1023298228 7:38739194-38739216 CCTACATTACTGAATGGTTCTTG 0: 1
1: 0
2: 1
3: 11
4: 151
Right 1023298231 7:38739207-38739229 ATGGTTCTTGATAGCCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023298228 Original CRISPR CAAGAACCATTCAGTAATGT AGG (reversed) Intronic
900363747 1:2302116-2302138 CAAGAGCCAGTGAGTGATGTGGG - Intronic
903267796 1:22168610-22168632 GAAGGACCTTTCAATAATGTGGG + Intergenic
906357950 1:45124033-45124055 CAAAAACCCTTCAGAAATGAAGG + Intronic
910796042 1:91098903-91098925 AAAGAAGCATTCAGTATTGAAGG + Intergenic
911933392 1:103933694-103933716 CAAGAAACATACAGTATTGTGGG - Intergenic
915322838 1:155065329-155065351 CATGCAGCATTCAGTACTGTGGG + Intronic
915588538 1:156858143-156858165 CAGGCACCATTAAGTAATGGAGG - Intronic
915791490 1:158676735-158676757 CAAGAAAATTTCAGTAATGCTGG + Intronic
1062900258 10:1138625-1138647 CAAGAACAGTTGGGTAATGTAGG + Intergenic
1063378749 10:5570893-5570915 CAGGAAGCATTCAGTGATGCTGG + Intergenic
1063786436 10:9390476-9390498 CAAGAGCCATACATTAATTTTGG + Intergenic
1064183506 10:13140317-13140339 AAAGAACCAAACAGAAATGTTGG - Intergenic
1064960686 10:20961667-20961689 CAGGAGCAAATCAGTAATGTAGG - Intronic
1068408801 10:56627681-56627703 CAAGACTCATTCAATAATGTTGG - Intergenic
1068826344 10:61444114-61444136 CAAGATACAATCAGTAAGGTGGG - Intronic
1072244506 10:93530792-93530814 AAAGAAACTTTCAGAAATGTTGG - Intergenic
1074160747 10:110834546-110834568 GAATAAACACTCAGTAATGTTGG - Intronic
1075422732 10:122315094-122315116 TGAGAACCATTTAGTAAAGTTGG - Intronic
1076073944 10:127517303-127517325 CTAAAACCATTCAGAAACGTTGG + Intergenic
1085374814 11:76050154-76050176 CAAACACCATTCTGTAATTTAGG + Intronic
1095159205 12:38896644-38896666 CAAGACACAATCAGTCATGTGGG - Intronic
1098774620 12:74596189-74596211 CAAGAACTTTTCAGGAATATAGG - Intergenic
1100198813 12:92277055-92277077 GAAGAATCATTCAGTGATGAAGG + Intergenic
1103453275 12:121044628-121044650 TCAGAAGCATTCAGCAATGTGGG - Intergenic
1104353357 12:128064062-128064084 CAAGAGCCTTTCACTGATGTTGG + Intergenic
1108016563 13:46082820-46082842 GAATCACCATTGAGTAATGTTGG - Intronic
1109477019 13:62892972-62892994 CAAGAATGATGCAGTAATTTTGG - Intergenic
1109611963 13:64777482-64777504 CAAGAACCATTGCATAATGTTGG - Intergenic
1109644005 13:65228589-65228611 CAAGATCCATTCTGTAATACCGG + Intergenic
1111049122 13:82856105-82856127 CAAGAAATAATCAGTGATGTGGG - Intergenic
1114129186 14:19770522-19770544 AAAGAACCAAACAGAAATGTTGG - Intronic
1115622069 14:35150428-35150450 CAATTACCATTCAGGTATGTCGG + Intronic
1119671492 14:76522792-76522814 CAAAAACCCTTCAGGAATGAAGG - Intergenic
1120566185 14:86060558-86060580 CAAGAACCATTGTGCAATGTTGG + Intergenic
1121034125 14:90685134-90685156 CAAGGACCATTCAGAAGAGTTGG - Intronic
1121691471 14:95880506-95880528 CAAGAACTATTATGTAATTTGGG + Intergenic
1202828397 14_GL000009v2_random:1509-1531 AAAGAACCATTCAGGTATATGGG + Intergenic
1123572137 15:21624740-21624762 AAAGAACCAAACAGAAATGTTGG - Intergenic
1123608752 15:22067327-22067349 AAAGAACCAAACAGAAATGTTGG - Intergenic
1124648679 15:31458666-31458688 CAAGAAGCTTTCAGTCATGGTGG + Intergenic
1126720990 15:51579482-51579504 GATGAACCATTCAGTATAGTGGG - Intronic
1129199443 15:73990200-73990222 CAAGAACCATTCATTCACATTGG - Intronic
1130285128 15:82548477-82548499 CGTGAACCATTCAGGAATGGGGG + Intronic
1202980993 15_KI270727v1_random:359127-359149 AAAGAACCAAACAGAAATGTTGG - Intergenic
1137996570 16:53221383-53221405 CAACAACTATTTATTAATGTAGG - Intronic
1141662566 16:85449297-85449319 CCAGAACCATCCAGAAAAGTCGG - Intergenic
1141871700 16:86790895-86790917 CAAGAACTAGACAGTATTGTAGG - Intergenic
1147726920 17:42571591-42571613 CAAGAACCGGTCAGTAAAGCTGG - Exonic
1147976278 17:44249994-44250016 CAGTAACCATCCTGTAATGTGGG + Exonic
1150488028 17:65557559-65557581 CAAGCAGTATTCACTAATGTGGG - Intronic
1151642029 17:75403195-75403217 CAAAAGCCATTCAGTAATGGTGG + Intronic
1153365361 18:4249541-4249563 CAGTAACCGTTCAGTAATGATGG + Intronic
1153464984 18:5379029-5379051 CAAGAACCTTTGTGTAATTTTGG - Intergenic
1155731523 18:29165623-29165645 AAAGACCAATTCACTAATGTTGG - Intergenic
1161577778 19:5064404-5064426 CAAGAGCCCTTCAGAGATGTCGG - Intronic
1163790291 19:19302341-19302363 CAAGAACCTTGCAGAAAAGTTGG - Exonic
1164033375 19:21431825-21431847 AAAGAAGGATTCAATAATGTGGG - Intronic
1202644301 1_KI270706v1_random:126312-126334 AAAGAACCATTCAGGTATATGGG - Intergenic
928042554 2:27892427-27892449 GAAGAACAATTCGGTAATATAGG + Intronic
928788826 2:34925857-34925879 AAACTACAATTCAGTAATGTTGG - Intergenic
928952103 2:36822296-36822318 CAATAACTACTCAGTGATGTTGG - Intergenic
929974981 2:46624696-46624718 AAAGAACCATTCAGCAATAATGG - Exonic
931059256 2:58508668-58508690 CAAGAACCTTTCAGAAAAGATGG + Intergenic
932309054 2:70725224-70725246 GAAGAAGCATTCAATAATGCTGG + Intronic
936385340 2:112023793-112023815 CAAGAACATTTCAGGACTGTGGG + Intronic
936410882 2:112257063-112257085 CAAGGACCATTTATTTATGTGGG - Intergenic
939165529 2:138637596-138637618 CAAGAACTATTTAGTACTTTAGG - Intergenic
947047700 2:226006658-226006680 CAGGACCCACCCAGTAATGTAGG - Intergenic
1168883998 20:1232091-1232113 AAGGAACAAATCAGTAATGTGGG + Intronic
1169706597 20:8513208-8513230 CAAGAAACTTTCAGTAGTGTTGG + Intronic
1171894271 20:30745249-30745271 AAAGAACCATTCAGGTATATGGG - Intergenic
1173180181 20:40800522-40800544 CAAGAACCAAACAATATTGTGGG + Intergenic
1176607578 21:8846337-8846359 AAAGAACCATTCAGGTATATGGG + Intergenic
1180357666 22:11856128-11856150 AAAGAACCATTCAGGTATATGGG + Intergenic
1180380599 22:12136205-12136227 AAAGAACCATTCAGGTATATGGG - Intergenic
1182925592 22:34121075-34121097 CACAAACCATCCTGTAATGTTGG - Intergenic
1183618625 22:38959946-38959968 CAGGAACAATTCAGCAATGTGGG + Intronic
953432656 3:42852509-42852531 CAGGAAACATTGAGTGATGTGGG + Intronic
954621666 3:51999899-51999921 CAAGAACCACTCACTCATGGAGG - Intergenic
955057225 3:55466068-55466090 CAAGAAACATTCAGAAACATAGG - Exonic
955423847 3:58767149-58767171 CAAGTACCACTCAGTATTCTTGG - Intronic
957226061 3:77448440-77448462 GAAGAACCATTCGGCAAAGTCGG + Intronic
957970919 3:87381015-87381037 GAAGATCCCTTCAGTAATCTGGG - Intergenic
958452550 3:94292259-94292281 CCAGAACCATTCTGTATTGAAGG - Intergenic
960852083 3:122066151-122066173 CAAGAACCATTCAGTTTTGGGGG + Intronic
961119940 3:124365381-124365403 CTAGAACCATACTGTAGTGTTGG - Intronic
962579559 3:136785441-136785463 CATGAAACATTCAGTAATTCAGG - Intergenic
963390451 3:144657100-144657122 CAATAACAATTCTGTAATCTAGG - Intergenic
963432860 3:145231684-145231706 AAAGAACCTTTCAGTATTGAAGG + Intergenic
966381760 3:179351563-179351585 GAAGATCCATTCAGTCAGGTTGG + Intronic
967020969 3:185522291-185522313 CAACAACACTTCAGTAATGAGGG - Intronic
971524811 4:27603668-27603690 CAGGAAACATTCAGTCATGGTGG + Intergenic
972108834 4:35528796-35528818 CAAGAACTATTAACTAATGAAGG - Intergenic
972875900 4:43359563-43359585 CAAGAAACATACAGTCATGGTGG - Intergenic
974328593 4:60446833-60446855 CAAGAAACATTCATTAAAGAAGG + Intergenic
974345000 4:60668361-60668383 AAAGCAACATTTAGTAATGTAGG - Intergenic
976559784 4:86488222-86488244 CAAGCACAATTCAGTAATATTGG + Intronic
977103001 4:92842555-92842577 CAACAACCACTCAGTAATGTAGG + Intronic
978077122 4:104545263-104545285 CAAGAAATATTTAATAATGTTGG - Intergenic
978631534 4:110752625-110752647 TAAAAATAATTCAGTAATGTGGG - Intergenic
979225072 4:118275519-118275541 CAGGAAACATTCAGTCATGGCGG - Intergenic
980608670 4:135127092-135127114 CAAAAAGCATTCATTAAAGTTGG + Intergenic
981142136 4:141281414-141281436 TAATAGACATTCAGTAATGTAGG - Intergenic
981287469 4:143035278-143035300 CAATGAACATTCAGTAAAGTGGG - Intergenic
984683670 4:182641136-182641158 CAATGATCCTTCAGTAATGTAGG - Intronic
985774028 5:1831389-1831411 CAAGCTCCATTCATTAATGAGGG - Intergenic
986424673 5:7619019-7619041 CCAGGACTATTCAGTAATTTGGG + Intronic
987012350 5:13780429-13780451 CAATAACTATTCTGAAATGTTGG + Intronic
987014273 5:13801329-13801351 CAGGAAACTTTCAGTTATGTTGG - Intronic
988146978 5:27322016-27322038 CAAGAATCTTTCAGTAATATAGG - Intergenic
988366915 5:30311367-30311389 CAGGAAACTTTCAGTAATGATGG - Intergenic
988784034 5:34549461-34549483 CAAGAATCGTTTAGTAAGGTTGG + Intergenic
989264345 5:39455718-39455740 CTAGAAACCTTCAGTAAAGTCGG - Intronic
989784144 5:45307045-45307067 CAAGAACCCCACAGTAATGAAGG + Intronic
992156662 5:73961962-73961984 CAGGTTCCATGCAGTAATGTTGG - Intergenic
996260255 5:121458061-121458083 CAAAAAGTATTCAGTCATGTTGG - Intergenic
996411706 5:123165649-123165671 CAAGATGCCATCAGTAATGTTGG + Intronic
997103667 5:130995055-130995077 CAAGAACCTTGCAGAAAAGTTGG + Intergenic
1000464584 5:161560047-161560069 CAAGAACCAATGAGTACTTTGGG + Intronic
1000773719 5:165389690-165389712 AAAGAACCATACAGAATTGTTGG + Intergenic
1004826445 6:19426482-19426504 CAAGAACGGATGAGTAATGTGGG + Intergenic
1005468416 6:26138152-26138174 GCAGAATCAATCAGTAATGTAGG - Exonic
1006241976 6:32690147-32690169 CAAGATCCAGTCAGTAGTGAAGG + Intergenic
1007016676 6:38475057-38475079 CAAGGAACATTTAATAATGTAGG + Intronic
1008038010 6:46766524-46766546 TAAGAACCATTGATTTATGTTGG - Intergenic
1008327434 6:50200434-50200456 CAAGATTCACTCAGTACTGTGGG + Intergenic
1008431941 6:51428693-51428715 CAAGAACCACTCAGGTAGGTAGG - Intergenic
1008693515 6:54007659-54007681 GAAGAACCAATCATTAAGGTGGG + Intronic
1015431754 6:133139510-133139532 CAAGAACAATTCAGTAGAGAAGG - Intergenic
1016773984 6:147883912-147883934 CAATAACCTTTCATTAATTTAGG - Intergenic
1017034711 6:150256874-150256896 CAAAAACCATGCAGAAATGAAGG + Intergenic
1017856106 6:158350570-158350592 CAAAAACCAGTCAGGAATGGTGG + Intronic
1018879900 6:167867243-167867265 CAAGAACGATTTGGTAATTTTGG + Intronic
1020845993 7:13284427-13284449 CAAGGACCATTCAGTATTTCAGG - Intergenic
1023298228 7:38739194-38739216 CAAGAACCATTCAGTAATGTAGG - Intronic
1027355356 7:77348902-77348924 TTAAAACCATTAAGTAATGTGGG - Intronic
1031784771 7:126015753-126015775 CAAGAACTAATGGGTAATGTGGG - Intergenic
1035951560 8:4027559-4027581 CAGGAACCATGCAGTTATGATGG - Intronic
1036487647 8:9194139-9194161 CAACAACTCTTCAGGAATGTGGG + Intergenic
1038316241 8:26486857-26486879 CAACAAACATTCAGGAATGAAGG - Intronic
1039324740 8:36472574-36472596 TTAGAACCAATCAGTAATGGAGG + Intergenic
1039671188 8:39601008-39601030 CAGGAAACATTCAGTCATGGTGG + Intronic
1039985761 8:42446584-42446606 CAAGATCCAATGAGTAATGCAGG + Intronic
1040935459 8:52777636-52777658 GAAAAATCATTCAGTAATGCAGG - Intergenic
1043836908 8:85059079-85059101 AAAGAACCAAACAGAAATGTTGG - Intergenic
1044558053 8:93586015-93586037 CAGGGACCATTCAGTGATGGAGG - Intergenic
1047837766 8:128712857-128712879 CAAGAACCATCCAGAAAAGAAGG + Intergenic
1048038076 8:130696432-130696454 CAAGAAGCTTCCAATAATGTTGG - Intergenic
1050070698 9:1810152-1810174 CTAGAACCATTCAGATAAGTTGG - Intergenic
1050714292 9:8504256-8504278 CTAGAACCATGCAGTCAAGTAGG - Exonic
1051894028 9:21970098-21970120 CAGAAACAATTGAGTAATGTTGG + Intronic
1054354384 9:64047525-64047547 AAAGAACCATTCAGCTATATGGG + Intergenic
1057390124 9:94635880-94635902 CAAGAAACATCCATTAATATCGG - Intronic
1058171810 9:101690559-101690581 AAAGAATCATTCAGTGGTGTGGG + Intronic
1058788719 9:108418920-108418942 CAAGAACAAATAAATAATGTAGG + Intergenic
1203742721 Un_GL000218v1:16649-16671 AAAGAACCATTCAGGTATATGGG + Intergenic
1203702918 Un_KI270742v1:11225-11247 AAAGAACCATTCAGGTATATGGG + Intergenic
1193140324 X:78019950-78019972 CAAGGAACATTTAGAAATGTGGG - Intronic
1194065398 X:89254308-89254330 CAAAAACCATTTAATAATTTTGG + Intergenic
1195608105 X:106832845-106832867 CAAGAAAAAATCAGTTATGTTGG - Intronic
1200291561 X:154880198-154880220 CACTATCCAATCAGTAATGTAGG + Intronic
1200719567 Y:6588390-6588412 CAAAAACCATTTAATAATTTTGG + Intergenic
1201628157 Y:16038434-16038456 CAAGAGCCATTCAGGAAGGTTGG + Intergenic
1202085511 Y:21132791-21132813 CAGGAAACATTCAGTCATGATGG + Intergenic