ID: 1023305108

View in Genome Browser
Species Human (GRCh38)
Location 7:38817816-38817838
Sequence GTTTGTGACCGGAGGGAAGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023305108_1023305112 -10 Left 1023305108 7:38817816-38817838 CCTTCTTCCCTCCGGTCACAAAC 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1023305112 7:38817829-38817851 GGTCACAAACTGCTTGCAACTGG 0: 1
1: 0
2: 0
3: 8
4: 161
1023305108_1023305113 6 Left 1023305108 7:38817816-38817838 CCTTCTTCCCTCCGGTCACAAAC 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1023305113 7:38817845-38817867 CAACTGGATCTCACGAAATGTGG 0: 1
1: 0
2: 0
3: 6
4: 84
1023305108_1023305114 7 Left 1023305108 7:38817816-38817838 CCTTCTTCCCTCCGGTCACAAAC 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1023305114 7:38817846-38817868 AACTGGATCTCACGAAATGTGGG 0: 1
1: 0
2: 0
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023305108 Original CRISPR GTTTGTGACCGGAGGGAAGA AGG (reversed) Exonic
900835094 1:4997075-4997097 GTTGGGGACCGGAAGGAAGTGGG + Intergenic
901032874 1:6318483-6318505 CTTTGTGCACGGAGGTAAGAAGG - Exonic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
905478831 1:38247488-38247510 GCTGGTGACCGGAGGCCAGAGGG - Intergenic
910215368 1:84838639-84838661 GGTTGAGACTGGAGGCAAGAAGG - Intronic
911370539 1:96989592-96989614 GTTTCTGACCAAAGGGAAGGAGG - Intergenic
911437287 1:97877255-97877277 GATGGTGACCAGTGGGAAGATGG + Intronic
911684508 1:100759404-100759426 GTTTGTTATGGGAAGGAAGAAGG + Intergenic
912573401 1:110641796-110641818 GTGTGTGTAGGGAGGGAAGATGG + Intergenic
914804620 1:150983108-150983130 GTCTGTGACTGGCGGGAAGATGG + Exonic
915099656 1:153490174-153490196 GTTTGAGACGGGAGGAATGATGG - Intergenic
920838168 1:209531238-209531260 GTTTGTGACCTGATAGACGATGG + Intergenic
922349889 1:224726666-224726688 GTTTGTGATCAAAGGGAAGTTGG - Intronic
923228024 1:231957279-231957301 GTTTGCGGAGGGAGGGAAGAGGG - Intronic
1063087637 10:2833845-2833867 GTTTGTCACTTGAGGGAACAGGG + Intergenic
1065574407 10:27103501-27103523 GTTTGTGAGAGGGGAGAAGATGG + Intergenic
1066055952 10:31680203-31680225 GTGTATGACCAGAGGGAAGAGGG + Intergenic
1066620613 10:37345290-37345312 GTCTGTGACAGGTGGGAGGAGGG - Intronic
1069573608 10:69509067-69509089 TTTTGTGCCCAGAGGGGAGACGG + Intergenic
1070559681 10:77556758-77556780 TATTGTGTGCGGAGGGAAGATGG - Intronic
1071255685 10:83869888-83869910 GCTTGGGACTGGCGGGAAGAGGG - Intergenic
1072731712 10:97850653-97850675 GTGTGTGAGGGGAGGGAAGGCGG + Intronic
1073284832 10:102381349-102381371 GTCTGTGAGCCGAGGGAAGAAGG + Intronic
1076168510 10:128301482-128301504 GTTTGTGACAAGAGGGAAGTAGG - Intergenic
1076562198 10:131374337-131374359 GTTTGTGACTTGAGTGAGGAGGG - Intergenic
1077533146 11:3106663-3106685 GTGAGTGACGGGAGGGAGGATGG - Intronic
1082124709 11:48418498-48418520 GTTTGTGTCTGCAGGGAAGTAGG + Intergenic
1083857282 11:65399528-65399550 GTGTGCGACCGGAGGGAGAAGGG - Intronic
1085181435 11:74540178-74540200 GTAGGAGACCGGAGGGAGGAAGG + Intronic
1085296359 11:75433932-75433954 GGGTGTGACCTGAGGGAAAAGGG - Intergenic
1088468583 11:110169311-110169333 GTTTGTGACAGGTGGGAGGATGG + Exonic
1089728157 11:120501221-120501243 GTTTGGGAGCTGAAGGAAGAGGG - Intergenic
1091215507 11:133898979-133899001 GTTGGTGACAGTGGGGAAGAGGG + Intergenic
1092183644 12:6462972-6462994 GTTCGTGGACCGAGGGAAGAAGG + Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1095709892 12:45277124-45277146 GTTTGTGAGAGAAGGGAAGGGGG - Intronic
1096399417 12:51292799-51292821 GTTTGAGAACGGAAGCAAGAAGG - Intronic
1096483548 12:51959809-51959831 ATTTGTGAGTGGAGGGGAGAGGG + Intronic
1096789695 12:54037091-54037113 GATTGTGACAGGAAGGAGGAGGG - Intronic
1097758162 12:63429527-63429549 GTTCATGATGGGAGGGAAGAAGG - Intergenic
1098553445 12:71791476-71791498 GTTTTTTATTGGAGGGAAGAAGG + Exonic
1101720464 12:107346234-107346256 GTTTGTGATGTGGGGGAAGATGG + Intronic
1101737391 12:107473284-107473306 GGTAGTGACCAGAGGGAGGATGG - Intronic
1105723119 13:23135472-23135494 GTTTGTGAACAGAGGAAAAATGG - Intergenic
1109997941 13:70154342-70154364 CTTTATGACCTGAGGTAAGATGG - Intergenic
1117476525 14:56101108-56101130 GTTTGTTTCCATAGGGAAGATGG - Intergenic
1119471779 14:74904954-74904976 GTCTGTCACAGGAGGGAAGTGGG + Exonic
1119676719 14:76561244-76561266 ATTTGTAAAAGGAGGGAAGAAGG + Intergenic
1121116726 14:91348699-91348721 GTTTGTAACAGGAGGGAAAAAGG + Intronic
1202889638 14_KI270722v1_random:143911-143933 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1124789982 15:32718189-32718211 GTGAGTGGGCGGAGGGAAGAGGG + Intronic
1125680758 15:41528811-41528833 TTTTGTGAGCAGAGGGAAGCTGG + Intronic
1128448599 15:67786935-67786957 GGCTGAGACCGGAGGGAACAAGG + Intronic
1131413598 15:92232192-92232214 GTCTGTGGCTGGAGGGAGGAGGG + Intergenic
1132109109 15:99089247-99089269 GTGTGAGGCTGGAGGGAAGAGGG - Intergenic
1135280591 16:21150977-21150999 GTTGGTGACAGAAGGGAACATGG + Intronic
1143193091 17:5054889-5054911 GTGTGTGACTGGAGGGAGGTAGG + Intergenic
1143675640 17:8430577-8430599 GTTTGTGACAGGAGAGATGTTGG + Intronic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1145758784 17:27412938-27412960 TTTTGTGTCAAGAGGGAAGAAGG - Intergenic
1148731613 17:49840136-49840158 GTTTGTGAAGGGAGAGCAGAGGG - Intronic
1149458340 17:56807635-56807657 GTTTGTGTTTAGAGGGAAGAAGG - Intronic
1151502036 17:74496499-74496521 GTTTGTGATGGGAGTGAAAATGG - Intergenic
1154493111 18:14936400-14936422 GTTTGTGGAGGGAGGGAGGAAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1159354306 18:67317344-67317366 CTTTATGACGTGAGGGAAGAGGG - Intergenic
1165071720 19:33259665-33259687 CCTTGTGACCGGAAGGGAGATGG - Intergenic
1166991511 19:46695607-46695629 GCTTGTGTGCGGAGGGCAGATGG + Intronic
1167956891 19:53073121-53073143 GTTGGGGACTGGAGGGAATAGGG - Intronic
1202665039 1_KI270708v1_random:110678-110700 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
926690402 2:15729262-15729284 GTCTGTGACTGGAAGGCAGAAGG + Intronic
927520827 2:23696994-23697016 GTGTGTGGCTGGAGGGAGGAAGG - Intronic
927912940 2:26914488-26914510 ATTTGTGACAGAAGGGAAGGAGG + Intronic
928003679 2:27543866-27543888 GGTTGAGACAGGAGGGAAGCTGG - Intronic
928192275 2:29182523-29182545 GTTAGTGACCCCAGGTAAGACGG - Exonic
930568450 2:53053173-53053195 GTATTTGCCAGGAGGGAAGAGGG - Intergenic
932574096 2:72953371-72953393 ATTTGAGACTGGAGGGAAGGAGG + Intronic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
936078088 2:109414528-109414550 GTTTGTGACCGTAGCCAAGATGG - Intronic
936444242 2:112584050-112584072 GCTTGGAACAGGAGGGAAGAGGG - Intergenic
937144234 2:119628375-119628397 CATTGTGCCCGAAGGGAAGAAGG - Intronic
938065682 2:128280855-128280877 GTGTGTGTCCTGAGGCAAGAGGG - Intronic
1169524027 20:6403402-6403424 GTATGTGAACAGAGGGAGGAAGG + Intergenic
1169682623 20:8232766-8232788 GTTTTGGACTGGAGGAAAGATGG + Intronic
1170013799 20:11757656-11757678 GTTTGAGCCCGGAGAGGAGAAGG - Intergenic
1172962838 20:38810595-38810617 GTTTCTCACCTGAGAGAAGAGGG + Intronic
1175397262 20:58675059-58675081 CCTTGTGGCTGGAGGGAAGATGG - Intronic
1175613985 20:60376965-60376987 GTTTATCAGCAGAGGGAAGAAGG + Intergenic
1175825229 20:61933342-61933364 GCTGGTGATGGGAGGGAAGAAGG - Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1180155429 21:45975086-45975108 GTTTGTGCCCGGAGGGCAGGTGG - Intergenic
1180331765 22:11487598-11487620 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1183481323 22:38067096-38067118 GTTTGCGTGGGGAGGGAAGAAGG + Intronic
1185310613 22:50152249-50152271 GTCAGTGACAGGAGGGCAGAGGG + Intronic
953738716 3:45518059-45518081 GTTTCTGACCTGAGAGATGACGG - Exonic
954976432 3:54699435-54699457 GTTAGTGACTGGGGGGAAGCAGG - Intronic
960460334 3:117926365-117926387 GATTGTGACTGGGGGGAAGAAGG + Intergenic
962031928 3:131610105-131610127 ATTTGTGAAAGGAGGGAAAAAGG - Intronic
967324259 3:188223587-188223609 ATTTGTGCCTGGAGGGAAGCTGG + Intronic
968328960 3:197847422-197847444 GATAGTGACAGGAGGGAAGATGG - Exonic
969061110 4:4435908-4435930 GGTTGGGAGCGGAGGGGAGAGGG + Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
972580521 4:40391715-40391737 TTTTGTGACCAGAGAGAATAAGG + Intergenic
975329799 4:73100070-73100092 GTTTGTGAACAGAGGAAAAATGG - Intronic
977160425 4:93627779-93627801 GTTTGTGATCTGTGGGCAGATGG - Intronic
983177499 4:164608208-164608230 GTTCGTAAGCGGAGGGAGGAGGG - Intergenic
984151495 4:176138557-176138579 TTTGGTGATGGGAGGGAAGATGG - Intronic
985096016 4:186413949-186413971 GTTTGTCCCCCGAGGGGAGAGGG + Intergenic
985971981 5:3385419-3385441 CTTTGTGACCCCAGAGAAGAGGG - Intergenic
986056472 5:4142201-4142223 GTGGGTGACTGGAGGTAAGAGGG + Intergenic
987097491 5:14562826-14562848 GTTTGTTACCAGAAGAAAGAGGG - Intergenic
989063987 5:37441136-37441158 AATTGTAACAGGAGGGAAGAAGG + Intronic
990149261 5:52798726-52798748 ATTTGTGTCAGGAGGGCAGAGGG + Intronic
990232436 5:53727930-53727952 GCTTGTGACTGGTGGGAAGGAGG + Intergenic
990788527 5:59450772-59450794 GTTGGTAACAGGAGGGAAAATGG - Intronic
990901641 5:60757069-60757091 TTTATTGACTGGAGGGAAGATGG + Intronic
994417797 5:99496966-99496988 AATTGTAACAGGAGGGAAGAAGG + Intergenic
994462168 5:100078190-100078212 AATTGTAACAGGAGGGAAGAAGG - Intergenic
996446703 5:123561592-123561614 TTTTGTAACAGGAGGGAAGGAGG + Intronic
997047463 5:130335644-130335666 GTTTGTGATTGAAGTGAAGAAGG - Intergenic
999631885 5:153579991-153580013 GTATGTGACATGAGGGAAGAGGG - Intronic
1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG + Intergenic
1000300172 5:159949947-159949969 GCTTGTGACAGGAGGGGAGTGGG - Intronic
1006474548 6:34245822-34245844 GTTTGTGAACAGAGGAAAAATGG - Exonic
1007231720 6:40352832-40352854 GTTTGTAGCTGGAGAGAAGAGGG - Intergenic
1007527318 6:42507870-42507892 ATTTGTGACAGGAGGGAGGGGGG - Intergenic
1008074062 6:47127395-47127417 GTTTGTGACCAGTGTGAAGCAGG - Intergenic
1009856699 6:69274290-69274312 GTTTGTGACCTGAGGATTGAAGG - Intronic
1013224477 6:108110523-108110545 GTTTGTTACCAAAGGGATGATGG + Intronic
1017085161 6:150706899-150706921 TTTGGTGAGGGGAGGGAAGAAGG - Intronic
1017286264 6:152680157-152680179 GTGTGTGAGGGGAGGGGAGATGG - Intergenic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1019853941 7:3585693-3585715 GTTTGGTAGGGGAGGGAAGAAGG + Intronic
1020094427 7:5360757-5360779 GTTTCTGACCGAAGAGAGGATGG - Intronic
1021649863 7:22822634-22822656 GAAAGTGACTGGAGGGAAGAGGG - Intronic
1023305108 7:38817816-38817838 GTTTGTGACCGGAGGGAAGAAGG - Exonic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1031043456 7:116862593-116862615 GTTTGTCGCCAGAAGGAAGATGG + Exonic
1031542608 7:123013323-123013345 GTGGGTGAAGGGAGGGAAGAAGG - Intergenic
1034424235 7:151006206-151006228 GCATATGCCCGGAGGGAAGATGG + Intronic
1036143479 8:6229481-6229503 ATTTGTGACAGAAGAGAAGATGG - Intergenic
1037373726 8:18206408-18206430 GTTTTTGAGCGGGGGCAAGATGG - Intronic
1037454627 8:19051189-19051211 GATTGGGACCAGAGGGAGGAGGG - Intronic
1037607371 8:20449078-20449100 GCTTTTGAAGGGAGGGAAGAAGG - Intergenic
1038182571 8:25242844-25242866 GTTTGTCACTGGAGGGTGGATGG + Intronic
1039541954 8:38380613-38380635 GTTTGCAACCAGAAGGAAGAGGG + Intronic
1039839694 8:41284916-41284938 GTGTCTGACCTGAGGGAAGAAGG - Intronic
1045081368 8:98629402-98629424 GTTTGTGAGAGGAAGGAAGGTGG - Intronic
1049726079 8:144147187-144147209 GTTTGTGATCGGAGTGAAAGTGG + Intergenic
1050040742 9:1490720-1490742 GTTTGGGGCCGGGGAGAAGAGGG + Intergenic
1050289511 9:4139530-4139552 GTATGTAACAGGAGGGAATATGG - Intronic
1051874444 9:21776596-21776618 GTCTGTGACCAAAGAGAAGATGG + Intergenic
1052049729 9:23831290-23831312 GTTAGAGACCGGAGGGAGGTGGG - Intergenic
1056856219 9:90131897-90131919 GTCTGTGACTGGAGGGATGTGGG - Intergenic
1057280624 9:93708655-93708677 GTTTCTGACTGGAAGGAACATGG - Intergenic
1057281211 9:93712957-93712979 GTTTGTGGCTGCAGGGAAGTGGG + Intergenic
1059646655 9:116274835-116274857 GTGTCTGACTGGAGGGCAGAGGG - Intronic
1186712734 X:12217047-12217069 GTTTGTGAAAGGAGGGAACCAGG + Intronic
1187770188 X:22686964-22686986 GCTTGTTACGGGAGGGAAAAGGG - Intergenic
1187990771 X:24869757-24869779 GTTTGTGGATGGAGGAAAGAAGG - Intronic
1189180448 X:38999596-38999618 GTTTGTGGAAGTAGGGAAGAGGG - Intergenic
1189226560 X:39418296-39418318 GTTTGTGACAGGTGGAAGGAGGG + Intergenic
1192216699 X:69164440-69164462 GTATATGACAGGAAGGAAGAAGG + Intronic
1195726960 X:107927849-107927871 GTGCGTGACAGGAGGGAGGAAGG - Intergenic