ID: 1023303960

View in Genome Browser
Species Human (GRCh38)
Location 7:38803761-38803783
Sequence AATGGGGTCTTGAACCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023303955_1023303960 6 Left 1023303955 7:38803732-38803754 CCTAGGATGGTGGCTGGCTACTG 0: 1
1: 0
2: 2
3: 70
4: 1777
Right 1023303960 7:38803761-38803783 AATGGGGTCTTGAACCCTGAAGG 0: 1
1: 0
2: 0
3: 8
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023303960 Original CRISPR AATGGGGTCTTGAACCCTGA AGG Intronic
907099899 1:51821446-51821468 AATGGTCTCTTTAACTCTGAAGG + Intronic
912415288 1:109504278-109504300 AATGGGGTCTTGGACACGGGAGG + Exonic
912722617 1:112032840-112032862 AATGGGCTCTGGATCCCTGATGG - Intergenic
913523689 1:119669955-119669977 AAGAGGGTCTAGAACCTTGAAGG - Intronic
916043603 1:160981967-160981989 AATGGGGTCGGGAAGCCTGGAGG + Intergenic
917592459 1:176490614-176490636 AATGGAGTCTGCATCCCTGAAGG - Intronic
919848337 1:201655597-201655619 AAGGGGGAGCTGAACCCTGAAGG - Intronic
922788367 1:228295035-228295057 CATGTGGTCTTTACCCCTGACGG - Exonic
924315215 1:242788235-242788257 AATGTGTTCTTGCACACTGAAGG + Intergenic
924526282 1:244853345-244853367 AAAGGGATTTTGAACCTTGATGG + Intronic
1065411498 10:25434070-25434092 AATGGCGGCGTGAACCCTGGAGG + Intronic
1067158875 10:43806034-43806056 AGGGGGGTCTTCAACCCTGTAGG - Intergenic
1067558653 10:47289297-47289319 AATGGGGGCCTCAACCCTGAAGG + Intergenic
1072308906 10:94135343-94135365 TAGTGGGTCTTGAACTCTGATGG + Intronic
1076286954 10:129309386-129309408 AAATGGGTTTTGAACACTGATGG - Intergenic
1080648307 11:34203314-34203336 AATGGTGTCTTGCACACAGAAGG + Intronic
1080726046 11:34900429-34900451 AAAGGGAACTTGAACCCTCATGG - Intronic
1085323186 11:75587344-75587366 AATGGGGTCTTGATTCTTCACGG + Exonic
1085406041 11:76262855-76262877 AGTGGTGTCTGGAACTCTGAAGG - Intergenic
1086884428 11:92188517-92188539 AATAGGGGCTTGAATCCTGGAGG - Intergenic
1088548053 11:110981553-110981575 AATGAAGTCTTGATCTCTGATGG + Intergenic
1089512984 11:119012292-119012314 AAAGGGGTCCTGAGACCTGAGGG - Intronic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1090356778 11:126146002-126146024 GATGGGGTCTGGCACCCAGAAGG + Intergenic
1092369700 12:7906611-7906633 AATGACGACTTGAACCCAGAAGG - Intergenic
1093999952 12:25684200-25684222 GCTGGGGCCTTGCACCCTGATGG - Intergenic
1095168426 12:39003284-39003306 AATAGTGTCTTGTACCCTGTGGG + Intergenic
1099650416 12:85420481-85420503 AAGCGGGTTTTGAACCCTGAAGG - Intergenic
1101530151 12:105566461-105566483 AAGGGGTTCTGAAACCCTGAGGG - Intergenic
1104874853 12:132026706-132026728 ACTGGAGTCCTGGACCCTGAGGG + Intronic
1107358138 13:39590234-39590256 ATTTGGGTCCTGCACCCTGAAGG - Intronic
1108847837 13:54697505-54697527 AAAGAGATCTTGGACCCTGATGG + Intergenic
1109461793 13:62669786-62669808 CATGGAGTCTAAAACCCTGAGGG + Intergenic
1111673655 13:91359923-91359945 AATGAGGTTTTAGACCCTGATGG - Intergenic
1111728441 13:92042079-92042101 ACTGGGGTCCTGAGTCCTGATGG + Intronic
1111809493 13:93081248-93081270 AATAGGGTCTGGAACACTTAAGG - Intergenic
1113471922 13:110553114-110553136 AATGAGGCCTTGCACCCAGAAGG + Intronic
1202893683 14_KI270722v1_random:183376-183398 ATTGGGGTCTTCATCCCTGCAGG + Intergenic
1123914392 15:25007352-25007374 AAGGGTCTCTTGATCCCTGAAGG + Intergenic
1124926178 15:34072736-34072758 AATGGTGTGTTGAACCCGGGAGG - Intergenic
1131425996 15:92345912-92345934 AATGGTGTCCTGGACCCTGCAGG + Intergenic
1135044486 16:19143652-19143674 AACGGGGCATTGATCCCTGAAGG - Intronic
1137795654 16:51215728-51215750 AATGGTGGCTTGAACCAGGATGG - Intergenic
1138070597 16:53989435-53989457 ACTGGGGTCTCGAACCCAGTAGG + Intronic
1138463876 16:57172609-57172631 AATGTGGTCTAGAAGGCTGAAGG + Intronic
1141081212 16:81054736-81054758 AAGAAGGTCTTGAACCCTGGAGG - Intronic
1142908207 17:3062958-3062980 GATGTGGTCATGAACCCTAAGGG + Exonic
1142926358 17:3241303-3241325 GATGTGGTCATGAACCCTAAGGG - Intergenic
1143527652 17:7481893-7481915 GATGGGGTCTGGGACCCTGTGGG - Intronic
1153224667 18:2890213-2890235 AATGGTCTCTTTCACCCTGAGGG - Intronic
1156735080 18:40246232-40246254 AATGGAGCCATGAACCCTGGCGG - Intergenic
1161195415 19:2983671-2983693 ACTTGGGCTTTGAACCCTGAGGG + Intronic
1165180681 19:33964871-33964893 AATGGGGTCTTCACCTCTGGTGG - Intergenic
926656359 2:15411278-15411300 ATTGTGGTCTTGAAACCTGTAGG - Intronic
928442221 2:31302104-31302126 ACTGGGCACTTGAACACTGAAGG - Intergenic
929037292 2:37706373-37706395 AATGGGGGCTGGAACCTAGAGGG + Intronic
929352165 2:40969712-40969734 AATGGGTTCATGAAACCTGAAGG - Intergenic
933892094 2:86781453-86781475 AAAGGAGTCTCGGACCCTGATGG - Intergenic
935124079 2:100207547-100207569 AAGGGGGAGCTGAACCCTGATGG + Intergenic
936142040 2:109948778-109948800 ACTGGGCTCTTGAAGCCTGCTGG + Intergenic
936178730 2:110246738-110246760 ACTGGGCTCTTGAAGCCTGCTGG + Intergenic
936202648 2:110422694-110422716 ACTGGGCTCTTGAAGCCTGCTGG - Intronic
937287992 2:120765208-120765230 AGTGGGGTTTTGTCCCCTGAGGG - Intronic
943631891 2:190262997-190263019 AATGGGGTATAAAACCCTAATGG + Intronic
946264915 2:218531775-218531797 ACTGATGTCTTGAACCCTCAAGG - Intronic
946959017 2:224963195-224963217 CATGGAGTCTGGAACCCTTAAGG + Intronic
948888910 2:240897412-240897434 AATGGGGCCTTGAACCTGAATGG - Intergenic
1173061020 20:39661249-39661271 AATGTGCTCTTGAGACCTGATGG - Intergenic
1174944065 20:54965443-54965465 AATGGGGTCTGGAAAACTGGAGG - Intergenic
1175447023 20:59029110-59029132 GGTGGGGTCTGTAACCCTGAAGG + Intronic
1177946784 21:27480332-27480354 AATGAGGTGTTGAAAACTGAAGG - Intergenic
1180988968 22:19922516-19922538 TCTGGGATCTTGAACACTGAAGG - Intronic
1182259038 22:29059633-29059655 AGTTGGGATTTGAACCCTGATGG + Intronic
950880946 3:16322279-16322301 AATGGTGACTTGAAGCCAGATGG - Intronic
952198409 3:31099954-31099976 TAGGGGGTCTTAAACCTTGAAGG - Intergenic
954052167 3:47988900-47988922 AAGAGAGTCTTGAACCCAGAAGG - Intronic
954874100 3:53789836-53789858 ACTGTGGTTTTGAACCCTGTGGG + Intronic
957693408 3:83600692-83600714 AATGGGCTCTTGAATCATGAGGG + Intergenic
961251513 3:125510315-125510337 AATGGTGGCGTGAACCCGGAAGG - Intronic
963377874 3:144493339-144493361 GAAGAGCTCTTGAACCCTGAAGG + Intergenic
967004607 3:185372249-185372271 AATGGGCTCTTGAGCCCTAATGG - Intronic
969507341 4:7596431-7596453 AATGGAGTCTTGGCACCTGAAGG - Intronic
969827135 4:9766524-9766546 AATGGGGTGTCCATCCCTGAAGG - Intergenic
970362098 4:15320467-15320489 AATGGGGTGTTGATCCCAAAGGG - Intergenic
971494934 4:27254056-27254078 AATAGGGTCATGAACCTTGGAGG + Intergenic
972338501 4:38129632-38129654 AATAAAGTCATGAACCCTGATGG - Intronic
975945719 4:79704159-79704181 AATGATGTCTTGAACCAGGAAGG + Intergenic
980030936 4:127829461-127829483 GATGGAGGCTTGAACCCAGATGG + Intronic
987830747 5:23091487-23091509 ATTGTGCTCTTGAACCCTGGAGG - Intergenic
988469039 5:31519627-31519649 AATGTGGTGTTGAAACCTGCAGG - Intronic
988831963 5:34996628-34996650 AATAGGGTCTGGAGACCTGAAGG - Intergenic
993333690 5:86631246-86631268 AATGGGCTCTTGAACCAACATGG + Intergenic
993841623 5:92887064-92887086 ACTGGGGTCTTGATGACTGAAGG - Intergenic
995361397 5:111302228-111302250 ACTGGGGTCTTGAGCCAAGATGG + Intronic
996336007 5:122384881-122384903 AAAGCGGTCTTGAAGCGTGATGG - Intronic
997603993 5:135160286-135160308 GGTGGGGTCTTGAACCCAGATGG - Intronic
997820978 5:137065403-137065425 AATGAGGTCTTTAACAATGAAGG + Intronic
998108498 5:139483497-139483519 AGTGGGGACTTGAAGCCTGGTGG + Intergenic
999575821 5:152975321-152975343 AATTGGGATTTGAACCCAGATGG - Intergenic
1007487827 6:42194597-42194619 AATGGGGTAAGGCACCCTGAAGG - Exonic
1007901667 6:45419771-45419793 AATGGGTTCTCGCACCCTGGCGG + Intronic
1015243241 6:131049796-131049818 ATTTGTGTCTTGAGCCCTGAAGG - Intronic
1015682522 6:135824165-135824187 CATGGGGTATTAAAACCTGAAGG + Intergenic
1021512673 7:21451446-21451468 ACTGGGGTCTTGGACTCTTAAGG - Intronic
1023303960 7:38803761-38803783 AATGGGGTCTTGAACCCTGAAGG + Intronic
1030481983 7:110116063-110116085 TATGAGGTCCTGAACCCAGAAGG + Intergenic
1033018001 7:137691579-137691601 AAAGCTTTCTTGAACCCTGAAGG + Intronic
1034732042 7:153396375-153396397 AATTGGGTCTTGAACTCTTGAGG + Intergenic
1036669377 8:10770981-10771003 ACTGGGGTTGTGAGCCCTGATGG + Intronic
1037514400 8:19616438-19616460 CATGGGGTTTTGGAGCCTGAAGG - Intronic
1042299636 8:67263196-67263218 AATTGGATCTTTAAGCCTGAGGG - Intronic
1048147408 8:131858997-131859019 AGTGGGGTGTTAAACCCAGATGG + Intergenic
1050150426 9:2614343-2614365 ACTGTGGTCCTCAACCCTGATGG - Intergenic
1050310971 9:4352972-4352994 ACTGAGGTCTGGAACCCTGAAGG - Intergenic
1052605423 9:30692120-30692142 AATGATGTCTTGAACTTTGAAGG - Intergenic
1053086935 9:35232946-35232968 AATGGTGTCTTGGAAGCTGAGGG + Intronic
1056922843 9:90807418-90807440 AAGGGGGACTTGAACCCAGTGGG - Intronic
1061738224 9:132678061-132678083 GATAGGGTGTTCAACCCTGAGGG + Exonic
1062648260 9:137561451-137561473 AATGGCGGCGTGAACCCGGAAGG + Intronic
1186587326 X:10889241-10889263 AATTGCATCTTGATCCCTGAGGG - Intergenic
1186752456 X:12635318-12635340 AGTGGGGTGTTGAGGCCTGATGG + Intronic
1192947112 X:75976245-75976267 AAGGGGATCTTGTACCCTGTGGG - Intergenic
1196647142 X:118130265-118130287 AATGAGATGCTGAACCCTGAAGG - Intergenic