ID: 1023300431

View in Genome Browser
Species Human (GRCh38)
Location 7:38764643-38764665
Sequence GAGATTAAACAGAATGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 414}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023300426_1023300431 15 Left 1023300426 7:38764605-38764627 CCCGATTGGTATTGACATGAAAA 0: 1
1: 0
2: 2
3: 12
4: 176
Right 1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG 0: 1
1: 0
2: 2
3: 43
4: 414
1023300427_1023300431 14 Left 1023300427 7:38764606-38764628 CCGATTGGTATTGACATGAAAAA 0: 1
1: 0
2: 2
3: 21
4: 249
Right 1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG 0: 1
1: 0
2: 2
3: 43
4: 414
1023300425_1023300431 16 Left 1023300425 7:38764604-38764626 CCCCGATTGGTATTGACATGAAA 0: 1
1: 0
2: 0
3: 1
4: 54
Right 1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG 0: 1
1: 0
2: 2
3: 43
4: 414

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023300431 Original CRISPR GAGATTAAACAGAATGAGGA GGG Intronic
900741636 1:4333794-4333816 GAGAATCAACAGAATGAGGAAGG + Intergenic
901146070 1:7065419-7065441 GAGACGAAAAAGAATGGGGATGG + Intronic
903207296 1:21792192-21792214 GGGGCTAGACAGAATGAGGATGG - Intergenic
903286183 1:22278179-22278201 GAGATAAAAGAGAGAGAGGAAGG + Intergenic
904424995 1:30417374-30417396 GTGGGTCAACAGAATGAGGAAGG + Intergenic
904928623 1:34068239-34068261 GAGAATGACCAGGATGAGGAAGG - Intronic
905183669 1:36181161-36181183 GAGATTATTTGGAATGAGGAAGG - Intergenic
907342622 1:53747793-53747815 GAGAAAACACAGGATGAGGAGGG - Intergenic
908091663 1:60692282-60692304 GTGATTAAACTTAGTGAGGAAGG + Intergenic
908415002 1:63904562-63904584 GAATTTAAAGAGAAGGAGGAAGG - Intronic
908434028 1:64087288-64087310 GAGATTGACTAGCATGAGGAGGG + Intronic
908621952 1:65991994-65992016 GAGCTTAAACAGAAGAATGAGGG + Intronic
909738850 1:79002607-79002629 TAGAATAAACTGAATTAGGAAGG + Intronic
909758592 1:79260596-79260618 GAGGTAGACCAGAATGAGGAAGG + Intergenic
910605916 1:89084416-89084438 GACATAAAATAAAATGAGGATGG + Intergenic
910843736 1:91585933-91585955 GAGCTTAAACACAGGGAGGAGGG + Intergenic
911215240 1:95185930-95185952 GAGACAAAAGTGAATGAGGAAGG + Intronic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
911672178 1:100619806-100619828 GCCATTAACCAGAATGACGAAGG - Intergenic
911720633 1:101187467-101187489 AAGAGTAAACAAAATGTGGAAGG + Intergenic
913007808 1:114651959-114651981 GAGCTTCAGCAGAATGAGGAGGG + Intronic
916608271 1:166364125-166364147 GAGGCCAAAAAGAATGAGGAGGG - Intergenic
917316868 1:173735096-173735118 GTGATTACACAGAAAGAAGAGGG + Intronic
917639402 1:176968533-176968555 GACATTAAACACAAAGAGCAGGG + Intronic
917704683 1:177620121-177620143 GAGATCAAAAAGGAAGAGGAAGG - Intergenic
917881328 1:179339488-179339510 GAGGATAAAGAGAATGAGGAGGG - Exonic
918935966 1:190922847-190922869 GAGATTAAACAGACAGGTGAGGG - Intergenic
919956658 1:202424028-202424050 GAGATAAAACTGATTGAGGCTGG - Intronic
920228201 1:204453111-204453133 CAGATTAAAGAGACTGAGGAGGG - Intronic
920473801 1:206255272-206255294 AGGATTAAACAGAATGGGGTGGG + Intronic
921657836 1:217761979-217762001 GAGGTGGAACAGCATGAGGACGG - Intronic
921983385 1:221283272-221283294 GACATTCAACAGAGTGAGGCAGG - Intergenic
922109745 1:222545519-222545541 GAGAGTGGACAGAATGAGCAAGG - Intronic
922350733 1:224732946-224732968 AAGAAAAAAAAGAATGAGGAGGG + Intronic
922364447 1:224851045-224851067 GACATTAGACAGCACGAGGATGG - Intergenic
922624164 1:227020833-227020855 ATGATTAAACTTAATGAGGAAGG - Intronic
922636354 1:227176383-227176405 GAAATGAAACAGAATGATTATGG - Intronic
924203532 1:241686400-241686422 GACATTAAACAGAGTGGGGAGGG - Intronic
924659525 1:246003539-246003561 GAGATAAAAAGGAATGGGGAGGG - Intronic
924768904 1:247061888-247061910 GGGATTAAACAAAATGATAAGGG + Intronic
1063090852 10:2865245-2865267 GAGATTACACAGCAGGAGGTGGG - Intergenic
1064054033 10:12082330-12082352 GAAAGAAAACAGAATGAGGCGGG - Intronic
1066379896 10:34892328-34892350 TCGAGGAAACAGAATGAGGAGGG + Intergenic
1066466273 10:35653110-35653132 AAGAGTGACCAGAATGAGGATGG + Intergenic
1067400540 10:45969683-45969705 GTGTTTAAAGAGTATGAGGAAGG - Intergenic
1067512349 10:46906497-46906519 GAGAGCAAAGAGAAAGAGGATGG + Intergenic
1067649894 10:48145325-48145347 GAGAGCAAAGAGAAAGAGGATGG - Intergenic
1068438721 10:57023018-57023040 GAGATTTAAAGGAAAGAGGAAGG + Intergenic
1069686819 10:70324049-70324071 GAGAGAGAACAGGATGAGGAGGG + Intronic
1070365491 10:75732887-75732909 GAGCTGAAAAAGATTGAGGAGGG + Intronic
1071049929 10:81435022-81435044 GAGAGTGAGCAGGATGAGGAGGG + Intergenic
1071069084 10:81670334-81670356 AAGATTAAACAGAATTGAGAAGG - Intergenic
1071101208 10:82039860-82039882 GGGATTGCAAAGAATGAGGAAGG - Intronic
1072519525 10:96218784-96218806 TAGATAAGACAGAAAGAGGAGGG - Intronic
1072689976 10:97566112-97566134 GAGATTATAAAGAATGACCAAGG - Intronic
1073337635 10:102722057-102722079 GAGAATAAACAGGATGTGGATGG - Intronic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1074369191 10:112885748-112885770 GAGATTAAAGAGACTGAGGGGGG + Intergenic
1074507617 10:114085582-114085604 GAGATTCAGCCGAGTGAGGATGG - Intergenic
1076464435 10:130668838-130668860 GAGACTAATCAGGATAAGGAAGG + Intergenic
1078646225 11:13143248-13143270 GTGATGAAGCAGAATGATGAAGG + Intergenic
1078895070 11:15590791-15590813 GAGATTAAAAAGGAAGAGGAAGG - Intergenic
1079068195 11:17317218-17317240 GAGATTAAAAATAGAGAGGAGGG - Intronic
1080181262 11:29429198-29429220 GAGGTACAGCAGAATGAGGAAGG - Intergenic
1081011285 11:37815673-37815695 GAGACTAAACAGAAATATGAAGG - Intergenic
1082910462 11:58367879-58367901 GAGAATAAGCAAAATGATGAAGG - Intergenic
1082950078 11:58805326-58805348 GAGGTAAAACTGCATGAGGAGGG - Intergenic
1084580719 11:70021503-70021525 GAAATTAAACAGAAACAGAATGG + Intergenic
1085177448 11:74503003-74503025 GAGATGACACAGGGTGAGGATGG - Intronic
1085782893 11:79425347-79425369 GAGATTAGACAGCTTGTGGAGGG - Intronic
1086522193 11:87681989-87682011 GAAATGAAAGAGAATGAGAAAGG + Intergenic
1086527300 11:87742836-87742858 GAGCTTATCCAAAATGAGGAGGG + Intergenic
1087205478 11:95389433-95389455 GTCATCAAACAGAATGAGAAGGG - Intergenic
1087342173 11:96920633-96920655 GAGATCATACAGGATTAGGATGG + Intergenic
1088107172 11:106220408-106220430 GAGATATAACAGAATAAGGAAGG + Intergenic
1088181648 11:107120127-107120149 GAGAGGAAACAGATTGAGGAAGG + Intergenic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1088689177 11:112310859-112310881 GGGCTTGAACAGACTGAGGAGGG + Intergenic
1088840464 11:113623456-113623478 GAGATGAAATAAAATGAGCATGG + Intergenic
1089944443 11:122453746-122453768 AAGAGGAAACATAATGAGGAAGG + Intergenic
1090725606 11:129524189-129524211 GAGAGAAAACAGAATTAGAATGG + Intergenic
1090800451 11:130168202-130168224 AAGAGCAAACAGAATGAGGAAGG + Intronic
1090819996 11:130333280-130333302 TAGATAAAACTGAATGAGGCTGG - Intergenic
1090844686 11:130520666-130520688 GAAATTAAAAAGACTGGGGAGGG + Intergenic
1092076940 12:5681682-5681704 GATATGAAACTGAATAAGGAAGG - Intronic
1092630848 12:10374673-10374695 GATATTAAAAAGAATGAGGCCGG - Intronic
1093312632 12:17609178-17609200 TAGCTTAAGCAGACTGAGGAGGG + Intergenic
1093815911 12:23546366-23546388 GCAGTTAAACAGAATGAAGAAGG - Exonic
1095214987 12:39537920-39537942 CAGATGAATCAGAATGAGGCAGG + Intergenic
1095651376 12:44613955-44613977 AAAATTAAATAGAATAAGGAAGG + Intronic
1095694383 12:45128196-45128218 GAAATTAAAAAGGATTAGGAAGG - Intergenic
1096188424 12:49599134-49599156 GGGATGAAACAGAAAGAGAAAGG + Intronic
1096973073 12:55682833-55682855 GGGATTAAGCAGAGTGTGGACGG + Intronic
1096977828 12:55709566-55709588 GATATTAAAAAGGATGGGGAGGG - Intronic
1097914787 12:65009339-65009361 GAGATAATATTGAATGAGGATGG - Intergenic
1098200692 12:68052247-68052269 GATGATAAACAGAATGAGTATGG + Intergenic
1098666945 12:73176229-73176251 GAGATTACAAAGTAGGAGGAGGG + Intergenic
1098826984 12:75308814-75308836 GAGATTAAAAAAAATGAGTAAGG + Intronic
1099698911 12:86059926-86059948 GATCTTATACAGAATGAGAACGG + Intronic
1101234229 12:102772144-102772166 CAGATTAAACTAAATGGGGATGG + Intergenic
1102590009 12:113949870-113949892 GAGAGTAAACTGACTTAGGAGGG - Intronic
1102798375 12:115709533-115709555 GAGATTAAAGAGAGTGAGAGAGG + Intergenic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1103262475 12:119599837-119599859 AAGATTAAACAGAATGACTGTGG + Intronic
1103472331 12:121191856-121191878 GAGATTGGACAGAACGGGGAAGG - Intergenic
1104163091 12:126199647-126199669 GAGATTAAACAGAGGAATGATGG + Intergenic
1104193351 12:126505362-126505384 TAGATTAAATAGATGGAGGATGG + Intergenic
1105432826 13:20352533-20352555 GAGGTCAAATAAAATGAGGATGG - Intergenic
1106906033 13:34409656-34409678 GAGATTATACAGAGTGTGGTGGG - Intergenic
1107112361 13:36711772-36711794 GAGAGTCAACAGCATGTGGATGG - Intergenic
1108475270 13:50810146-50810168 GAAAGTATAGAGAATGAGGATGG - Intronic
1109180101 13:59203256-59203278 GAGATTATACTGAATAAGGGTGG + Intergenic
1111176998 13:84607886-84607908 GAGGTGAAAGAGTATGAGGAAGG + Intergenic
1111639805 13:90953410-90953432 GAGATTATCCAGGATGAGAAGGG - Intergenic
1112034083 13:95481598-95481620 GATATTTAAGAGAATGAGCATGG + Intronic
1112900622 13:104352799-104352821 GAGATGAAACAGGGTGAGGTGGG - Intergenic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1114188878 14:20425685-20425707 AAGATGAAAGAGAATGAAGATGG + Intergenic
1114341197 14:21746398-21746420 GGAAGTAAACAGAATGATGAAGG + Intergenic
1114651112 14:24285044-24285066 TACATTAAACAGGAAGAGGATGG - Intergenic
1115510381 14:34132506-34132528 GGGATTAAGGAGAATGAGGTTGG - Intronic
1116183181 14:41561672-41561694 GAGACTAAAGTGAAAGAGGATGG - Intergenic
1116492794 14:45526426-45526448 GAGATAACACTGAATGTGGATGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117950003 14:61073338-61073360 GATATTAAACCTACTGAGGAAGG + Intronic
1118467826 14:66046765-66046787 AAGGTTAAACTGAATGAGGGAGG + Intergenic
1119404836 14:74391647-74391669 GACATTAAAAAGAATGAAGCAGG - Intergenic
1119816463 14:77573115-77573137 GAGATTAAATTTAGTGAGGAAGG - Intronic
1120172621 14:81260840-81260862 GAGGTTACACTGAATGAGAATGG + Exonic
1120664979 14:87295057-87295079 GAGAGCAAACTGATTGAGGAAGG + Intergenic
1121216527 14:92252815-92252837 GAGAGAAAACAGAAGAAGGAGGG + Intergenic
1122076712 14:99239843-99239865 TGGAATAAACAGAAGGAGGAAGG + Intronic
1122252647 14:100450821-100450843 CAGATTAAGCACACTGAGGAGGG + Intronic
1124037856 15:26072869-26072891 GAGATCAAGCAGCATTAGGAAGG - Intergenic
1124101514 15:26698612-26698634 ATGATAAAACAGAATGAAGAGGG + Intronic
1124713467 15:32034002-32034024 GAGAATTAACAGAAAGATGAGGG + Intronic
1124789494 15:32714238-32714260 GATGTTCACCAGAATGAGGAGGG - Intergenic
1126212847 15:46119498-46119520 CAGATTAAAGAGACTGATGAAGG + Intergenic
1126577299 15:50209685-50209707 GAGAATACACAGAAGGATGAAGG + Intronic
1126938246 15:53736252-53736274 GAGTTCAAATAGTATGAGGAGGG + Intronic
1127135342 15:55915897-55915919 GAAATTGCACATAATGAGGATGG - Exonic
1127165083 15:56236466-56236488 AAGACTAAACAGAAAGAGAATGG + Intronic
1127808315 15:62541352-62541374 AAGAAATAACAGAATGAGGAAGG - Intronic
1128631365 15:69271572-69271594 GAGCTTAGAGAGAATGGGGAGGG + Exonic
1130214789 15:81958050-81958072 GAGATTACAGGGAATGAGGAAGG - Intergenic
1130322461 15:82852665-82852687 GAGATGAAACAGAATAATGCAGG - Intronic
1130688176 15:86057290-86057312 GATTTTAAACAGGATGATGATGG - Intergenic
1134463104 16:14446903-14446925 GAAATTAAAAAGAATGAAGAAGG - Exonic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135528472 16:23232186-23232208 GAAATTAAACAGGATGAGGCTGG - Intergenic
1136249311 16:28993515-28993537 TACAATAATCAGAATGAGGACGG - Intergenic
1138301544 16:55934134-55934156 GGGATTAAACACATTGAGGTTGG - Intronic
1138318600 16:56091478-56091500 GAGGTGAAACAGGGTGAGGAGGG + Intergenic
1139191880 16:64873671-64873693 TAGAGTCAAGAGAATGAGGATGG + Intergenic
1139289917 16:65848471-65848493 AAGATTTAACAGAAAGAAGAAGG + Intergenic
1139563636 16:67759248-67759270 GAGAAACAACAGAATGAGAAAGG + Intronic
1140623812 16:76768910-76768932 GACATTAAACAGAGACAGGATGG + Intergenic
1140969625 16:80000621-80000643 GAGATGAAACGCAATCAGGATGG - Intergenic
1141009493 16:80384217-80384239 GAGATTAAAAAAAAAGAAGATGG + Intergenic
1143002341 17:3802559-3802581 GAGGTTCAACAGAAGTAGGATGG - Intergenic
1143234889 17:5391036-5391058 GAAATTAAAGAGTATGAGTATGG + Intronic
1143986880 17:10922369-10922391 GACTTTAAACTGCATGAGGAGGG - Intergenic
1148343939 17:46890911-46890933 GAAATTAAATAGGATGAGGCGGG - Intergenic
1150005370 17:61465748-61465770 GAGATGGAACAGAGTGAGCAAGG - Intronic
1150033554 17:61767999-61768021 GAGATTAAGAAGAATGATAATGG - Intronic
1151297206 17:73194073-73194095 TTGATTAGACACAATGAGGAAGG + Intronic
1151783528 17:76263703-76263725 GAGTTTAAGCAGATTGGGGAAGG - Intergenic
1153785118 18:8527894-8527916 GATGTTAAAAAGAATGAGGCAGG + Intergenic
1154234013 18:12585652-12585674 GCTATTAAACACAATGAGGTAGG + Intronic
1155101613 18:22615988-22616010 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1155210504 18:23596487-23596509 GAAGTGAAACATAATGAGGAAGG - Intergenic
1155284760 18:24276182-24276204 GATAGTACACAAAATGAGGAGGG + Intronic
1158163846 18:54517121-54517143 GAGATGAAACCACATGAGGAAGG + Intergenic
1158661150 18:59388837-59388859 GAGGTTAAACAGAAAGAGTGTGG + Intergenic
1158870576 18:61683695-61683717 GAGATTTAAATGAATTAGGAAGG - Intergenic
1160966119 19:1747666-1747688 GAGATAAAACTGAATGAAGCTGG - Intergenic
1162262853 19:9546653-9546675 GGGATTAGAAAGAGTGAGGAGGG - Intergenic
1162843769 19:13375463-13375485 ATGATTAAACACAGTGAGGAAGG + Intronic
1162991423 19:14305062-14305084 GTCATTAAGCAGAATGAGGCAGG - Intergenic
1164780795 19:30890365-30890387 GAGACTAATCAGAATGAGTCAGG + Intergenic
1165650272 19:37481840-37481862 GAGGTCAAACAGACTGTGGAAGG - Intronic
1167770957 19:51517659-51517681 GAGATTAAAGAAAAAAAGGATGG - Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925752062 2:7097640-7097662 GAGATTAACCAGAATTAGACAGG + Intergenic
925754055 2:7116904-7116926 GAAATTAAAATGAATGAGGGGGG + Intergenic
926001115 2:9333561-9333583 GAGAAGAAACAGAATGCAGAGGG + Intronic
926252471 2:11163286-11163308 CAGAATACACAGAATGAGGTGGG + Intronic
926255621 2:11193445-11193467 GAGATTAAACAAAAACAGAAAGG + Intronic
926644957 2:15280410-15280432 GAGAATAAAGAGGATGGGGAAGG + Intronic
927324043 2:21782565-21782587 GGAGTTAAACAGAATGTGGATGG - Intergenic
927493766 2:23538397-23538419 AAGATAAAACAGAATAAGAATGG - Intronic
929663573 2:43815095-43815117 GTGATTAAACAGAAAGTTGAAGG + Intronic
930403364 2:50921176-50921198 AACATTAAACACAATGAGGATGG + Intronic
930585017 2:53258262-53258284 GAAACTAAACAGACTGAAGATGG - Intergenic
930722615 2:54652413-54652435 GCCATGAAAAAGAATGAGGAAGG - Intronic
931735560 2:65190230-65190252 TAGATTAAAGAAAATGAGGACGG - Intergenic
932146685 2:69326268-69326290 GAGATTATATAGACTGGGGAAGG + Intronic
932378120 2:71256187-71256209 GAGAAGATACAGAATGAGAAGGG + Intergenic
932899325 2:75680407-75680429 GAACTTAAACTGAATAAGGAGGG - Intronic
933554365 2:83813352-83813374 GAGATTAAATAAGATGAGAAAGG + Intergenic
934655709 2:96116069-96116091 GATGGTAAAGAGAATGAGGAAGG + Exonic
935287851 2:101581043-101581065 GTGTTTCAACAGAATGAGGGTGG + Intergenic
935449526 2:103192635-103192657 AATATAAAACAGAATGAAGAAGG + Intergenic
936719802 2:115237548-115237570 AAGATTAAGCTTAATGAGGAAGG + Intronic
936895653 2:117424561-117424583 GATATTTAAGAGGATGAGGAGGG + Intergenic
937636853 2:124165748-124165770 GACATTAGACAGAATCTGGAGGG + Intronic
939193958 2:138949480-138949502 GAGAGTTAACAGAATAAAGAAGG + Intergenic
939789894 2:146559302-146559324 GGGACAAAACAGAATAAGGAAGG - Intergenic
941281013 2:163550626-163550648 GAGATTAAAAACAGAGAGGATGG + Intergenic
941345421 2:164362456-164362478 GAGGTTAAGCAGAATGTTGAAGG - Intergenic
941618843 2:167754527-167754549 CAGATTTCACAGAAAGAGGAAGG + Intergenic
941691801 2:168507843-168507865 GAGAAGAAAGAGAATGAGGAAGG - Intronic
943173526 2:184435570-184435592 AAGAGTAAAGAGAATGTGGAAGG + Intergenic
943376684 2:187086290-187086312 GAGTATAAATAGCATGAGGAAGG + Intergenic
943797692 2:192017594-192017616 GATATTAAACAGGCTGAGAAGGG - Intronic
944086145 2:195850168-195850190 GAGAATAACCAAAATGAGCATGG + Intronic
944173166 2:196801158-196801180 GAGAATAAACAGCAAAAGGATGG + Intergenic
945076479 2:206044602-206044624 GAGATAAAGAAAAATGAGGATGG + Intronic
945322625 2:208442960-208442982 CAGATTCAACAGACTGTGGATGG + Intronic
946013154 2:216582818-216582840 GAGATTACACAGACAGAAGAGGG - Intergenic
947211822 2:227715621-227715643 CAGAATAAACAGAATTTGGAAGG - Intronic
947754165 2:232549794-232549816 ATGATTAAACTGAGTGAGGAAGG - Exonic
948141919 2:235679773-235679795 GAGATTTTAGAGAATAAGGATGG + Intronic
948856915 2:240734544-240734566 GAGAATAAAAAGAAAGAAGACGG + Intronic
1169245053 20:4018523-4018545 GAGAATGAACGGAAGGAGGAGGG + Intergenic
1169696001 20:8387220-8387242 AAGATTAAGCTGAGTGAGGAAGG - Intronic
1169957297 20:11118387-11118409 GACATTACTCAGAATGAGGATGG + Intergenic
1171192467 20:23168840-23168862 GAGATGAGAGAGAATGAGAATGG - Intergenic
1172507627 20:35475397-35475419 GCTATGCAACAGAATGAGGATGG - Intronic
1173099747 20:40074720-40074742 GAGATAAAACAGATTAAGGAGGG - Intergenic
1173772793 20:45678005-45678027 GAGAAAAAAAAGAATGAAGAAGG - Intergenic
1175055893 20:56197735-56197757 GACATTGAACAGAATGATGAGGG + Intergenic
1175517852 20:59580083-59580105 GAGATTCATCAGAATGGGGCTGG + Intronic
1176291539 21:5047971-5047993 GACATAAATCAGAATGTGGAAGG - Intergenic
1176974355 21:15302087-15302109 GAGGTTAAACAAAAAGAAGATGG - Intergenic
1176993285 21:15523598-15523620 TAAATGATACAGAATGAGGAAGG + Intergenic
1177380870 21:20342776-20342798 GTGATTAAACAGTATTAGCAAGG + Intergenic
1177771858 21:25525911-25525933 GACATTAAAGAGAATGATGTAGG - Intergenic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1179676883 21:42989078-42989100 GACATCAAACAGAAAAAGGAAGG - Intronic
1179865716 21:44215670-44215692 GACATAAATCAGAATGTGGAAGG + Intergenic
1181403471 22:22665798-22665820 GAGATTAACCAGGGTGGGGAAGG - Intergenic
1181408474 22:22701782-22701804 GAGATTAACCAGGGTGGGGAAGG - Intergenic
1182604300 22:31491186-31491208 AAGATTAAACAGGATAAGGTGGG + Intronic
1183071369 22:35398938-35398960 GCTGTTAAACAGAATGAGGCCGG + Intergenic
1183144871 22:35981227-35981249 GAAATAGAACAGAAAGAGGATGG - Intronic
1184041068 22:41944141-41944163 TAGAGTAAACAAAAAGAGGACGG + Intronic
1184272870 22:43394797-43394819 GAGGTTAAACAGCATGACCAAGG + Intergenic
949290264 3:2457049-2457071 GAGATTAAACCCAATGAGCCAGG + Intronic
949386508 3:3508428-3508450 AAAAATATACAGAATGAGGAAGG + Intergenic
949453922 3:4218043-4218065 GAGAGAAACAAGAATGAGGAGGG + Intronic
949665736 3:6337489-6337511 AAGATAAAAAAGAAGGAGGAGGG + Intergenic
949994560 3:9606272-9606294 AAGAATAAAAAGAATGAGGGAGG - Intergenic
952214934 3:31268882-31268904 GAGATTAAACATCAAGAGAAAGG + Intergenic
952461904 3:33536344-33536366 CAGATTAAATAGGATGAGTAGGG + Intronic
952635673 3:35527343-35527365 ATGATTAAACTTAATGAGGAAGG - Intergenic
952686668 3:36157710-36157732 GAAAATACACAGAATGAGGCTGG + Intergenic
952874444 3:37931646-37931668 GAGATAAAAGAAAATGAGAAAGG - Intronic
953145539 3:40271164-40271186 GAGACCAAGCAGAAAGAGGAAGG + Intergenic
953240046 3:41140760-41140782 GAGATTATAGAGCTTGAGGAAGG - Intergenic
953461749 3:43086937-43086959 GAGATCATACTGGATGAGGATGG + Intronic
953576958 3:44120624-44120646 GAGAGCAAACAGAATGGGCAAGG + Intergenic
953667036 3:44932998-44933020 GAGATTTAATAAAATGAGGTTGG + Intronic
955844166 3:63143267-63143289 GAGATCATACTGAATTAGGATGG - Intergenic
956098195 3:65739556-65739578 ATGATTAAGCTGAATGAGGAAGG - Intronic
956578660 3:70784371-70784393 AACATTAAACTGAAAGAGGAGGG - Intergenic
957166246 3:76677280-76677302 GAGAAGAAAAAGGATGAGGAGGG + Intronic
957538325 3:81534609-81534631 GAGAAGAAACAGAAAAAGGAAGG + Intronic
957842209 3:85686157-85686179 GATATTAAACAGAAGGAAGTAGG - Intronic
958813305 3:98888256-98888278 GAGCTTAAAAAGAATGAAGCTGG - Intronic
958946302 3:100366183-100366205 GAGATGAAACAGAAAGAGGTGGG - Intronic
959008206 3:101044665-101044687 GATATCAATCAGACTGAGGAGGG + Intergenic
960300290 3:115995186-115995208 GACATTACACAGAAAGTGGATGG - Intronic
962132873 3:132701235-132701257 GAGAAGACACAGAATGAGAAAGG - Intronic
962200023 3:133393270-133393292 AAGAGGAAACAGAATGAGGTTGG - Intronic
962564989 3:136648759-136648781 AAGATTAGAGAGAAAGAGGAAGG - Intronic
963510725 3:146244815-146244837 AAGATTAAGCTTAATGAGGAAGG + Intronic
964035310 3:152188525-152188547 GAGATTAAACTTAGTGAGGAAGG + Intergenic
964442295 3:156724755-156724777 GCCATTAAACAGAATGAGGTTGG - Intergenic
965530579 3:169766535-169766557 GAGAATAAATTGAATGAGGAAGG - Intergenic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966664060 3:182450770-182450792 GAGATAAAACACAGTGAGGAGGG - Intergenic
966999741 3:185322563-185322585 AAGATTATACAGAGTGAGGAAGG - Intronic
967236636 3:187391216-187391238 GAAACTAAACAGACAGAGGAAGG + Intergenic
967431329 3:189389289-189389311 AAGATTAAACAGAAGAAAGATGG - Intergenic
967494477 3:190127582-190127604 GAGATTAAGTAGAATGTTGAAGG - Intergenic
967773905 3:193364491-193364513 AACATTAAACAGAAAGAGTATGG + Intronic
969161077 4:5259671-5259693 GCTATTAGAAAGAATGAGGAAGG - Intronic
969918704 4:10515341-10515363 GAGAGAAATCAGGATGAGGATGG - Intronic
970359573 4:15295306-15295328 GAGATTAAACCGAAACAGAAGGG - Intergenic
970793154 4:19882950-19882972 AAGATTTAACAAAATGAGGCTGG + Intergenic
970802572 4:19991488-19991510 GAGACTAAGGAGGATGAGGAGGG - Intergenic
971068370 4:23061117-23061139 AAGACAAAACAGACTGAGGAAGG - Intergenic
971074589 4:23132667-23132689 GAACTTAAACAGAACAAGGAAGG + Intergenic
971353433 4:25872872-25872894 GAGACACAACAGAATGAGCACGG - Intronic
971481068 4:27115564-27115586 GTGATTCAACAAAATGAGGCTGG - Intergenic
971568107 4:28171277-28171299 GAGATTAAAAAGTAGGAGCAAGG + Intergenic
971578937 4:28309046-28309068 AACCTTAAACAGAATCAGGAAGG + Intergenic
972099418 4:35394306-35394328 ATGATTAAACATAGTGAGGAAGG + Intergenic
972138721 4:35928116-35928138 GAGATTACACTAGATGAGGATGG + Intergenic
973195485 4:47434905-47434927 GAGAGTGAACAGAATGAGGCAGG - Intergenic
973786890 4:54340734-54340756 GAGATCAAACAGCATCAGAATGG + Intergenic
975495904 4:75035631-75035653 GAGATAAAAGGGAAGGAGGAGGG - Intronic
976244032 4:82989689-82989711 GAAATTAAAGAGTAGGAGGAGGG + Intronic
976278966 4:83307801-83307823 GAGAGAAAAAAGAATGAAGATGG + Intronic
977119775 4:93084522-93084544 GTGAATAAACAGAAAGATGAAGG - Intronic
977328085 4:95602438-95602460 AATATTAAACAAAATTAGGAAGG + Intergenic
977531570 4:98206791-98206813 GAGAAGAGACAGAATGAGGGAGG + Intergenic
980510050 4:133773162-133773184 GAGAAAAAAAAGAAAGAGGAAGG + Intergenic
981095572 4:140775981-140776003 GAGATAATAGAGGATGAGGAGGG - Intergenic
981435496 4:144716549-144716571 CAAATTTAAAAGAATGAGGATGG + Intronic
981735213 4:147942608-147942630 GAGAATAAAGAGGATAAGGAGGG - Intronic
982346750 4:154368317-154368339 GAAATAAAAAAGAAAGAGGAAGG - Intronic
982719942 4:158849020-158849042 GAGATCAAGAAGAATCAGGATGG - Intronic
982930959 4:161407371-161407393 GAGAGAAAACTGAATGAGGATGG + Intronic
984017530 4:174443621-174443643 GAGATGAAAGAAAAGGAGGAGGG - Intergenic
984568960 4:181366713-181366735 GATAAAAAACAGAGTGAGGAAGG - Intergenic
984857083 4:184204620-184204642 GAGATGAAAGAGACTGGGGATGG - Intronic
985268931 4:188176360-188176382 GAGATTAGAGAGAAAGAGAAGGG + Intergenic
985905125 5:2828870-2828892 AGGATTAAACAGAATGAAAAAGG + Intergenic
986125763 5:4881202-4881224 GAGATTATACTGGATGAGGGTGG - Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987731626 5:21780959-21780981 GAAAACAAAGAGAATGAGGATGG + Intronic
988292650 5:29309338-29309360 GATGTGAAACAGAATGATGATGG - Intergenic
988387985 5:30591386-30591408 AAAATTAGACAGAATGTGGAGGG + Intergenic
988448852 5:31319318-31319340 GAGATTAAACAAGATGTGGGAGG - Intronic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
989303470 5:39922888-39922910 GTGATTAAGCTTAATGAGGAAGG - Intergenic
990417130 5:55597285-55597307 GAGATTAAAAAGAGTCAGGAAGG + Intergenic
991430614 5:66541061-66541083 GAGATTTAGCAGAACGAGGCTGG - Intergenic
991599732 5:68340484-68340506 GAGATTAACCAGGCTGAGGATGG + Intergenic
992036006 5:72776952-72776974 AGAATTAAAAAGAATGAGGAAGG + Intergenic
992549470 5:77847195-77847217 GGGAGAAAAGAGAATGAGGATGG - Intronic
993323148 5:86500522-86500544 GATATCAAACAAAATTAGGAGGG + Intergenic
993415731 5:87627766-87627788 AAAATGAAACAGAATGAGGAGGG + Intergenic
994130391 5:96220307-96220329 GAGATTAAAATGCATGAAGAGGG - Intergenic
994302941 5:98167713-98167735 GAAATTAAATAGAATGATGAAGG + Intergenic
994330409 5:98498476-98498498 GAGATGAAACATATTGAGGAAGG + Intergenic
994517453 5:100788597-100788619 ATGATTAAACTGCATGAGGAAGG - Intergenic
995261108 5:110105572-110105594 GAAATTAGACAGAATGAGAGAGG + Intergenic
995791340 5:115891497-115891519 GAAATTAATCAAACTGAGGAGGG - Intronic
996542201 5:124642202-124642224 GAGACTAAACAAAAATAGGATGG - Intronic
996591529 5:125153234-125153256 GAGTTTAACCAGAATGAGCGGGG - Intergenic
997002698 5:129781514-129781536 GAAATTAAACTGAATCAGGGAGG - Intergenic
997024067 5:130037223-130037245 GAAATTAGACAGAAGGAGCATGG + Intronic
997986222 5:138503491-138503513 GAAATAAAACAGCATGAAGAAGG - Intergenic
998100636 5:139430869-139430891 GATTTTAAAAAGAATGAGGTAGG - Intronic
999594787 5:153190976-153190998 AAGATTAAGAAGAATGAGAAGGG - Intergenic
1000401751 5:160836085-160836107 TAGATTCAAAAGAATGAGGAGGG + Intronic
1001213826 5:169836570-169836592 GAAATAAAGCAAAATGAGGATGG - Intronic
1001242974 5:170084093-170084115 GAGATGAGAAAGAATGATGATGG + Intergenic
1002050176 5:176566055-176566077 GAGATTAGCCAGTGTGAGGAAGG - Intronic
1003630952 6:7786716-7786738 GAGAATACACAGAAAGAAGAAGG + Intronic
1003939384 6:11009203-11009225 GGGTTGAAACAGAATGATGAGGG + Intronic
1004973062 6:20933712-20933734 CAGATTAAAGAAAATAAGGACGG - Intronic
1005484281 6:26284831-26284853 AAGCTTAAACTGAAGGAGGAAGG + Intergenic
1006552088 6:34832744-34832766 GATATTAAACATAAAGAGGCTGG - Intronic
1006726849 6:36205433-36205455 GAGATCAGACAGAATGCAGAAGG - Intronic
1006748096 6:36359143-36359165 CAGATTAAACAGAAAGGGGATGG + Intronic
1007334385 6:41141846-41141868 GAAATTTAAAGGAATGAGGAAGG - Intergenic
1009372211 6:62919646-62919668 GAGAATAGAAAGAATGAGGCAGG - Intergenic
1009374699 6:62953004-62953026 GAGACCAAACAGAATGGAGAAGG - Intergenic
1009643610 6:66368979-66369001 GAGATTAAACATGTTGAAGATGG - Intergenic
1011309783 6:85969138-85969160 GAGGTTAAATAGAATAAGGATGG + Intergenic
1011538447 6:88403818-88403840 GAAATTAAACAGATGGAGAAGGG - Intergenic
1012050726 6:94340489-94340511 GAGATTAAACAACTTGATGAAGG + Intergenic
1012366920 6:98452511-98452533 GAGATGAGAGAGAATGAGCAAGG + Intergenic
1012703413 6:102492729-102492751 GAAAATAAACAGAATGAACAAGG - Intergenic
1013158954 6:107522869-107522891 GTGATTAATCAGAATGTGGGAGG + Intronic
1013172661 6:107650856-107650878 GTGATTAAACTTAGTGAGGAAGG + Intronic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1014653125 6:124065992-124066014 GAGATTAAAGAGAAGGAAGTGGG + Intronic
1014917071 6:127163575-127163597 GAAATTAAATAGAAAGAGAAGGG - Intronic
1015426137 6:133070045-133070067 GAGAATGAAGAGAGTGAGGATGG + Intergenic
1016765253 6:147785456-147785478 GAGATTAGACAGAACTAGGAGGG - Intergenic
1016878911 6:148890661-148890683 AATATTGGACAGAATGAGGACGG - Intronic
1017075681 6:150615632-150615654 GAGAAGAATCAGACTGAGGAGGG + Intronic
1017200469 6:151748416-151748438 AAGAGTAAAAAGAATGAGGCAGG - Intronic
1017562736 6:155647656-155647678 AACATTAAACAGAATGAGAAAGG + Intergenic
1017731337 6:157319517-157319539 CTGAATAAACAGAAAGAGGAAGG - Intronic
1020229009 7:6303094-6303116 GAGATTAGACAAAACCAGGAAGG + Intergenic
1020601958 7:10286742-10286764 GAGAAAAAACAGCATGGGGAAGG + Intergenic
1020732191 7:11894170-11894192 GAGATTATACAGAATTACGGTGG - Intergenic
1020931702 7:14404932-14404954 GAGATTAACCAGGGAGAGGATGG - Intronic
1022658068 7:32339575-32339597 GAGGTTAAATAAGATGAGGACGG + Intergenic
1023155074 7:37242071-37242093 GAGAGGAAAAAGAATGGGGAAGG - Intronic
1023262247 7:38369882-38369904 AATATTACACAGAATGTGGAGGG + Intergenic
1023300431 7:38764643-38764665 GAGATTAAACAGAATGAGGAGGG + Intronic
1023768139 7:43531055-43531077 TAGAGCATACAGAATGAGGAAGG - Intronic
1024382568 7:48715246-48715268 GAGAGTAAAGAGAATGGGGAAGG - Intergenic
1024955093 7:54910281-54910303 AAGAGTAAACACATTGAGGAAGG + Intergenic
1025959868 7:66210471-66210493 GAGCTTTTAAAGAATGAGGATGG + Intronic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1026474908 7:70726900-70726922 GAGAGGAAAGAGAATGAGGAAGG - Intronic
1027127444 7:75566818-75566840 GAGATAGAAAAGAATGGGGAGGG + Intronic
1027611861 7:80371032-80371054 GAAAGTAAAAAGAATGAGAAAGG + Intronic
1027631999 7:80618443-80618465 GTGATTAAACTTAGTGAGGAAGG + Intronic
1027647111 7:80815599-80815621 GATATAAAACAGAGTGATGAAGG + Intronic
1028151529 7:87379067-87379089 GACATAAACCAGACTGAGGAAGG - Intronic
1030566630 7:111165748-111165770 GAGATGACCCAGAATGAGTATGG - Intronic
1030839799 7:114334620-114334642 GAGATTAAAAAAAAAGAAGAAGG + Intronic
1031392362 7:121231433-121231455 GAGCTTAAGGAGAATGATGAAGG + Intronic
1031731335 7:125304690-125304712 GAGATTAAAGAAAAAGAAGATGG - Intergenic
1031741981 7:125444297-125444319 GATCTTAAACAGGGTGAGGAGGG - Intergenic
1032432760 7:131875358-131875380 GAGGTTAAGCATAAGGAGGAAGG - Intergenic
1032439683 7:131932999-131933021 GAGATAAAATTGCATGAGGAGGG - Intergenic
1034300471 7:150010817-150010839 CAGATGGAACAGAATGAGAAAGG + Intergenic
1034805583 7:154086491-154086513 CAGATGGAACAGAATGAGAAAGG - Intronic
1036828256 8:11997067-11997089 GAGGTGAAAGAGAATCAGGAGGG - Intergenic
1037118524 8:15254879-15254901 GAGATTTAAGTGAATAAGGAAGG + Intergenic
1037173528 8:15921565-15921587 GAGTTTACACAGAGTGAGGGTGG + Intergenic
1037208832 8:16360313-16360335 GAGACTAAAGAGAGGGAGGAGGG + Intronic
1037385489 8:18335775-18335797 GAAGTTAAACACAATGAAGATGG + Intergenic
1037692457 8:21193762-21193784 GAGCTGAAAGAGAAGGAGGAAGG + Intergenic
1041183011 8:55268185-55268207 GAGATTAAAACGAATGGAGAGGG + Intronic
1042962432 8:74318639-74318661 GACATTAAACTGGAGGAGGAAGG - Intronic
1043609684 8:82046576-82046598 CAGATTCAAAAGAATGAGAAAGG + Intergenic
1044073354 8:87789300-87789322 GCTGTTAAACAGAATGAAGAAGG - Intergenic
1045636138 8:104193070-104193092 GAGATTAAAGGGAAGGAGGGAGG - Intronic
1045837666 8:106541916-106541938 GAGATTAAACAAAATGATACAGG - Intronic
1047152856 8:122284351-122284373 GAGGTTAGACAGGATTAGGATGG - Intergenic
1047707111 8:127510523-127510545 GTGATTAAACAGCATCTGGAAGG - Intergenic
1047846226 8:128808390-128808412 GAGAATAAAGGGAAGGAGGACGG - Intergenic
1048194533 8:132321506-132321528 GAGAGCAAACAGAAGCAGGAGGG - Intronic
1048384650 8:133900901-133900923 GAGCCTAAGCAGAGTGAGGAGGG - Intergenic
1048630183 8:136233948-136233970 GAGAATAAGCAGAAGCAGGATGG - Intergenic
1048630435 8:136236458-136236480 GAGAGTGAAGAGAAAGAGGAGGG - Intergenic
1049775173 8:144400688-144400710 GGGCTCAAACAGGATGAGGAGGG + Exonic
1049936702 9:506343-506365 GAGGTTAAAATGAATAAGGATGG + Intronic
1050367520 9:4886131-4886153 GAGACTAACCAGAAAGAGGCAGG - Intergenic
1050856350 9:10361850-10361872 GAGATTAAGGAGAAAGAGCATGG + Intronic
1051043733 9:12848295-12848317 GAAATTAAACTGAAATAGGACGG + Intergenic
1053606677 9:39666978-39667000 GAGAATGAAATGAATGAGGAGGG + Intergenic
1054246858 9:62675426-62675448 GAGAATGAAATGAATGAGGAGGG - Intergenic
1054560979 9:66709960-66709982 GAGAATGAAATGAATGAGGAGGG - Intergenic
1055525844 9:77133028-77133050 GAGATTACAAAGTATGGGGATGG + Intergenic
1056339999 9:85619408-85619430 TAGTTTAAAAATAATGAGGAAGG - Intronic
1056695566 9:88847555-88847577 ATGATTAAGCTGAATGAGGAAGG - Intergenic
1056965185 9:91159452-91159474 GAGAGGAAAGAGAAAGAGGAGGG + Intergenic
1057504515 9:95621708-95621730 ATGATTAAGCTGAATGAGGAAGG + Intergenic
1058602324 9:106683529-106683551 GACATAAAGCAGAATGTGGAAGG - Intergenic
1058976377 9:110128701-110128723 GAGCTTTAACAGCCTGAGGATGG + Intronic
1059035680 9:110751392-110751414 GAGAAAGACCAGAATGAGGATGG + Intronic
1061290668 9:129648954-129648976 GACAGTAAACAGAATAAGGGAGG - Intergenic
1061337831 9:129953596-129953618 GAGATTAAACAGTAAAAGAAAGG + Intronic
1061456620 9:130702887-130702909 GAGATTAAAAGGAATGGGGCAGG - Intronic
1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG + Intergenic
1187654357 X:21453359-21453381 GAGTTTAAACAGAAGGATGTGGG + Intronic
1187692254 X:21881156-21881178 AAGATTAATCAGAGTGAGAAAGG + Intronic
1187859858 X:23670819-23670841 GAGGCTACACAAAATGAGGAGGG - Intronic
1188458886 X:30399319-30399341 GTGGTTAAACTGAATTAGGAGGG - Intergenic
1189297409 X:39928866-39928888 GAGATCCAACAGCCTGAGGAAGG - Intergenic
1195109911 X:101637689-101637711 GAGTCTAGAGAGAATGAGGAAGG - Intergenic
1195243539 X:102976720-102976742 GAGTTTACACAGCTTGAGGATGG - Intergenic
1195697964 X:107680650-107680672 GAGAGTAAAAAGGATGAGTAAGG - Intergenic
1198036084 X:132802844-132802866 GAGATCAAGCAGAAGGGGGAAGG + Intronic
1198923004 X:141751477-141751499 GGGATTAAACATAATGGAGAAGG + Intergenic
1201556870 Y:15272339-15272361 GAGATAGAAAACAATGAGGAGGG + Intergenic
1201724176 Y:17135510-17135532 GAGAGTAAAAAGAGAGAGGAAGG + Intergenic