ID: 1023301844

View in Genome Browser
Species Human (GRCh38)
Location 7:38781416-38781438
Sequence TATCTTGGTGTTGCTCATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023301841_1023301844 18 Left 1023301841 7:38781375-38781397 CCAAGTTTTTCGCTTTAAAGTCC 0: 1
1: 0
2: 0
3: 2
4: 120
Right 1023301844 7:38781416-38781438 TATCTTGGTGTTGCTCATTATGG No data
1023301840_1023301844 19 Left 1023301840 7:38781374-38781396 CCCAAGTTTTTCGCTTTAAAGTC 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1023301844 7:38781416-38781438 TATCTTGGTGTTGCTCATTATGG No data
1023301842_1023301844 -3 Left 1023301842 7:38781396-38781418 CCAATAATTTCATTAGAACATAT 0: 1
1: 0
2: 4
3: 41
4: 398
Right 1023301844 7:38781416-38781438 TATCTTGGTGTTGCTCATTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023301844 Original CRISPR TATCTTGGTGTTGCTCATTA TGG Intronic
No off target data available for this crispr