ID: 1023299009

View in Genome Browser
Species Human (GRCh38)
Location 7:38748574-38748596
Sequence ATAGTTCAGCAGATTTATAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023299009_1023299010 9 Left 1023299009 7:38748574-38748596 CCGGTATAAATCTGCTGAACTAT 0: 1
1: 0
2: 0
3: 6
4: 112
Right 1023299010 7:38748606-38748628 GATCTGCTCTTAACCACTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023299009 Original CRISPR ATAGTTCAGCAGATTTATAC CGG (reversed) Intronic
902500958 1:16911505-16911527 AAAGTTCAGAAGAGTAATACAGG - Intronic
905840155 1:41169802-41169824 AAAAAGCAGCAGATTTATACGGG - Intronic
906464821 1:46068640-46068662 CTAGTACAGCAGATATGTACGGG + Intronic
909981599 1:82108789-82108811 CTAATTCAACAGAATTATACTGG + Intergenic
912179224 1:107197583-107197605 AGAGTTCAACAGATTTGTGCAGG + Intronic
915883091 1:159693935-159693957 AGAGTACAGCAGATTTTTAGAGG + Intergenic
916965257 1:169933188-169933210 ATATTTCAAAAGATTTATAGTGG + Intronic
918803460 1:189004940-189004962 ATAGTTAAGCAGATGTTTAAAGG + Intergenic
918860359 1:189817439-189817461 ATACTTCAGCAGTCTTATATAGG + Intergenic
921430653 1:215061720-215061742 ATAATTCAACAGATTTAAAAGGG + Intronic
922028278 1:221773762-221773784 CTAATTCAGCAGATTTATTGCGG + Intergenic
923705988 1:236345285-236345307 ATAATTCAGCTGAATTATAGTGG + Intergenic
1063893760 10:10657075-10657097 ATTATTCAGCAGATTGATAGAGG + Intergenic
1065099229 10:22317057-22317079 CTAGTTCAGCATGTTTACACAGG + Intronic
1069844584 10:71362239-71362261 ATAGGTCAGCAAAGTTGTACAGG - Exonic
1075233833 10:120709094-120709116 ATAGTTCAAGAGATTTATTTGGG - Intergenic
1076021712 10:127079012-127079034 ATAATTCAGCTGTTTTATAAAGG - Intronic
1078487680 11:11739231-11739253 AGAGCTCAGCAAGTTTATACTGG + Intergenic
1085219573 11:74861989-74862011 ATAGTACAGCAGTATAATACGGG + Intronic
1085656965 11:78324347-78324369 ATAATTCAGGAGACTTACACAGG + Intronic
1086806539 11:91250964-91250986 ATAGTTCTGCACATGTATACTGG - Intergenic
1087603417 11:100344392-100344414 ATAGTTAAGCTGCTATATACAGG + Intronic
1093144766 12:15552393-15552415 ATAATTCAGCAGGTTAATATTGG - Intronic
1093277106 12:17142797-17142819 ATAGTTTAGCAGCTATTTACAGG - Intergenic
1098347611 12:69523069-69523091 AGAGTTCTGTAGATTTATATCGG + Intronic
1107183101 13:37485125-37485147 ATAATGCAGCAAAATTATACAGG + Intergenic
1107460921 13:40601579-40601601 ACAATTCAGAAGATTTATTCAGG - Intronic
1109061559 13:57628516-57628538 ATAGTTCTGAAGATTTTTATTGG - Intergenic
1109102123 13:58198896-58198918 ATAGTACAGTAAATTGATACTGG + Intergenic
1111600333 13:90465083-90465105 ATTTTTCAAAAGATTTATACGGG + Intergenic
1112877729 13:104065765-104065787 GTAGTCCAGGAGGTTTATACTGG - Intergenic
1119139423 14:72252542-72252564 ACACTTGAGCAGATTTGTACAGG - Intronic
1119167520 14:72507494-72507516 ATAGTTCAGCAGAAATAAATGGG - Intronic
1122308156 14:100778479-100778501 AGAGTTCAGCACATTTATCACGG + Intergenic
1123957804 15:25357763-25357785 TAAGTTCATCAGATTTATCCAGG - Intronic
1126869216 15:52969714-52969736 GTAGTTCAGCAGTCTGATACGGG - Intergenic
1127082751 15:55396652-55396674 ATATTTGAGGAGATTTATTCTGG + Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1128407570 15:67358561-67358583 AAAGTCCAGCACATTTAAACTGG - Intronic
1130999961 15:88932083-88932105 ACAGAACAGCAGATGTATACAGG + Intergenic
1138132162 16:54489615-54489637 ATGGTTCAGCAGGTGTAAACCGG + Intergenic
1144420731 17:15095659-15095681 ATATTTCAGCAGATATATCATGG - Intergenic
1144823424 17:18091281-18091303 ATACTTCAGCAGATTTTTGATGG - Intronic
1150318935 17:64193616-64193638 ATGGTTTAGGAGATTTATTCTGG - Exonic
1151849280 17:76680730-76680752 AGAGCTCAGCAGATTTATGGAGG + Intronic
1155686067 18:28552396-28552418 AATGTTCAGATGATTTATACTGG - Intergenic
1157992595 18:52515136-52515158 TTAGTTGAGCATATTTATGCGGG - Intronic
1158076790 18:53539584-53539606 TGGGTTCAGCAGAGTTATACTGG - Intergenic
933406118 2:81862051-81862073 TTAGTTCAGCAGTTTTCCACTGG + Intergenic
935802195 2:106708721-106708743 ATTATTCTGCACATTTATACAGG - Intergenic
936411551 2:112262577-112262599 AAAGTAGAGCAGATTAATACAGG + Intergenic
938653725 2:133409723-133409745 ATTGTTCATCAGATTTCTAAAGG + Intronic
939250375 2:139674288-139674310 ATAATTTAGGAGATTTATTCTGG - Intergenic
941104785 2:161340677-161340699 AGAGCTCAGCAGATTTATGGAGG + Intronic
941714591 2:168750190-168750212 AGAGTGCAACAGATTTTTACAGG - Intronic
942027056 2:171921117-171921139 ATAGTTGAGCAAATAAATACTGG + Intronic
945448663 2:209968296-209968318 ATAGTTCAACAGATTAACACTGG + Intronic
945503021 2:210601501-210601523 ATTGTGCAGCAGAGTTATCCTGG - Intronic
945696679 2:213115335-213115357 ATAGTATAGCATATTTATTCAGG - Intronic
946542724 2:220703020-220703042 ATAGTTCAGCACAATGACACTGG + Intergenic
947434980 2:230065583-230065605 ATTGCTCAGCAGATCTATAGGGG - Intronic
1170160128 20:13302347-13302369 ATAGTTCAGCAAATTTCCAGAGG - Intergenic
1174755309 20:53152705-53152727 ATATTTCAGCAGAGTGATATTGG - Intronic
1177186045 21:17798094-17798116 AAAGCTAAGCAGATTTAAACTGG - Intronic
1177681581 21:24378554-24378576 AAAGTTCTGAAGATTTATAAGGG + Intergenic
952671269 3:35972475-35972497 AAAGTTCAGCAAACTTATAAAGG + Intergenic
953285914 3:41609266-41609288 TTAGTTCAGCCCATTTATTCAGG + Intronic
956681535 3:71785624-71785646 TTTGTTCAGCAGGTCTATACTGG + Intergenic
958468722 3:94491380-94491402 ATAATTCAATACATTTATACAGG + Intergenic
958547177 3:95568329-95568351 ATAATTCAGCAGAATAATACTGG + Intergenic
958703428 3:97622149-97622171 AGAGTTCTGCAGATGGATACTGG - Intronic
958898923 3:99862754-99862776 ATAATTAAGAAGAGTTATACAGG - Intronic
963586692 3:147200502-147200524 ATGGTTCAGAAGATAAATACTGG - Intergenic
970053652 4:11946857-11946879 ATAGCTAAGCAGATTTTTAGAGG + Intergenic
970920959 4:21394515-21394537 ATAAGACAGCATATTTATACTGG - Intronic
971779314 4:31010966-31010988 ATATTTCAACAGATTTATCGGGG - Intronic
972754990 4:42037011-42037033 TTACTTCAGAAGATTAATACTGG + Intronic
973119141 4:46496804-46496826 GTAGATCAGCAAATTTATTCAGG + Intergenic
974556459 4:63456289-63456311 ACAATTTAGCAGATTTATTCAGG - Intergenic
975067118 4:70079720-70079742 ATACTTCAGCAGATTCCTAAAGG - Intergenic
979812897 4:125062325-125062347 ATAATTCAGCAGAGTAATGCAGG - Intergenic
986964144 5:13250428-13250450 ATAGTTCAGCTGATTGAGAATGG - Intergenic
988266771 5:28961935-28961957 AGAGATAAGCATATTTATACTGG - Intergenic
989553883 5:42768814-42768836 ATAGTTCCCCAGATATATGCAGG + Intronic
993162360 5:84308952-84308974 ATAGTTGATTAGATTTTTACAGG + Intronic
996257362 5:121421103-121421125 ATAGTACAGAAATTTTATACTGG + Intergenic
1000254263 5:159522993-159523015 ATAGTTTAGCAAATTTTTAATGG - Intergenic
1005394449 6:25367034-25367056 ATAGTTCAGCAAATGCATACTGG - Intronic
1005446618 6:25930627-25930649 ATACTTTTGCAGATTTTTACAGG + Exonic
1011654541 6:89538562-89538584 AAATTTCAGCAGAATTAAACAGG + Intronic
1013437539 6:110126227-110126249 ATAGTTAATCATATTTAAACTGG + Intronic
1014350174 6:120332142-120332164 AGAGTTCTAGAGATTTATACGGG + Intergenic
1015047720 6:128796924-128796946 CTAGGTCAGGATATTTATACTGG + Intergenic
1015617899 6:135098192-135098214 ATACTTCATCATTTTTATACTGG + Intronic
1015761200 6:136663334-136663356 ATGGTTCAGCAGAAATATTCAGG - Intronic
1017070799 6:150574019-150574041 ATATTACAGCAGATTTGTAAAGG - Intergenic
1021669575 7:23021694-23021716 TTAGTTCAGTGGATTTTTACAGG + Intergenic
1022628601 7:32063984-32064006 ATCGTTCAGCATATTTTTATTGG - Intronic
1023299009 7:38748574-38748596 ATAGTTCAGCAGATTTATACCGG - Intronic
1027249773 7:76391857-76391879 AAAGCTCAGCAGATTCACACCGG - Intronic
1035031892 7:155866249-155866271 ATGGTTCAACAGATTTCTGCAGG + Intergenic
1040735210 8:50498296-50498318 ACATTTCAGAAGATTTATAGTGG + Intronic
1041249440 8:55920128-55920150 ATAATTCAGCAGATTAATTGTGG + Intronic
1043817101 8:84814550-84814572 TTAGTACAGCACATTTATCCAGG - Intronic
1044216442 8:89616638-89616660 ATAGTCCAGCACATTTATAGAGG - Intergenic
1044233552 8:89805859-89805881 AGAGATCAGCAGATTCCTACAGG - Intergenic
1044476643 8:92634016-92634038 ATAATTCAGGACATATATACTGG + Intergenic
1045066717 8:98453942-98453964 ATGCTTCAGCAAATCTATACTGG - Intronic
1047131437 8:122024879-122024901 TTTGTTAAGCAGATTTATTCTGG + Intergenic
1050820749 9:9876966-9876988 ATAATTCAGCCTATTTATACAGG - Intronic
1053368978 9:37544628-37544650 TTAATTCTGCAGATTTGTACTGG + Intronic
1054988892 9:71297928-71297950 ATAGCTCAGCAGACTTAAAGAGG + Intronic
1187523094 X:20030752-20030774 AAAGAGCAGCAGTTTTATACCGG + Intronic
1188598937 X:31937151-31937173 AAAGTTTAGCAGAATTATATTGG - Intronic
1193597096 X:83460331-83460353 ACAATTCAGCAAAATTATACAGG - Intergenic
1194210866 X:91066844-91066866 ATATTTCAGCATATTCATAGTGG - Intergenic
1198998068 X:142599075-142599097 TTTGTTCAGCAAATATATACCGG - Intergenic
1199372772 X:147070895-147070917 ATAAATCAGAAGATTTATATGGG + Intergenic
1201060763 Y:10043983-10044005 ATATTTCAGCAGCTTTATTTTGG + Intergenic