ID: 1023299887

View in Genome Browser
Species Human (GRCh38)
Location 7:38758852-38758874
Sequence CCCTCCAAAGCCACTCCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 263}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023299887_1023299895 13 Left 1023299887 7:38758852-38758874 CCAAAAGGAGTGGCTTTGGAGGG 0: 1
1: 0
2: 3
3: 49
4: 263
Right 1023299895 7:38758888-38758910 GAACACCTGGAGGTTCCTGGAGG 0: 10
1: 80
2: 243
3: 344
4: 539
1023299887_1023299897 17 Left 1023299887 7:38758852-38758874 CCAAAAGGAGTGGCTTTGGAGGG 0: 1
1: 0
2: 3
3: 49
4: 263
Right 1023299897 7:38758892-38758914 ACCTGGAGGTTCCTGGAGGGTGG No data
1023299887_1023299894 10 Left 1023299887 7:38758852-38758874 CCAAAAGGAGTGGCTTTGGAGGG 0: 1
1: 0
2: 3
3: 49
4: 263
Right 1023299894 7:38758885-38758907 GCTGAACACCTGGAGGTTCCTGG 0: 10
1: 84
2: 258
3: 328
4: 514
1023299887_1023299892 3 Left 1023299887 7:38758852-38758874 CCAAAAGGAGTGGCTTTGGAGGG 0: 1
1: 0
2: 3
3: 49
4: 263
Right 1023299892 7:38758878-38758900 CCCAAGAGCTGAACACCTGGAGG No data
1023299887_1023299889 0 Left 1023299887 7:38758852-38758874 CCAAAAGGAGTGGCTTTGGAGGG 0: 1
1: 0
2: 3
3: 49
4: 263
Right 1023299889 7:38758875-38758897 CTCCCCAAGAGCTGAACACCTGG 0: 1
1: 0
2: 1
3: 20
4: 201
1023299887_1023299896 14 Left 1023299887 7:38758852-38758874 CCAAAAGGAGTGGCTTTGGAGGG 0: 1
1: 0
2: 3
3: 49
4: 263
Right 1023299896 7:38758889-38758911 AACACCTGGAGGTTCCTGGAGGG 0: 10
1: 83
2: 260
3: 301
4: 495

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023299887 Original CRISPR CCCTCCAAAGCCACTCCTTT TGG (reversed) Intronic
900138146 1:1127548-1127570 CCCTCCACAGCCACTCCCAGGGG + Intergenic
900620013 1:3582387-3582409 CCGTCCAAAGCCAGTCCAGTCGG + Intronic
902194916 1:14791286-14791308 TCCTCCAAAGCCACTTATCTGGG - Intronic
902703892 1:18191397-18191419 CCCTCTAAAGCCATTCCTCTAGG - Intronic
903128262 1:21262209-21262231 CCCTCCATAGCCCCTCGTTCAGG - Intronic
903128875 1:21265607-21265629 CCCTCCATAGCCCCTCGTTCAGG + Intronic
903679512 1:25087795-25087817 CCCTCCCCAGCCCCTCCATTTGG + Intergenic
903800299 1:25962192-25962214 CCCACCAAAACCAGTCCTTTTGG - Intronic
904214155 1:28906217-28906239 CCCTCCAAAGCTGCTACTATAGG - Intronic
904332511 1:29769777-29769799 CCCTCAAAAATCCCTCCTTTTGG + Intergenic
904730578 1:32587954-32587976 CACTCCAAATCCAGTCCTTTTGG - Intronic
905076653 1:35277818-35277840 CCCTCCCAAACCTCACCTTTGGG - Intronic
905159071 1:36015366-36015388 CTCTCCAAACCCCATCCTTTTGG + Intronic
905487652 1:38315309-38315331 CTCTCCAAATCCATTCCTTTTGG - Intergenic
905524411 1:38625424-38625446 GCCTCCAAATCCACTCCCTGGGG + Intergenic
906020144 1:42620937-42620959 TCCCCCAAACCCAGTCCTTTTGG + Intronic
906491289 1:46270826-46270848 CCATCCATGGCCAATCCTTTGGG + Intronic
908453578 1:64280384-64280406 CCCTTCAAAGTCACTGCTGTTGG - Intergenic
908457462 1:64318272-64318294 ACCCCCAAAGCCACCCATTTCGG - Intergenic
909676311 1:78242294-78242316 CTCCCCAAACCCAGTCCTTTGGG - Intergenic
910102961 1:83598332-83598354 CTCTCCAAAGCCATCCTTTTGGG + Intergenic
910582894 1:88847915-88847937 CTCTCTGAAGCCTCTCCTTTTGG - Intergenic
912374830 1:109201571-109201593 CCCTCCCCACCCACTCCTATTGG - Intronic
912680785 1:111727520-111727542 CCTTCCACAGACACTCCTATGGG + Exonic
913441899 1:118907137-118907159 CACCCCAAAGCCACTGCTGTTGG - Intronic
914256904 1:145967660-145967682 CTGTCCACATCCACTCCTTTAGG + Intronic
915059151 1:153165730-153165752 CCCTCCAAAGCCACACTTCCAGG - Intergenic
915936149 1:160091439-160091461 CCCTCCCAAGCCCCTCCCTCTGG - Exonic
918088106 1:181262679-181262701 CCAACCAAAGCCAGTCCTTGGGG - Intergenic
920081991 1:203381657-203381679 CCCTTCATAACCACCCCTTTGGG + Intergenic
920294213 1:204946065-204946087 CTCTCCAAAGCCCCACCTGTAGG + Intronic
920608883 1:207418060-207418082 CCCTCCAAGGTAACTTCTTTGGG - Intergenic
922059202 1:222071485-222071507 CTCTCCAAAACCACTTCTATTGG - Intergenic
923020171 1:230157295-230157317 CCCCCCAAAGCCACTCCCCTAGG - Intronic
923706730 1:236350176-236350198 CCCTGCAAAGCCATCCCTTGTGG - Intronic
924924617 1:248667053-248667075 CCCTGCAAAGCCAATTCTTCTGG + Intergenic
1063083403 10:2790117-2790139 CCCTCCAAAACCACACATTCAGG + Intergenic
1063695279 10:8329158-8329180 CTGTCCAAGGCTACTCCTTTAGG + Intergenic
1063966812 10:11352432-11352454 CCCCCCAGAGCCACACCTGTGGG + Intergenic
1064292738 10:14050732-14050754 CTCTCCAAAGCCTGTCCATTAGG - Intronic
1065865741 10:29913775-29913797 GCTTCCAAGGCCAGTCCTTTGGG - Intergenic
1067169528 10:43895265-43895287 CTCTCCAGACCCAGTCCTTTGGG - Intergenic
1069556425 10:69401491-69401513 GCCTCCAAAGCCCATCCTTGGGG + Exonic
1069920966 10:71815369-71815391 CCCTCCAAGGCCAGGCCTTGGGG + Exonic
1072752651 10:97994307-97994329 CTTCCCAAAGCCTCTCCTTTGGG + Intronic
1073215523 10:101834058-101834080 CCCTCCATATCTACTCCTTGAGG + Intronic
1073441086 10:103553141-103553163 GCCTCCAAAGCATCTTCTTTTGG + Intronic
1077961911 11:7084548-7084570 CTCTCCAAAGCCAGCCTTTTCGG - Intergenic
1078088888 11:8251569-8251591 CCCTACAAAGCCACCCCAGTGGG - Intronic
1078788353 11:14519281-14519303 CCCTCCATATCAACCCCTTTAGG + Intronic
1078933130 11:15928555-15928577 CCCTGCAAAGCAACTGCTGTGGG - Intergenic
1080270931 11:30449979-30450001 CCCCCCAAAACCACTTTTTTTGG + Intronic
1080625560 11:34027753-34027775 CTTTCCAAAACCAGTCCTTTTGG + Intergenic
1083084267 11:60126277-60126299 CCCTCCAAAACCTGTCCTTTTGG + Intergenic
1083350192 11:62022510-62022532 CTCTCCAAACCCAGCCCTTTTGG - Intergenic
1083707195 11:64524772-64524794 CTCTCCAAACCCAGTCCTTTTGG - Intergenic
1083932949 11:65855837-65855859 CCCTCCAAACCCACACATCTGGG + Intronic
1084660440 11:70543503-70543525 TCCTCCAAACCCTGTCCTTTTGG - Intronic
1085452673 11:76644851-76644873 CTCTCCAAACCCAGTCCTTTCGG - Intergenic
1085489689 11:76903778-76903800 CCCTGCAAAGCCACCTCTTATGG + Intronic
1085854796 11:80163884-80163906 CCAACCAAACCCCCTCCTTTTGG - Intergenic
1086729931 11:90236333-90236355 CTCTCCAAACCCAGTTCTTTTGG - Intergenic
1089090551 11:115871072-115871094 CCCCCCAATGCCACTCCTCAGGG - Intergenic
1089939660 11:122402527-122402549 CCCTCCAAAGCTGCTGTTTTAGG + Intergenic
1093635282 12:21459290-21459312 CTCTCCAAACCCAGTCCTTTTGG - Intronic
1095052752 12:37568711-37568733 CTCTCCAAATCCACTCCTTTTGG - Intergenic
1096296411 12:50388025-50388047 CTCTCCAAACCCTGTCCTTTGGG + Intronic
1097067653 12:56332952-56332974 GCCTCCAAGGCCACTCCCTCTGG + Exonic
1101462639 12:104912469-104912491 CTCTCCAAACCAAGTCCTTTTGG - Intronic
1102961490 12:117096323-117096345 TCCTCCAAGGCCATTCCCTTGGG - Intronic
1103377588 12:120469160-120469182 CCCTCCAAAGGCTCAGCTTTTGG + Intronic
1111008793 13:82285349-82285371 CCCTCCAAAATCAACCCTTTAGG + Intergenic
1111839000 13:93425873-93425895 CCCTCCCTACCCACTCCCTTAGG + Intronic
1113218187 13:108068175-108068197 CCCTGCAAAGCCATTCTTTGTGG + Intergenic
1113626763 13:111853449-111853471 CCCTCCAAAGCGACTCTTCCTGG + Intergenic
1117862301 14:60105082-60105104 CCCTACTAAGCATCTCCTTTGGG + Intronic
1119280250 14:73400752-73400774 CTCTCCAAACCCTGTCCTTTCGG - Intronic
1119540696 14:75436261-75436283 CCCTCCAAGGCCACTCCTGCAGG + Intronic
1119554106 14:75540304-75540326 CCCTCCTAAGCCCCTCCAGTAGG + Intronic
1119572540 14:75688311-75688333 CTCTCCAAACCCAGTCCTTTTGG - Intronic
1122747842 14:103910117-103910139 CCCTCCAAAGCCTCTGGTTGGGG + Intergenic
1124336098 15:28858260-28858282 CGCTCCAGAGCCACTCATTGTGG + Intergenic
1125525321 15:40370513-40370535 CCCTCCAAAACCCCTCCTGCTGG - Exonic
1128083921 15:64873134-64873156 TCCTCCGAAGCCTCTCCTTTGGG - Intronic
1128349872 15:66881600-66881622 CCCTCCAAAGCCCCTCACCTTGG + Intergenic
1129169420 15:73798604-73798626 CCCTCCAAAGCCCTGCCCTTGGG + Intergenic
1132138440 15:99367772-99367794 CTCTCCAAACCCAGTCCTTTGGG + Intronic
1133226263 16:4341900-4341922 ACCACCAAAGCCACTGCCTTGGG + Intronic
1135816553 16:25639571-25639593 CCATCTAAAGCCAGCCCTTTTGG - Intergenic
1136865802 16:33752193-33752215 CTCTCCAAATCCAATCCTTTTGG + Intergenic
1137307163 16:47213696-47213718 CTCTCCAAATCCTATCCTTTTGG - Intronic
1137452421 16:48589426-48589448 CTCTCCAAAGCCAGTCCATTTGG - Intronic
1140216179 16:73010710-73010732 CACTCCAGAGCCAGTCCTTTGGG + Intronic
1140407739 16:74722116-74722138 CCCTCCCAAGGGACTCCTCTGGG + Intronic
1141295802 16:82767918-82767940 CACTCTAGATCCACTCCTTTTGG - Intronic
1203106352 16_KI270728v1_random:1363910-1363932 CTCTCCAAATCCAATCCTTTTGG - Intergenic
1203127162 16_KI270728v1_random:1598458-1598480 CTCTCCAAATCCAATCCTTTTGG + Intergenic
1143408583 17:6694999-6695021 CCCTCCAAAGGCACACATCTAGG - Intronic
1143831581 17:9656232-9656254 CACGCCAAAGCCCGTCCTTTTGG - Intronic
1144068759 17:11647778-11647800 ATTTCCAAAGCCACTCCTCTGGG - Intronic
1145373271 17:22324646-22324668 CTCTCCGAATCCACTCCTTTTGG - Intergenic
1145895315 17:28454109-28454131 CTCTCCAAACCAATTCCTTTTGG + Intergenic
1145923175 17:28626671-28626693 CTCTCCAAACCCTGTCCTTTTGG - Intronic
1146097055 17:29940688-29940710 CTCTCCAAAGGCAGTACTTTTGG + Intronic
1146138848 17:30347292-30347314 CCCTCCAAACCCTGTCCTTTGGG - Intergenic
1147565046 17:41530830-41530852 GCCCCCAAAACAACTCCTTTGGG + Intergenic
1148506149 17:48128696-48128718 CCTTCCAGAGCCACTCCTGGTGG + Intergenic
1148819416 17:50351983-50352005 CTCTCCACTGCCACTCCTTATGG - Intronic
1150912929 17:69408048-69408070 CCTTCCTAACCTACTCCTTTGGG - Intergenic
1152051330 17:77980932-77980954 CTCTCCAAACCCAATCCTTTTGG + Intergenic
1154334699 18:13456195-13456217 CCCACCACAGCCAGTCATTTTGG - Intronic
1155646628 18:28086242-28086264 CACTGGAAAGCCACTTCTTTAGG - Intronic
1156384408 18:36592750-36592772 CCCTCCAAAGCCCCCACCTTAGG - Intronic
1156571845 18:38264496-38264518 CCCTCCAAGGCCACTCCTATTGG - Intergenic
1157353729 18:46914710-46914732 CCCTTCAAGGCTACTCATTTTGG - Intronic
1157409594 18:47452675-47452697 CTCTCCAAATCCTGTCCTTTGGG - Intergenic
1157768206 18:50319471-50319493 CTCTCCAAACCCAGTCCTTTTGG - Intergenic
1158297931 18:56019786-56019808 ACCTCCAAAGCCACTTAATTTGG + Intergenic
1158871681 18:61694189-61694211 CTCTCCAAAGCCAGTCTTTTTGG + Intergenic
1160053354 18:75456661-75456683 CTCACCAAAGACACTTCTTTAGG + Intergenic
1162296818 19:9819267-9819289 CCCTCCCCAGCCACGCCTTCCGG - Intronic
1162656481 19:12134995-12135017 CCCCCAAATGCCAGTCCTTTGGG - Intronic
1162839985 19:13349334-13349356 CCCTCCACATCCCCTCCTTGGGG + Intronic
1165294702 19:34917147-34917169 CTCACCAAAGCCAATCCTCTTGG + Intergenic
1166002656 19:39887036-39887058 CCCTCCAAAGACACTGGTTGGGG - Intronic
1166005442 19:39903288-39903310 CCCTCCAAAGACACTGGTTGGGG - Intronic
1166252454 19:41580718-41580740 CTCTTCAAACCCAGTCCTTTTGG + Intronic
1166542687 19:43615897-43615919 CTCTCCAAACCCAGTCCTCTTGG + Intronic
1166631962 19:44414856-44414878 CTCTCTAAACCCAGTCCTTTTGG + Intergenic
1166636219 19:44453784-44453806 CTCTCTAAACCCAGTCCTTTTGG - Intergenic
1166637082 19:44459853-44459875 CTCTCTAAACCCAGTCCTTTTGG - Intergenic
1166919561 19:46220074-46220096 CCCTCAAAGGCCAGTTCTTTAGG - Intergenic
1167562514 19:50234349-50234371 CCCTCCAAAGAAAGACCTTTAGG + Intronic
1167810485 19:51825354-51825376 CTCTCCAAATCCAGTCCTCTTGG + Exonic
1202649081 1_KI270706v1_random:164687-164709 CCCTCTGAACCCAGTCCTTTTGG + Intergenic
926766922 2:16330077-16330099 CTCTCCAAAGCCTCCCCTTGTGG - Intergenic
927175150 2:20400562-20400584 CTCTCCAAACCCCCTCATTTAGG - Intergenic
927745400 2:25615280-25615302 CTCTCCAAACCTAGTCCTTTTGG + Intronic
928175766 2:29033419-29033441 CCCTGGAGGGCCACTCCTTTTGG + Intronic
928839915 2:35593412-35593434 CCCTCTAAAGGTACTCTTTTTGG - Intergenic
929911412 2:46092652-46092674 CCCTCCTAAGCCTCTCCTTTGGG - Intronic
931976523 2:67649800-67649822 CTCTCCATGCCCACTCCTTTAGG + Intergenic
933235039 2:79855463-79855485 CCCTCCAGAGCCCCTCGTTCTGG + Intronic
933669136 2:84990234-84990256 CCCTTCACAGCCAAACCTTTGGG - Intronic
934634324 2:95969060-95969082 CTCTCCAAATCCAATCCTTTTGG + Intronic
934799308 2:97136179-97136201 CTCTCCAAATCCAATCCTTTTGG - Intronic
934834133 2:97567290-97567312 CTCTCCAAATCCAATCCTTTTGG + Intronic
934912511 2:98272451-98272473 CTCTCCAAACCCTGTCCTTTTGG + Intronic
935195189 2:100809557-100809579 CTCTCCGAACCCACTCCCTTGGG + Intergenic
936452478 2:112644109-112644131 CCCTGCAAACCCACTCCGATGGG + Intergenic
937295466 2:120807317-120807339 CCCTCCAAAGATACGCATTTTGG - Intronic
938174076 2:129108152-129108174 GCCTCCAGAGTGACTCCTTTGGG - Intergenic
938417048 2:131112226-131112248 CTCCCCAAACCCAATCCTTTTGG - Intronic
938541057 2:132283841-132283863 CTCTCTAAACCCAGTCCTTTTGG - Intergenic
938877294 2:135545733-135545755 CCCCCCAAATCCACTACATTTGG - Intronic
940338944 2:152559250-152559272 CCCTCCAGTGCCACTACGTTTGG - Intronic
941099417 2:161280484-161280506 CTCTCTAAACCCAGTCCTTTTGG + Intergenic
943863661 2:192899535-192899557 ATCTCCAAACCCAATCCTTTGGG + Intergenic
946050708 2:216860046-216860068 CCTTGCAAAGCCCCTCATTTTGG - Exonic
946406901 2:219496682-219496704 CCCTACCAAGCCACACGTTTAGG + Intronic
947824701 2:233097775-233097797 CCTTCCAATGCAACTCATTTAGG + Intronic
948790202 2:240372859-240372881 CCCCCCAGGGCCACTCCTGTTGG + Intergenic
1168984821 20:2039064-2039086 CCCTCCTAAACCACTCCTCATGG + Intergenic
1169199079 20:3698976-3698998 CCCTCCAATGCCAGCCCTGTGGG - Intronic
1170653891 20:18268176-18268198 CTCCCCAAACCCAGTCCTTTGGG - Intergenic
1171529523 20:25843677-25843699 CTCTCCGAATCCACTCCTTTGGG + Intronic
1171547303 20:26012203-26012225 CTCTCCGAATCCACTCCTTTGGG - Intergenic
1171810942 20:29743814-29743836 ACCCCCAAAGGCACACCTTTCGG + Intergenic
1171869966 20:30516846-30516868 CTCTCTAAACCCAGTCCTTTTGG - Intergenic
1175012579 20:55754549-55754571 CTCTCCAAACCCAGTCCTCTTGG + Intergenic
1176602733 21:8807855-8807877 CCCTCTGAACCCAGTCCTTTTGG - Intergenic
1176611649 21:8989531-8989553 CTCTCTACAGCCATTCCTTTTGG + Intergenic
1177322782 21:19544212-19544234 CTCTCCAAACCCTATCCTTTTGG - Intergenic
1178421177 21:32444592-32444614 CTCTCCAAACCCAGTTCTTTTGG + Intronic
1179972184 21:44842354-44842376 CCCTCCTGAGGCTCTCCTTTAGG + Intergenic
1179986278 21:44922193-44922215 CCCTCCCAACCCAGTCCTCTAGG - Intronic
1180345018 22:11699412-11699434 CCCTCTGAACCCAGTCCTTTTGG - Intergenic
1181648717 22:24247391-24247413 CCTTCCAAACCCACTCCCTCTGG + Intergenic
1182035769 22:27197159-27197181 CCCTTCAAAGCCACAGCCTTGGG + Intergenic
1183504186 22:38200009-38200031 GCCTCCAAAGCCATCTCTTTTGG + Intronic
1183746293 22:39693961-39693983 GCCCCCACAGCCACTCCTCTTGG - Intergenic
1184998550 22:48227741-48227763 TCCACCAAAGCCACCCCTTCTGG + Intergenic
950336231 3:12195708-12195730 CCCTTCAAAGCAATTCCTTTGGG + Intergenic
951563326 3:23989221-23989243 ACCTCCTGAGCCACCCCTTTGGG + Intergenic
954071181 3:48143982-48144004 CCCTCCAGACCCACTCCTGTGGG + Intergenic
954090518 3:48280104-48280126 CATTCCACAGCCTCTCCTTTGGG - Intronic
954866651 3:53735475-53735497 CCATCCGCAGCCACTCCTTCCGG + Exonic
955320120 3:57968388-57968410 CTCTCCAAACCCAGTCCTCTTGG - Intergenic
955942258 3:64157744-64157766 CCCTCCCCAGCCACTCCTGGTGG - Intronic
957050211 3:75405947-75405969 CTCTCCAAACCCAATTCTTTTGG - Intergenic
957949516 3:87107092-87107114 CCCTCCGAAGCCATGCCTTGAGG - Intergenic
960080556 3:113535794-113535816 CCCTCAAAAGCCACTTATTGTGG + Intronic
960324350 3:116276893-116276915 CATTCCAAAGCCCCTCCTTAGGG - Intronic
960427945 3:117531835-117531857 CACTCTAAAGCCACTCCCATGGG + Intergenic
961173194 3:124813744-124813766 CCCTCCAAATCCAGGCCTTCTGG + Intronic
961882525 3:130072384-130072406 CTCTCCAAACCCAATTCTTTTGG - Intergenic
962625435 3:137221185-137221207 CCCTGCAAAGCCACAGCCTTTGG - Intergenic
963146977 3:142004063-142004085 CCCTCCTCAGCCACTACTATAGG - Intronic
964884590 3:161466656-161466678 CACTCCAAATCCAGTCCTGTAGG - Intergenic
965961592 3:174435674-174435696 CTCTCCAAATCCTGTCCTTTGGG + Intergenic
967409594 3:189154003-189154025 CTCTCCAAAGCCAGCCCTTTGGG + Intronic
967438073 3:189474407-189474429 TCCTCATAATCCACTCCTTTTGG + Intergenic
967594596 3:191314799-191314821 CTCTCTGAACCCACTCCTTTGGG - Intronic
969128395 4:4971795-4971817 CTCTCCAAACTCAGTCCTTTTGG + Intergenic
970587840 4:17531358-17531380 CTCTCCAAACCCAGTTCTTTTGG - Intergenic
972030464 4:34450842-34450864 CTCTCCAAAACCTGTCCTTTGGG - Intergenic
973218693 4:47700711-47700733 CCCCACACAGCCATTCCTTTTGG + Intronic
973247916 4:48030139-48030161 CCCACCAGAGCCATTCCTTCAGG - Exonic
973816891 4:54627315-54627337 CTCCCCAAAGCCTGTCCTTTGGG + Intergenic
974868874 4:67613898-67613920 CCCTGCAAAGCCATCCCTTGTGG + Exonic
975608813 4:76183610-76183632 CTCTCCAAATTCAGTCCTTTTGG + Intronic
976933845 4:90603763-90603785 CCCTGGAAAGCAACTGCTTTTGG - Intronic
978522360 4:109629801-109629823 CTCTCCAAACACAGTCCTTTTGG + Intronic
979292250 4:118991009-118991031 CCTTCCAAGTCAACTCCTTTGGG + Intronic
981066557 4:140492204-140492226 TCCTCCAAAGCCTCTCCTCGTGG - Intronic
982230796 4:153206575-153206597 CCCTCCAGACCCGCTCCTTTGGG + Intronic
983609437 4:169626331-169626353 CTCTCTGAATCCACTCCTTTTGG + Intronic
984920267 4:184757846-184757868 CCCTTCAAATCCTCTCTTTTGGG + Exonic
985486965 5:157336-157358 GCCTCCAGAGCCACTTCTTGAGG - Intronic
985564725 5:609717-609739 CCCTGAAAAGCCACTGCTGTTGG + Intergenic
986512704 5:8525131-8525153 CCCTCTGAACCCAGTCCTTTTGG - Intergenic
986893092 5:12332752-12332774 CCCTGCAAAGCCATCCTTTTGGG - Intergenic
987119455 5:14753071-14753093 CCATCCAGGGCCACTCCTCTGGG - Intronic
987908234 5:24106671-24106693 CCCTGCAAAGCCATTCTTTGTGG + Intronic
989422139 5:41252599-41252621 CCCTGCAAAGCCATCTCTTTTGG + Intronic
992212332 5:74493113-74493135 CTCTCCAAACCCAGTTCTTTTGG + Intergenic
994439605 5:99785414-99785436 CTCTCCAAACCCAGTACTTTTGG + Intergenic
996174175 5:120334295-120334317 TCTTACAAAGCCACTCCTTTGGG - Intergenic
998108905 5:139486303-139486325 CCCACCATTCCCACTCCTTTTGG - Intergenic
998367199 5:141639226-141639248 ACCTCTAGTGCCACTCCTTTGGG + Intronic
999392787 5:151206325-151206347 CTCTCCAAACCCAATCCTCTCGG + Intronic
1000112445 5:158121893-158121915 CTCTCCAAAGTCACTCTTCTAGG + Intergenic
1000595304 5:163208780-163208802 CCCTTCAAAGCTAGTCCTTTTGG + Intergenic
1001943093 5:175754397-175754419 CCCTCCAAAGGCATTGCATTGGG + Intergenic
1002857425 6:1050655-1050677 CTCCCCAAACCCAGTCCTTTTGG + Intergenic
1003706956 6:8543182-8543204 CTCTCTAAACCCAGTCCTTTTGG + Intergenic
1004931125 6:20464135-20464157 CTCTCCAAACCCAGTCCTTCGGG + Intronic
1005987410 6:30883693-30883715 CCCTCCCACTCCACTCCGTTGGG + Intronic
1007120731 6:39378614-39378636 CCCCCCAGGGCCACTCCTTCTGG + Intronic
1007770190 6:44185985-44186007 CCCTCCACAGCCTCCCCTTCTGG + Intergenic
1007893624 6:45322844-45322866 CTCTCCAGTGCCACTGCTTTTGG - Intronic
1008505032 6:52221714-52221736 CACTCCAAAGCCATTCTCTTTGG + Intergenic
1011239781 6:85258679-85258701 CTCTCCAAAACCTGTCCTTTTGG + Intergenic
1016951809 6:149587695-149587717 CTCTCCAAAGCTAGTCCTTTTGG + Intronic
1018635955 6:165859627-165859649 CTCTCCAAATCCAATCCTTTTGG + Intronic
1020983742 7:15106270-15106292 CCATCTAAAGTCCCTCCTTTAGG - Intergenic
1021737384 7:23653325-23653347 CTCTCCAAACCCCGTCCTTTTGG + Intergenic
1022011059 7:26308517-26308539 CCCTCCAAACCCTGTCCTCTTGG - Intronic
1022831061 7:34067269-34067291 CCCACCACAGCCACTCGTTTTGG + Intronic
1023299887 7:38758852-38758874 CCCTCCAAAGCCACTCCTTTTGG - Intronic
1023898571 7:44455513-44455535 CCCTCCAAGCCCAATCCTTCAGG + Intronic
1024302637 7:47899485-47899507 CCCTCCACACCCCCTACTTTGGG + Intronic
1025270521 7:57508617-57508639 CTCTCCAAAACCTGTCCTTTGGG + Intergenic
1028104965 7:86866293-86866315 TCCTCCAAAGCCAGTCCTGTTGG - Intergenic
1028625603 7:92873395-92873417 CATACCAAAGCCAATCCTTTTGG + Intergenic
1030128607 7:106178348-106178370 CTCTCCCAAGCCACTGTTTTGGG + Intergenic
1030735454 7:113042727-113042749 CCCACCAATGCCATTCCTGTTGG + Intergenic
1032192253 7:129771828-129771850 CCCCACCAAGCCTCTCCTTTCGG - Intergenic
1032374674 7:131399953-131399975 CCCTCCAAAGCCAATACCCTGGG - Intronic
1032991570 7:137400262-137400284 ACATTCTAAGCCACTCCTTTTGG + Intronic
1033067845 7:138173083-138173105 TTCTCCAAAGCCAGTCCTCTTGG - Intergenic
1033098477 7:138450771-138450793 CCCTCCAAATCCCGTCGTTTAGG - Intergenic
1033148932 7:138896332-138896354 CCCTCCCTTGCCACTCCCTTAGG - Intronic
1034965995 7:155391410-155391432 CCCTGCAAACCCACTCCCTCGGG + Intronic
1035518683 8:258498-258520 CCCTCAAAAGCTACTCCTACAGG + Intergenic
1036989718 8:13578817-13578839 CCCTCCAAACCCTGTCCTTTAGG + Intergenic
1037469941 8:19198107-19198129 CAATCCAAAGCCACACCCTTTGG + Intergenic
1038176813 8:25187773-25187795 CCCTGCAGAGTCCCTCCTTTGGG + Intronic
1038491491 8:27975187-27975209 CTCTCCAAACCCAGTCCTTTTGG - Intronic
1038733034 8:30144583-30144605 ACAGCCAAAGCCACTCCATTAGG + Exonic
1038848953 8:31255516-31255538 CTCTCCAAACCCAGTCCTCTTGG + Intergenic
1040023995 8:42764935-42764957 CCCTTCAAAGCCATCCATTTGGG - Intronic
1045557056 8:103224737-103224759 CCCTGCAAAGCCACCCCTTGTGG - Intronic
1047522506 8:125606027-125606049 CCCTGCAAAGCCACCCGTTGTGG - Intergenic
1048888995 8:138931440-138931462 CCCACCAAAGCCCCTCATTATGG - Intergenic
1049389823 8:142361925-142361947 CTCTCCAAAGCCTACCCTTTGGG + Intronic
1050419117 9:5444560-5444582 CTCTCCAAATCCCCTCATTTAGG - Intergenic
1050710476 9:8456436-8456458 CACTCCCCTGCCACTCCTTTTGG - Intronic
1051195791 9:14561875-14561897 CCCTGCAAAGCCACATTTTTTGG - Intergenic
1051679597 9:19593745-19593767 CCCCCCAAAGCCCCGCCCTTTGG - Intronic
1051975174 9:22940530-22940552 CCCTGCAAAGCCACCTCTTGTGG + Intergenic
1053072310 9:35108433-35108455 CCCATCAAAGTCACCCCTTTAGG - Intronic
1053430755 9:38040392-38040414 CCTTCCCAAGCCCCCCCTTTAGG - Intronic
1053797499 9:41739975-41739997 CTCTCCGAATCCACTCCTTTTGG + Intergenic
1054147689 9:61574968-61574990 CTCTCCGAATCCACTCCTTTTGG - Intergenic
1054185911 9:61952027-61952049 CTCTCCGAATCCACTCCTTTTGG + Intergenic
1054467437 9:65506015-65506037 CTCTCCGAATCCACTCCTTTTGG - Intergenic
1054652594 9:67636492-67636514 CTCTCCGAATCCACTCCTTTTGG - Intergenic
1054918977 9:70522847-70522869 CTCTCCAAACCCTGTCCTTTTGG + Intergenic
1055755630 9:79554754-79554776 CCTCCCAAAACCACTGCTTTGGG - Intergenic
1055788644 9:79898227-79898249 CCCACCAGAGCTACTCCTTCAGG + Intergenic
1056177921 9:84053476-84053498 CCCTCCACATTCTCTCCTTTGGG - Intergenic
1057526858 9:95810652-95810674 CTCTCCAAACCCTGTCCTTTTGG + Intergenic
1057550145 9:96046436-96046458 CTCTCCAAACCCTGTCCTTTTGG - Intergenic
1059142867 9:111870567-111870589 CTCTCCAAACCCTATCCTTTTGG - Intergenic
1203567757 Un_KI270744v1:105987-106009 CTCTCTAAACCCAGTCCTTTTGG - Intergenic
1203568817 Un_KI270744v1:112972-112994 CTCTCTAAACCCAGTCCTTTTGG - Intergenic
1185936470 X:4262437-4262459 CTCTCCAAACTCAGTCCTTTTGG + Intergenic
1186741395 X:12522161-12522183 CTCACAAAAGCCACCCCTTTGGG + Intronic
1187057359 X:15753565-15753587 CCCTGCAAAGCCATCCCTTGTGG - Intronic
1188660738 X:32755005-32755027 CCCTTCAAAGCCTTTCCTTACGG + Intronic
1189286357 X:39854796-39854818 CCCTCCAGAGCTCCTCCTTTGGG + Intergenic
1189831749 X:44981496-44981518 CTCTCCAAACCCTGTCCTTTTGG + Intronic
1190097494 X:47493378-47493400 TCATCCAAAGCCAGTTCTTTTGG + Intergenic
1194483567 X:94457519-94457541 CCCTTCAAAGCCACCTCTTGTGG - Intergenic
1195087268 X:101424180-101424202 CTCTCCAAACCCAATTCTTTCGG - Intronic
1195362798 X:104101265-104101287 CTCTCCAAACCCAGTGCTTTGGG + Exonic
1196972949 X:121129742-121129764 GCCACCACAGCCATTCCTTTGGG + Intergenic
1198434925 X:136607853-136607875 CCCTGCAAAGCCATTCTTTGTGG - Intergenic
1199340107 X:146667654-146667676 CCCACCAAAGCCTCTCCTATAGG - Intergenic
1199743658 X:150758263-150758285 CCCTCCACACCCAGTCCTCTGGG + Intronic
1200067644 X:153511866-153511888 CCCTCCACAGCCACTCCCCGAGG - Intergenic
1201720761 Y:17094342-17094364 CTCTCCAAACTCAGTCCTTTTGG + Intergenic
1201858487 Y:18570650-18570672 ACTTCCAAAGCCTCTCCTCTCGG - Intronic
1201874834 Y:18749731-18749753 ACTTCCAAAGCCTCTCCTCTCGG + Intronic
1202586183 Y:26430384-26430406 CTCTCCAAATCCAATCCTTTTGG - Intergenic