ID: 1023305365

View in Genome Browser
Species Human (GRCh38)
Location 7:38820120-38820142
Sequence CCTCATCCAAGCCATCACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023305356_1023305365 27 Left 1023305356 7:38820070-38820092 CCCCAAAGCGAGAACCTGAACTG 0: 1
1: 0
2: 0
3: 2
4: 105
Right 1023305365 7:38820120-38820142 CCTCATCCAAGCCATCACTAAGG 0: 1
1: 0
2: 0
3: 10
4: 138
1023305362_1023305365 -9 Left 1023305362 7:38820106-38820128 CCGTCTTTCATCACCCTCATCCA 0: 1
1: 0
2: 2
3: 51
4: 524
Right 1023305365 7:38820120-38820142 CCTCATCCAAGCCATCACTAAGG 0: 1
1: 0
2: 0
3: 10
4: 138
1023305360_1023305365 3 Left 1023305360 7:38820094-38820116 CCCTGAGCTCTTCCGTCTTTCAT 0: 1
1: 0
2: 0
3: 14
4: 194
Right 1023305365 7:38820120-38820142 CCTCATCCAAGCCATCACTAAGG 0: 1
1: 0
2: 0
3: 10
4: 138
1023305357_1023305365 26 Left 1023305357 7:38820071-38820093 CCCAAAGCGAGAACCTGAACTGA 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1023305365 7:38820120-38820142 CCTCATCCAAGCCATCACTAAGG 0: 1
1: 0
2: 0
3: 10
4: 138
1023305359_1023305365 13 Left 1023305359 7:38820084-38820106 CCTGAACTGACCCTGAGCTCTTC 0: 1
1: 0
2: 3
3: 19
4: 173
Right 1023305365 7:38820120-38820142 CCTCATCCAAGCCATCACTAAGG 0: 1
1: 0
2: 0
3: 10
4: 138
1023305361_1023305365 2 Left 1023305361 7:38820095-38820117 CCTGAGCTCTTCCGTCTTTCATC 0: 1
1: 0
2: 0
3: 9
4: 121
Right 1023305365 7:38820120-38820142 CCTCATCCAAGCCATCACTAAGG 0: 1
1: 0
2: 0
3: 10
4: 138
1023305358_1023305365 25 Left 1023305358 7:38820072-38820094 CCAAAGCGAGAACCTGAACTGAC 0: 1
1: 0
2: 0
3: 5
4: 57
Right 1023305365 7:38820120-38820142 CCTCATCCAAGCCATCACTAAGG 0: 1
1: 0
2: 0
3: 10
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023305365 Original CRISPR CCTCATCCAAGCCATCACTA AGG Intronic
900659673 1:3776282-3776304 CCTCATCCTGGCCTTCACAAGGG - Intergenic
901808701 1:11753580-11753602 CCCCATCCAAGCCACCAACATGG - Intronic
903010573 1:20327388-20327410 ACTCAACCTAACCATCACTAAGG - Intronic
903570074 1:24297762-24297784 CCTCACCCAAGCCTTCCCTTAGG - Intergenic
904695363 1:32327575-32327597 CCTCTTCCACGCCGTCACCATGG - Exonic
904996685 1:34636712-34636734 CCCAAGCCAAGCCATCACAAAGG - Intergenic
907656269 1:56344647-56344669 TCTCAGACAAGCAATCACTAAGG + Intergenic
908586760 1:65578190-65578212 CCTTATCCAGTCCATCACTGAGG + Intronic
910564758 1:88631050-88631072 CCACATCCAATCAATTACTAAGG - Intergenic
914197154 1:145453486-145453508 CCTCATCCCAGGCAGCACAAGGG + Intergenic
915543119 1:156581466-156581488 CAGCATCCAAGCCCTCACCAGGG + Exonic
915570138 1:156740886-156740908 CCTCATCCCAGACATCGCCAAGG + Intronic
923254347 1:232208156-232208178 CATCATCCATGCTATCACAAGGG - Intergenic
923918368 1:238535017-238535039 CCTTATCCTAGCCAACACTTGGG + Intergenic
1065140688 10:22715269-22715291 CTTCTTCCAATCCATCACTATGG + Intergenic
1065563976 10:26990600-26990622 CCTAATCCGAGCCATGTCTATGG + Intergenic
1067672063 10:48332577-48332599 CCTGATCCCAGACATCCCTAAGG - Intronic
1068073837 10:52229439-52229461 CCTCCTCAAAGCCATCATGAGGG - Intronic
1069777082 10:70933526-70933548 CCTTCTCCAAGCCACCACCATGG + Intergenic
1070908135 10:80092750-80092772 CCACATACAAGGAATCACTAGGG + Intergenic
1071529453 10:86377650-86377672 CCTCACCCAATCCTTCACAAGGG + Intergenic
1072309195 10:94138292-94138314 CCTCTTCCATGCCATCACCGTGG - Intronic
1073262128 10:102198427-102198449 CCTGATCCCAGACATCCCTAAGG - Intergenic
1074141764 10:110679750-110679772 CCTCAGCCAAGCCCTCTCTCAGG - Intronic
1074458601 10:113616445-113616467 CCTTATCCTAGCCAACTCTAGGG - Intronic
1075933837 10:126322894-126322916 CCTCATATAACCCATCATTATGG - Intronic
1077134978 11:994001-994023 CCTCAGCCAAGCCAGCCCGAAGG - Intronic
1080919109 11:36690915-36690937 CCTCATACAAGCCACCATCAGGG - Intergenic
1084052027 11:66606216-66606238 CCTCCCCCAACCCCTCACTATGG + Intergenic
1084398113 11:68927910-68927932 CCTATTCCCAGCCATCCCTATGG - Intronic
1088604572 11:111515391-111515413 CCACATCCTAGGCCTCACTAAGG - Intronic
1088952255 11:114583786-114583808 CCTCTTCCATGCCATCATCATGG - Intronic
1090277210 11:125428769-125428791 CCTCAGCCAAGCCCCCACAATGG - Intronic
1091996220 12:4996261-4996283 CCTCAACCAAGTCACCTCTATGG + Intergenic
1096103729 12:48984741-48984763 CCTCCTCCAAGCAGGCACTATGG - Intergenic
1096722404 12:53532987-53533009 CCTCTGCCAATCCAGCACTATGG - Intronic
1097074461 12:56382702-56382724 GCTCATCCAAGTTATCTCTAAGG + Intergenic
1100151718 12:91745782-91745804 CTTCATCAAAGCCATTACTATGG - Intergenic
1100181961 12:92095629-92095651 CTCCATCCAATCCACCACTAAGG + Intronic
1100382325 12:94073430-94073452 CCACAGCCAACCCATCACTAGGG + Intergenic
1105700947 13:22935410-22935432 CCACATCCAAGCCAAGACTCAGG + Intergenic
1105845507 13:24290566-24290588 CATCATCCCAGCCCTCTCTAAGG - Intronic
1108935403 13:55875439-55875461 CCTGATCCCAGACATCCCTAAGG - Intergenic
1109120871 13:58455296-58455318 TCTCAGACAAGCAATCACTAAGG + Intergenic
1112622589 13:101067121-101067143 CCTCATCCAAGCAAACACTCAGG - Intronic
1117242670 14:53850534-53850556 TATCATCAAAGCCATCACCAAGG - Intergenic
1119172937 14:72548164-72548186 CTTCATCCAAGTCATCAAAAAGG - Intronic
1119408116 14:74411286-74411308 TCTCATCCCAGCCATCTCTTTGG - Intronic
1122842555 14:104473461-104473483 CCGCATCCAAGCCAAGACTCAGG + Intergenic
1125370350 15:38969263-38969285 CCACATCCATGCCAACACTGTGG - Intergenic
1126263326 15:46720701-46720723 ACTCTTCCAAGCCATGAATATGG + Intergenic
1126419376 15:48455412-48455434 CATCATCAAAGCCATCTCTGAGG + Intronic
1129897994 15:79122814-79122836 CCTCAGCAAAGCCACCACTCAGG + Intergenic
1129972812 15:79795281-79795303 CCTCATCCTAGCCATCCTTCAGG + Intergenic
1132422529 15:101684600-101684622 CCTCAAACATGCCATCATTATGG + Intronic
1132556391 16:574602-574624 CCTCATCAAAGCGGTCACTGCGG - Exonic
1136294284 16:29292913-29292935 ACTCATCCCAGCCATAACCAGGG + Intergenic
1140464160 16:75166019-75166041 CCTCATTCAAGCCATAAAAATGG - Intronic
1141945399 16:87305735-87305757 CCTCCTCCAGGCCATCCCGAGGG - Exonic
1142100190 16:88266959-88266981 ACTCATCCCAGCCATAACCAGGG + Intergenic
1142389883 16:89792316-89792338 CCTCATCAAGGCCACCACTCAGG - Intronic
1144520577 17:15949985-15950007 CATCATCCAACCCATTACCATGG - Intronic
1150948141 17:69770035-69770057 CCTCAGACAAGCAATCCCTAAGG - Intergenic
1151321066 17:73352596-73352618 CCTCATCAAAGACATCCCCAAGG - Exonic
1154184147 18:12167022-12167044 CTTCATCCATGCCACCACAAAGG + Intergenic
1158441425 18:57477825-57477847 CCTCATCCATCCCATTAGTAGGG + Exonic
1158588697 18:58762281-58762303 CCCCGCCCAAGCCATCACAATGG + Intergenic
1160816012 19:1036120-1036142 CCTCACCCAGGCCAAGACTAAGG + Exonic
1163419518 19:17206276-17206298 CCCCATCCACGCCATCACAGGGG + Exonic
1164831391 19:31323969-31323991 CCTCATTCAAGGCATCACCGAGG + Intronic
1165086516 19:33352163-33352185 CCTGATACAAGCAATCAATATGG + Intergenic
1165310672 19:35027792-35027814 CCTGCTCCAAGCCATCAGTTAGG - Intergenic
1166550353 19:43661835-43661857 CCACATCTAATCCACCACTAAGG + Intronic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
1167691715 19:50988871-50988893 CTTCATTCAATCCATCACCAAGG - Intergenic
1168400347 19:56082032-56082054 CCATATCCAAGCCCTCACTGCGG + Intergenic
928801476 2:35099274-35099296 TCTCATCCTAGCCATGACCATGG - Intergenic
930898119 2:56469782-56469804 CTCCATTCAGGCCATCACTAAGG - Intergenic
931198275 2:60073588-60073610 CCACCTCCAAGCCTTCAGTAAGG - Intergenic
931676895 2:64706204-64706226 ACTCTTCCAGGCCATCACTGTGG + Intronic
931690735 2:64832639-64832661 CCCCATTCAACCCATCACCAAGG - Intergenic
932955287 2:76344565-76344587 CCGCATCCAACCCAACACTTGGG + Intergenic
940308928 2:152256278-152256300 CTCCATCCAAGCCAGCTCTAAGG - Intergenic
940619206 2:156089614-156089636 CATCTTCCAAACCATCACTTTGG - Intergenic
942776973 2:179593741-179593763 ACTCATCCAAGTTATAACTAGGG + Intronic
943748392 2:191486123-191486145 CTTCATCCAAGACATCCCAAGGG - Intergenic
943772695 2:191735630-191735652 CCTCATCCTAGCCTTCTCAAAGG + Intergenic
947243364 2:228019930-228019952 CCTCAGCCAAGCCATCACAGTGG - Exonic
1168918006 20:1507285-1507307 CAACATCCAAGCCATAACCAGGG - Intergenic
1169194365 20:3675296-3675318 CCACAACTAAGCCATCACCAAGG - Intronic
1169918788 20:10710970-10710992 CCTCATTCAAGTCATGAGTATGG + Intergenic
1171128906 20:22629897-22629919 CCTCATCCAAGACAACCCAAGGG - Intergenic
1174737616 20:52980558-52980580 CCACATCTAAGCCATTTCTATGG + Intronic
1177107543 21:16978702-16978724 CCTCATCCATGGCTTCTCTAGGG + Intergenic
1179112460 21:38459131-38459153 TTTCTTCCAAGCCATCACTCAGG + Intronic
1180657756 22:17437559-17437581 CCCCATCCATACCATCACTGAGG + Intronic
1182253967 22:29024825-29024847 CAGCATCCAAGCAGTCACTATGG - Intronic
949554936 3:5144651-5144673 CCTGATCCCAGACATCCCTAAGG - Intronic
950921587 3:16700285-16700307 CATCTTCAAAGCCAGCACTAAGG + Intergenic
951858217 3:27221873-27221895 CCTCAGCCAAGCCCTCCCTAAGG - Intronic
953184430 3:40625121-40625143 CCTCATCCATGACTTCACTCTGG - Intergenic
955190867 3:56760486-56760508 CCTGAGCCCAGCAATCACTAGGG - Intronic
956356808 3:68402724-68402746 CCTCATCCAAGCCAAGAGTCTGG - Intronic
958526000 3:95260177-95260199 CCTCATCGAAACCTTCACTTTGG + Intergenic
963123427 3:141794796-141794818 CCGTATCCAAACCATCACTGAGG - Intronic
967525485 3:190487796-190487818 CCTCATCTAAGGCAACTCTACGG + Intergenic
967894165 3:194383427-194383449 CCTAATCCAAGCCATCCACAGGG - Intergenic
968131980 3:196197404-196197426 CCTCCTCCAAGCCCTCACCCAGG + Intergenic
969328582 4:6459165-6459187 CCTCAGGCAAGCCATCCATATGG - Intronic
974373536 4:61047154-61047176 CCTCATGCAAGCCACCAATGTGG - Intergenic
978204682 4:106067156-106067178 CCTCATCCTTGCCAACACTTGGG + Intronic
980751495 4:137095849-137095871 CCTCATCCCATCCATCAGTAAGG - Intergenic
983599566 4:169510889-169510911 CCTCTTCAAAGCCTTCTCTAGGG + Intronic
991656932 5:68913599-68913621 CCTCTTCCAAGCCATGTTTAGGG + Intergenic
992639392 5:78755942-78755964 CCACAGCAAAGCCATCTCTATGG - Intronic
996174905 5:120344427-120344449 CCTCATCCAGTCTATCACTGAGG - Intergenic
997064466 5:130545340-130545362 CCTGATCCCAGACATCTCTAAGG - Intergenic
998193307 5:140044508-140044530 CCTCATCCAATTAATCACCAAGG + Intergenic
999150419 5:149422818-149422840 CCTCACCCCATCCATCACTGTGG - Intergenic
1002322679 5:178384956-178384978 CCCCATCCAAGCCACCACACTGG + Intronic
1003008520 6:2404553-2404575 CCATACCCAAACCATCACTAAGG + Intergenic
1005373299 6:25157003-25157025 CCTAATCTAAGCCATCACCATGG + Intergenic
1006001081 6:30965674-30965696 CCACATCCTAGCCTCCACTATGG + Intergenic
1007947203 6:45837320-45837342 CCTCATCCCATCCATCCCTCAGG - Intergenic
1008684091 6:53904902-53904924 CCTCATCCAAGACATGAGCATGG - Intronic
1014058605 6:117044723-117044745 CCACATCCTTGCCATCACTTGGG - Intergenic
1017585292 6:155914249-155914271 ACTCATCCACGCAATCACAAGGG + Intergenic
1023119936 7:36899053-36899075 CCCCCTCCAAGCCTTCACTCAGG - Intronic
1023305365 7:38820120-38820142 CCTCATCCAAGCCATCACTAAGG + Intronic
1023778925 7:43637504-43637526 CATTATCCAAGACATCATTAAGG + Intronic
1024094953 7:45976025-45976047 CCTCATCCAAACCCTCCCTCTGG - Intergenic
1026178141 7:68015722-68015744 GCCCATCAAAGCCATTACTATGG - Intergenic
1028833860 7:95352482-95352504 CCTCATCCAACCCTTCACTTGGG - Intergenic
1033741615 7:144280291-144280313 GGTCATCCAAGTCATCACCAGGG - Intergenic
1033752286 7:144369323-144369345 GGTCATCCAAGTCATCACCAGGG + Intronic
1039340546 8:36644719-36644741 AGTCAGCCAAGCCATCACAAGGG + Intergenic
1042105621 8:65323348-65323370 CCTCAACCAAGTCAACATTAAGG + Intergenic
1044797528 8:95919516-95919538 CCTCATCCTACCTACCACTAAGG + Intergenic
1045588655 8:103567324-103567346 CCTCATCCCAGCCACCAATCTGG + Intronic
1048125490 8:131630400-131630422 CATTATCCAAGTCATCACTCTGG - Intergenic
1051146306 9:14031224-14031246 CATCATCCCAGCCGACACTAGGG + Intergenic
1055276793 9:74626506-74626528 CCTCACTCAAGCCATCTCTCAGG + Intronic
1056894452 9:90530383-90530405 ACACATCCAAGCCTTCACTCAGG + Intergenic
1062401950 9:136376677-136376699 CCCCATCCAAGCCATCCCTCTGG + Intronic
1062697577 9:137883355-137883377 CCTCATCCCAGGCAGCACAAGGG - Intronic
1189448848 X:41108210-41108232 CATCATCCCAGGCATGACTAAGG - Intronic
1190746036 X:53321908-53321930 CCTCATCCCAGGCATCCCTTGGG + Intergenic
1194993778 X:100571810-100571832 CCTGATCCCAGACATCCCTAAGG - Intergenic
1200230745 X:154442798-154442820 CATCTCCCAAGCCATCGCTAGGG - Exonic