ID: 1023305442

View in Genome Browser
Species Human (GRCh38)
Location 7:38821265-38821287
Sequence ATACAATCCATTTTCTTTGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 324}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023305442_1023305443 5 Left 1023305442 7:38821265-38821287 CCTACAAAGAAAATGGATTGTAT 0: 1
1: 0
2: 2
3: 26
4: 324
Right 1023305443 7:38821293-38821315 CACCATGACAGCAATAGAGAAGG 0: 1
1: 0
2: 0
3: 14
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023305442 Original CRISPR ATACAATCCATTTTCTTTGT AGG (reversed) Exonic
901841736 1:11958022-11958044 ATAGACTCCATTGTCTTTGGTGG + Intronic
902031513 1:13426215-13426237 TCACAATCCAATTTATTTGTTGG - Intergenic
905605802 1:39298582-39298604 AAACAGTTCATTTTTTTTGTCGG + Intronic
906352103 1:45070181-45070203 ATACTGTCCATTTACTTTGTAGG + Intronic
906681944 1:47732994-47733016 ATACCCTCCAGTTTCTTTTTGGG - Intergenic
907483858 1:54763317-54763339 ATACAATTTTTTTTCTTTCTGGG + Intronic
908682534 1:66678271-66678293 AAACAATTCATTTACTTTCTTGG - Intronic
908851158 1:68377513-68377535 ATACAGTTCTTTTTGTTTGTAGG - Intergenic
909159095 1:72122257-72122279 ACACAATCCATTTGTTGTGTTGG + Intronic
909239573 1:73195266-73195288 GTAGAATTCATTTCCTTTGTGGG + Intergenic
909283567 1:73787853-73787875 ATATTGTCCATTTTCTTTCTTGG - Intergenic
910280024 1:85489486-85489508 TTACTATACATTTTCTTTGGGGG + Intronic
910759576 1:90720488-90720510 ATAGATTTCATTTTTTTTGTAGG - Intergenic
911065313 1:93782561-93782583 ATGTACTCCATTTTCTCTGTTGG - Intronic
911156927 1:94646096-94646118 ATAGAATCAAATTTCTTAGTGGG - Intergenic
911194185 1:94977096-94977118 AAACAATACATTATCTCTGTAGG - Exonic
911332542 1:96541889-96541911 ACACAATCCATTTTCATTTCTGG - Intergenic
911424650 1:97693318-97693340 ATACCTTGCATTTTCTTTTTTGG - Intronic
911446889 1:98006192-98006214 AGACAATACATTTTATTTCTGGG + Intergenic
912949967 1:114113818-114113840 GTACAATCCATTTTCCATCTGGG - Intronic
913367445 1:118056288-118056310 ATACAATGCAATCTCTTTTTTGG + Intronic
913380342 1:118203456-118203478 ATAGAATTCATTTGCTTTCTAGG + Intergenic
914371918 1:147033074-147033096 AGACAATTCATTTCCTTTGCTGG - Intergenic
914577599 1:148989732-148989754 AGACAATTCATTTCCTTTGCTGG + Intronic
916866184 1:168861602-168861624 TTACAATTCATTTTATTTCTAGG - Intergenic
916975916 1:170077858-170077880 AGACAATCCATTTTGTTTTTCGG + Intronic
917078528 1:171232691-171232713 ATGCATTCCATTTTTTTTTTTGG + Intergenic
917263986 1:173200125-173200147 TTAAAATTCATTTTCTTTTTTGG - Intronic
918730642 1:187990511-187990533 ATTCATTTCTTTTTCTTTGTTGG + Intergenic
919348949 1:196423735-196423757 ATAGAAACCATTTTTTTTTTTGG - Intronic
919497766 1:198297320-198297342 ATACCATTCATTTTCATTTTTGG - Intronic
920240804 1:204548069-204548091 ATACAGTCCATTTGCTTAATAGG - Intronic
920433544 1:205934146-205934168 GTACAAAGCATTGTCTTTGTTGG - Intronic
924207052 1:241723876-241723898 ATACAATCAACTTTCAGTGTAGG + Intronic
1064187367 10:13174070-13174092 TTCCATTCCATTTTATTTGTGGG - Intronic
1064520509 10:16196023-16196045 TTACCATCCATTGTCTCTGTTGG - Intergenic
1064790839 10:18956393-18956415 ATACATTCCATTGTGTTTGCAGG - Intergenic
1064965805 10:21014066-21014088 ATACACTCCATTCTCTCTGCAGG + Intronic
1066131155 10:32395309-32395331 ATACCACTCATTTTCTTTATTGG - Intergenic
1066224213 10:33366506-33366528 ATAAAAACAATTTGCTTTGTAGG + Intergenic
1067308119 10:45085433-45085455 ACAAAATCCATATTCTTTGAAGG + Intergenic
1068195956 10:53716480-53716502 ATACAATCCAGTTTCCTTATAGG - Intergenic
1068882431 10:62064737-62064759 AGACAATTTATTTTTTTTGTTGG + Intronic
1069042347 10:63708951-63708973 ATACAGTCCATGTGCTTTGGGGG + Intergenic
1070505049 10:77105561-77105583 ATACATTCTAATTTCTTTCTGGG + Intronic
1071720877 10:88145151-88145173 CTAGAAGCCATTTTCTTTCTGGG + Intergenic
1071726634 10:88204815-88204837 ATTCAATACATTTTTTTTGAAGG - Intergenic
1072922364 10:99586983-99587005 ATATATTCCACTTTCTCTGTAGG - Intergenic
1073732430 10:106305743-106305765 ATAAAATACATTTGCGTTGTTGG - Intergenic
1073841315 10:107502229-107502251 ATACAATCCAATTCCATTTTTGG + Intergenic
1079026283 11:16950443-16950465 ATACATACCCTCTTCTTTGTGGG - Intronic
1079807887 11:24957714-24957736 ATATAACACATTTTCTTTGATGG + Intronic
1080576529 11:33604571-33604593 ATATACTACATTTTCTTTATTGG - Intronic
1081021501 11:37954010-37954032 TTAAATTCCATTTTCTTAGTAGG - Intergenic
1081059557 11:38456653-38456675 AGGCAATACATTTTCTTTATTGG - Intergenic
1081647973 11:44803109-44803131 ATACACTCCCTTTTCTTACTAGG - Intronic
1082226881 11:49718512-49718534 GTATAATCCCTTTTCTTTTTCGG - Intergenic
1084381064 11:68813055-68813077 ATATAATCCTTTTTTTTTTTTGG - Intronic
1086849199 11:91789092-91789114 ATATTACCCACTTTCTTTGTAGG - Intergenic
1087335451 11:96838779-96838801 ATACAGTTCATTCTCTTTTTAGG - Intergenic
1087807449 11:102570038-102570060 AGAAAATCCATTTTCTTTTCTGG - Intergenic
1090236273 11:125150164-125150186 ATACAATCCATTGTTTTTCCTGG + Intergenic
1090886026 11:130877663-130877685 ATACCACCCATTTTATTTATTGG - Exonic
1091133826 11:133169918-133169940 ATAAAATCATTTTTGTTTGTGGG + Intronic
1094402178 12:30074062-30074084 ATTCAATTCATATTATTTGTGGG + Intergenic
1095279188 12:40330130-40330152 ATTCCATCCATTCTCTTGGTTGG + Intronic
1096210698 12:49763397-49763419 AGGCTCTCCATTTTCTTTGTAGG - Exonic
1097529759 12:60783459-60783481 ATACAATCCATTTACAAAGTGGG + Intergenic
1097557042 12:61151230-61151252 ATACACTCCATCTTCCTTTTAGG - Intergenic
1098433713 12:70447656-70447678 AGAAATTCCATTTTCTCTGTGGG - Intergenic
1098508543 12:71283816-71283838 ATTCTATACATTTTCTTAGTAGG + Intronic
1098558622 12:71847704-71847726 ATACAATGAATATTATTTGTGGG - Intronic
1100941645 12:99729256-99729278 AGACAGTCCATTGTCTTTCTGGG + Intronic
1101111499 12:101491015-101491037 TTATAAGGCATTTTCTTTGTGGG - Intergenic
1101366960 12:104081722-104081744 TTAAAATCCATTTTATATGTTGG - Intronic
1103291635 12:119850921-119850943 ATCCAATCTACTGTCTTTGTTGG - Intronic
1104287816 12:127441196-127441218 CTACATTCCATTTTCCTTCTAGG - Intergenic
1104616219 12:130271515-130271537 AACCAATTCATTTTCTTTCTGGG - Intergenic
1106730214 13:32533446-32533468 ATAGAATTCATATTCTTTGGAGG - Intronic
1107011819 13:35677751-35677773 ATAAAATCTATGTTCTCTGTGGG + Intergenic
1107297702 13:38929899-38929921 AAACATTCCATTTTCTATTTGGG + Intergenic
1109031162 13:57190354-57190376 ATATAATCCATATTTCTTGTTGG + Intergenic
1109190774 13:59320870-59320892 ATACAACCAATATTCTTTTTAGG + Intergenic
1109864833 13:68249345-68249367 ATACACTACATTTTATTTATAGG + Intergenic
1109896642 13:68700593-68700615 ATACAATATTTTTTATTTGTTGG - Intergenic
1110118164 13:71846089-71846111 ATACAATTCAGTTTCTTCTTGGG - Intronic
1110330311 13:74264595-74264617 GTAAAAACCCTTTTCTTTGTTGG + Intergenic
1111410745 13:87873488-87873510 ATCCAATCCAATATCTTTATTGG - Intergenic
1111426396 13:88089760-88089782 ATAAAAGCCATTTTGTTTTTTGG + Intergenic
1111644970 13:91021297-91021319 ATGCAATCCATTTTATTTTCTGG - Intergenic
1112725243 13:102296187-102296209 AGACCATCTGTTTTCTTTGTGGG - Intronic
1113964853 13:114147271-114147293 ATACAATTTGTTTTCTTTGATGG + Intergenic
1113965281 13:114149357-114149379 ATACAATTTGTTTTCTTTGATGG - Intergenic
1114847402 14:26339742-26339764 ATATAATCCATCATATTTGTAGG + Intergenic
1114893291 14:26952854-26952876 GTAGAATCCACCTTCTTTGTTGG + Intergenic
1114899450 14:27038659-27038681 AAACACTCTAATTTCTTTGTGGG - Intergenic
1115072122 14:29336608-29336630 TCACAATGCATTTTATTTGTTGG - Intergenic
1115173587 14:30536049-30536071 GTACCAGCTATTTTCTTTGTGGG + Intergenic
1116105854 14:40504094-40504116 ATACAAAACATTTTATTTGTTGG - Intergenic
1116307759 14:43280583-43280605 TTACAATACATTTTCTATGCCGG + Intergenic
1116964024 14:50996228-50996250 CTACAGTACAGTTTCTTTGTTGG + Intronic
1117730989 14:58721487-58721509 ATAGAAAACATTTTCTTTGAAGG + Intergenic
1117791444 14:59346121-59346143 ACACAATCCCTTTTTTTTGGGGG + Intronic
1119373322 14:74166594-74166616 ATATAATTCATTTTCTGGGTGGG + Intronic
1120095098 14:80379554-80379576 TTTAAATCCATTTTCTCTGTAGG - Intronic
1120384558 14:83827779-83827801 TTATAAACCATTTTGTTTGTCGG + Intergenic
1121384482 14:93506848-93506870 AAACATTCCATTGTCTTTTTTGG - Intronic
1121474797 14:94188436-94188458 ATACAAGGCATTTTGATTGTAGG - Intronic
1121488716 14:94342560-94342582 ATAGAATCCATGTTCTTGCTGGG - Intergenic
1121575571 14:94982639-94982661 AAACTATCCTTTGTCTTTGTTGG - Intergenic
1122311551 14:100799243-100799265 ATGAAATGCATTTTCTATGTCGG - Intergenic
1123969094 15:25488255-25488277 ATAAAATGCACTATCTTTGTGGG - Intergenic
1124064215 15:26324758-26324780 ATACAGTACGTATTCTTTGTGGG + Intergenic
1124403620 15:29374318-29374340 TTCCATTCCATTTCCTTTGTTGG + Intronic
1126139104 15:45422730-45422752 TTACTATACATTTTCTTTGTTGG + Intergenic
1127985226 15:64064553-64064575 ATACAATGTATTTTCTCTCTTGG - Intronic
1128403286 15:67308149-67308171 CTACAATACATTTTACTTGTGGG - Intronic
1129549803 15:76436036-76436058 CTCCCATTCATTTTCTTTGTTGG + Intronic
1129573001 15:76709795-76709817 ATACAATAGTTTTTATTTGTTGG - Intronic
1130568479 15:85019556-85019578 ATACTATTCATTATTTTTGTGGG + Intronic
1132137831 15:99360884-99360906 TTAAAATCTATTTGCTTTGTGGG + Intronic
1132436305 15:101806914-101806936 AAACAATCCATTTTGAATGTCGG + Intronic
1133178745 16:4036431-4036453 ATACAATACATTTTGGTTTTGGG + Intronic
1138257887 16:55584120-55584142 AAACAATTCATTTTCTTATTAGG - Exonic
1138740419 16:59302647-59302669 TTACTATCCATTTCCTTTTTTGG - Intergenic
1139081416 16:63525982-63526004 ATTGAATACATTTTCTTGGTAGG - Intergenic
1140225760 16:73075405-73075427 AAACAATCAGTTTTCATTGTTGG + Intergenic
1140304764 16:73792764-73792786 ATACCAACCTTTTTCTTTGAAGG + Intergenic
1143173927 17:4945814-4945836 ACACAAACCATTTTATTTTTTGG - Exonic
1143929520 17:10407331-10407353 ATAAAATCCATTTTTTCTCTGGG + Intronic
1146706702 17:35005516-35005538 ATACTGTCCATTTACTTTGTAGG - Exonic
1148530107 17:48381757-48381779 ATACAATACACTTACCTTGTAGG - Intronic
1148970643 17:51478227-51478249 ATATAATCAATGTTCTTTCTGGG + Intergenic
1149114718 17:53079237-53079259 ATGCAAACCATTATTTTTGTTGG - Intergenic
1149977165 17:61278014-61278036 AAACAAACCATTTTTTGTGTGGG - Intronic
1150254466 17:63732881-63732903 CTAAAAACCATTTTCTTTTTGGG + Intronic
1151625856 17:75275331-75275353 TTATAATGCATTTTCTTTGTAGG - Intronic
1151780441 17:76241411-76241433 AAACCTTCTATTTTCTTTGTGGG + Intergenic
1151855469 17:76718445-76718467 ATTGAATCCATTTTCTATCTTGG - Intronic
1152608043 17:81302824-81302846 ATAAAATCCAGTCTCTTTGCTGG - Intergenic
1153016992 18:591754-591776 ATACAATCAATTTGCTTAATAGG + Intergenic
1154101761 18:11481415-11481437 GGATAAACCATTTTCTTTGTCGG + Intergenic
1156117640 18:33805394-33805416 ATAAAAGTCATTTTCTTTGTAGG + Intergenic
1156203745 18:34863425-34863447 ATACAATCCATTTAAATTTTTGG - Intronic
1156511712 18:37642277-37642299 AAACATTTTATTTTCTTTGTTGG - Intergenic
1156878179 18:42042085-42042107 AAACAATCCACTTTCCTTCTGGG + Intronic
1159290817 18:66416489-66416511 AAAATATCCATGTTCTTTGTAGG + Intergenic
1159499482 18:69251231-69251253 ATACAATAATTTTTGTTTGTTGG + Intergenic
1159550531 18:69891104-69891126 ATACAATCCATTTAATGTGATGG - Intronic
1164616810 19:29672152-29672174 ATTCAATCGTTTTTCTTTGTGGG - Intronic
1165577430 19:36833129-36833151 ATACAATATCTTTTGTTTGTTGG + Intronic
1166654992 19:44604577-44604599 TTACAATCCATTCTCTCTGAAGG + Intergenic
925514771 2:4668417-4668439 AGACAATGCATTTTCAATGTAGG + Intergenic
927049833 2:19316408-19316430 ATATAAAACATTTTCTTTATTGG + Intergenic
927106148 2:19828859-19828881 ATATAATCCATTGTATTTCTAGG + Intergenic
927318822 2:21719075-21719097 ATAAAATTAATTTTGTTTGTGGG - Intergenic
927373539 2:22385813-22385835 ACACAAACCATTCTCTTTATGGG + Intergenic
927809817 2:26174602-26174624 ATTCAATCCATAATCTTTATTGG - Intronic
928245388 2:29622222-29622244 ATACACTGCTTTTTATTTGTTGG - Intronic
929506390 2:42531407-42531429 AAACAATCTATTTTTTTAGTAGG + Intronic
931093168 2:58909320-58909342 CTGCAATCCATTTTGTTGGTGGG - Intergenic
931654780 2:64500973-64500995 ATGAATTCCATTTTCTTTGCAGG - Intergenic
933046853 2:77549580-77549602 ATACAATGTCTTTTCTGTGTGGG + Intronic
935885429 2:107614131-107614153 ATACAATCAATTCTCTGTGTAGG + Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
937622518 2:124005101-124005123 TTAGAATCCATTTACTTTTTTGG - Intergenic
938404495 2:131022679-131022701 CTACAATTCATTTTGTGTGTGGG - Intronic
938451105 2:131421375-131421397 ATACAATTCATATTCTTATTTGG - Intergenic
939086549 2:137726085-137726107 ATAGACTCCTTTTTCTTTGAAGG + Intergenic
939167245 2:138652965-138652987 ATACAATCCATTTTTTGCGGGGG - Intergenic
940704376 2:157085432-157085454 ATATAATCAATTTTATATGTAGG - Intergenic
940772373 2:157853163-157853185 ATACAATCTATTTATTTTTTGGG - Intronic
941706117 2:168659862-168659884 ATTAATGCCATTTTCTTTGTAGG + Intronic
941809308 2:169739358-169739380 ATTAAATCCAGATTCTTTGTTGG + Intronic
942156789 2:173137679-173137701 ATAGATTCCCTTTTCTTTTTTGG - Intronic
942354223 2:175090494-175090516 ATATAATGCTTTTTCTTTTTTGG + Intronic
942455048 2:176131671-176131693 ACACCACCTATTTTCTTTGTTGG + Exonic
942912906 2:181267223-181267245 GTAAAATCCATTTACTTTGTAGG + Intergenic
943373116 2:187041227-187041249 ATACAATCCTTTTGGATTGTAGG + Intergenic
943511672 2:188834466-188834488 ATTAAATCTCTTTTCTTTGTGGG + Intergenic
944105241 2:196072560-196072582 ATAAAATTCATTTTTTTTGGGGG - Intergenic
944867927 2:203880622-203880644 ATAGATTAGATTTTCTTTGTGGG + Intergenic
944906996 2:204271992-204272014 ATACAATCCATACCCTCTGTAGG + Intergenic
945244494 2:207705768-207705790 ATAGAATACATTTTTTTTTTTGG - Intergenic
945518909 2:210798783-210798805 ATACAATCAATATTCCTTGAAGG - Intergenic
945711323 2:213299674-213299696 ATACTATCCGTTTTCTTAGTGGG + Intronic
945762945 2:213936814-213936836 AAACATTCCATTTTCTTTAATGG - Intronic
947068513 2:226258966-226258988 ATCCAATCAATTTCATTTGTGGG + Intergenic
947271175 2:228337506-228337528 ATACAGTCCAGTTTCTTTTCTGG + Intergenic
1169008427 20:2229149-2229171 AAACAACCAATTTTCTTTTTTGG - Intergenic
1169610390 20:7373215-7373237 ATAGAATCCATCCTCTTTTTTGG + Intergenic
1169875453 20:10292421-10292443 ATAGAATCCATTTTCTTCTTTGG - Intronic
1169948660 20:11017187-11017209 ATACATTTCCTTTTCTTTTTTGG - Intergenic
1170510136 20:17067997-17068019 ATTCAATCAATTTTTTTTGGCGG - Intergenic
1172499337 20:35414042-35414064 ATACAATACATATTCATAGTGGG + Intergenic
1172829931 20:37825028-37825050 ATAGAACCCATTTTATTTGGAGG - Intronic
1174704096 20:52638284-52638306 TTACAAAACATTTTGTTTGTGGG + Intergenic
1176978954 21:15356871-15356893 ATACTTTACATTTTTTTTGTGGG - Intergenic
1177465896 21:21479789-21479811 ATTCTATCCATTTTCTTTCCAGG - Intronic
1177989079 21:28016741-28016763 TTACATTCCATTTTGTTGGTAGG - Intergenic
1178009034 21:28261023-28261045 ATAGAATCAATTTTATTTATAGG + Intergenic
1178144623 21:29724614-29724636 ATACATTAAATTTTCTTTGGAGG + Intronic
1178161549 21:29922758-29922780 TTACACTTCATTTTCTTTATTGG + Intronic
1178736151 21:35153897-35153919 AAACAATCTATTTTCTTTCATGG - Intronic
1182140209 22:27948344-27948366 ATAAATTCCATTTTCTTCTTTGG - Intergenic
1183584273 22:38743078-38743100 ATTTATTCCATTTTCTCTGTGGG - Intronic
949426444 3:3922244-3922266 ATACACACCTTTTTTTTTGTTGG - Intronic
951361443 3:21729393-21729415 AGATAATCCATTTTCACTGTGGG - Intronic
952665995 3:35905087-35905109 TTACCATCTATTTTCTTTGAAGG - Intergenic
953169844 3:40497208-40497230 ATACTATTGATTTTCTATGTTGG + Intergenic
953613938 3:44472922-44472944 TTCAAAGCCATTTTCTTTGTGGG - Intronic
954598373 3:51847228-51847250 ATACAGCCCATTTTTTTTGTTGG + Intergenic
956081259 3:65558784-65558806 ATATAATCTATTTTCTGAGTTGG - Intronic
957217343 3:77337408-77337430 AAACTCTCCATTTTCTTTTTTGG - Intronic
959542065 3:107551446-107551468 ATACAATGCATTTTTGTTGGGGG + Intronic
961942508 3:130652788-130652810 ATACAATGCATTTTTATTGTGGG + Intronic
962106327 3:132394191-132394213 TTACATTCTTTTTTCTTTGTAGG - Intergenic
963278090 3:143352963-143352985 ATAAAATCCATTTTCTTAACCGG + Intronic
964111466 3:153092129-153092151 GTAAAATCCATTTCCTCTGTAGG + Intergenic
965091986 3:164176167-164176189 ATACACCACATTTTCTTTTTTGG - Intergenic
965384308 3:168027592-168027614 ATGCAAGCCATTTTCCTTCTGGG + Intronic
966439800 3:179931328-179931350 ATCCATTCCATTTTTTTTGAAGG + Intronic
966668406 3:182498916-182498938 ATTTAGTACATTTTCTTTGTAGG - Intergenic
968108251 3:196019292-196019314 TTACAATACATCTTCTTAGTGGG + Intergenic
970181132 4:13395530-13395552 ATACAATTACTTTTCTTTTTAGG + Intronic
970181752 4:13404849-13404871 ATACTAACCAGTTTTTTTGTTGG + Intronic
970552816 4:17200218-17200240 ATAAAATCCACTTGCTTTGATGG - Intergenic
970814819 4:20142407-20142429 TTTCATTCTATTTTCTTTGTTGG - Intergenic
970950001 4:21743626-21743648 ACACAATTCCTTTTTTTTGTAGG + Intronic
971131492 4:23815770-23815792 TTACAATACATTTTCTGTTTAGG + Intronic
973743495 4:53940990-53941012 ATATTATCCATTTACTCTGTTGG - Intronic
974522248 4:62996864-62996886 ATACATACCATTTTTTTTGGTGG - Intergenic
976074624 4:81283794-81283816 ATACAAACCATTTCCTGTGCTGG - Intergenic
976807519 4:89064664-89064686 ATACATCCCATTGTTTTTGTGGG - Intronic
977020871 4:91757654-91757676 ATAAATTCCATTTTCTAAGTGGG + Intergenic
977200809 4:94113314-94113336 AAATAATACATTTTCTTTGGAGG - Intergenic
977764414 4:100779715-100779737 ATAGAAACTATTTTCTTTGTAGG - Intronic
979013808 4:115405757-115405779 ACACACTTCATTTTCTTTATAGG - Intergenic
979534794 4:121807290-121807312 ATAAAATCCACTTTTTTTTTTGG - Intronic
980311167 4:131130695-131130717 ATACAAACCATTTTCATTACAGG + Intergenic
981070471 4:140530791-140530813 GTATATTCCATTTACTTTGTAGG + Intronic
981321896 4:143401551-143401573 ATGAAATGCATTTTCTTTATGGG + Intronic
981421764 4:144558668-144558690 ATACAATCTTTTTTCTTTTTTGG - Intergenic
981793674 4:148569773-148569795 AGACAATCAATGTCCTTTGTTGG - Intergenic
982373265 4:154657621-154657643 AAACAAACCATTTTCTTAGATGG - Intronic
982441216 4:155438466-155438488 TTACTTACCATTTTCTTTGTGGG + Intergenic
983719993 4:170839034-170839056 GTACATTCAATTTCCTTTGTGGG + Intergenic
984096663 4:175443531-175443553 TTACAATCTATTTTCTCTGAAGG - Intergenic
984408842 4:179369971-179369993 ATACAACCCATGTTCATTTTGGG + Intergenic
984617818 4:181918115-181918137 GGACAATGCATTTTATTTGTGGG + Intergenic
987015415 5:13813158-13813180 AAATAATGCATTTTCTTTTTTGG - Intronic
987238961 5:15973000-15973022 ATCCAACCTATATTCTTTGTTGG + Intergenic
988089552 5:26519121-26519143 ATACAAGTCTTTTTTTTTGTAGG - Intergenic
988366000 5:30300199-30300221 AAATCATCCATTTTCATTGTTGG - Intergenic
988458239 5:31407605-31407627 GTTCATTCCATTATCTTTGTTGG - Intronic
989258973 5:39397886-39397908 ATACATTCTATTTTCTTCATGGG + Intronic
990090917 5:52047291-52047313 ATAGATTCCATATTATTTGTAGG - Intronic
990277448 5:54213125-54213147 ATAAAATCCTTTTTCTTCTTTGG - Intronic
991255736 5:64612104-64612126 AGACAATACATGTTCTTTGTGGG + Exonic
991318165 5:65336098-65336120 ATACAAACTATTTTCTAAGTTGG - Intronic
992705130 5:79382893-79382915 ATGTAATCCATTTTCATTCTAGG - Intronic
993322516 5:86489870-86489892 TTACAATCCATTTTCTTAAAAGG + Intergenic
993341800 5:86733327-86733349 ATTAAATGCATTTTCTTTATTGG + Intergenic
993453125 5:88096920-88096942 ATACAATTCAATGTCATTGTTGG - Intergenic
993552226 5:89287781-89287803 CTACACTCTACTTTCTTTGTTGG - Intergenic
993886369 5:93420196-93420218 ATACAATTTTTTTTGTTTGTTGG - Intergenic
995314775 5:110756451-110756473 GTCCAATCTATTTTCTTTGCAGG + Intronic
995416085 5:111914973-111914995 ATACAAGTCCTTTTCATTGTAGG + Intronic
995450305 5:112292661-112292683 ATAAAATACATTTTATTAGTAGG + Intronic
996782200 5:127199443-127199465 TTGCATTCCATTTTCTTGGTAGG - Intergenic
998747838 5:145281590-145281612 ACATAATCCATTTTCTTTGACGG - Intergenic
1000684639 5:164233133-164233155 ATACATTCCATTCTGTTTGTTGG + Intergenic
1000855672 5:166395138-166395160 ATACAATCCTTGCTCTTTCTGGG + Intergenic
1000875802 5:166636877-166636899 ATACAATTCATTTTATTTTTTGG + Intergenic
1004576321 6:16898932-16898954 CTACAATTGATTTTCATTGTGGG + Intergenic
1004790417 6:19020330-19020352 ATACCATCAATTTACTTTGCTGG - Intergenic
1006476209 6:34256124-34256146 ATCCACTTTATTTTCTTTGTTGG - Intergenic
1006621034 6:35364266-35364288 ATATATTCCATTTTATTTATTGG + Intronic
1009321752 6:62299490-62299512 ATTCAAGCCATTTTCTTAGGAGG + Intergenic
1010758607 6:79696200-79696222 ACACACTCCTTTTCCTTTGTGGG - Intronic
1011003280 6:82615472-82615494 ATACAACCCATTTTCTTTGCAGG - Intergenic
1012351079 6:98251207-98251229 ATACTCTCCATTCTCTTTGTTGG - Intergenic
1012455539 6:99399839-99399861 GTAAAAACCATTTTCTTTGGGGG + Exonic
1012706750 6:102540629-102540651 TTAGAATCCTTTTTCATTGTTGG - Intergenic
1013732182 6:113181395-113181417 ATTCATTCCCTTTTCTTTCTGGG + Intergenic
1014291473 6:119563439-119563461 ATACAATTCATTTTTTTTCATGG + Intergenic
1014995403 6:128136773-128136795 GAAGAATGCATTTTCTTTGTTGG - Intronic
1017529687 6:155276468-155276490 TTACATTCTACTTTCTTTGTAGG - Exonic
1018297166 6:162361089-162361111 AGACAATCCATCTTCTTAGCTGG + Intronic
1018403716 6:163454252-163454274 AAAAGATCCATTTTCTTTATGGG + Intronic
1018560162 6:165093681-165093703 CTTCTTTCCATTTTCTTTGTGGG - Intergenic
1018888361 6:167961693-167961715 ATACAATCCATTCTGTTTTCAGG - Intronic
1023305442 7:38821265-38821287 ATACAATCCATTTTCTTTGTAGG - Exonic
1023345598 7:39268219-39268241 CTACATTCCATTATCTTTGATGG - Intronic
1024516413 7:50262674-50262696 ATATAACCTATTTTTTTTGTGGG - Intergenic
1025286857 7:57669862-57669884 ATGCAATACATTTTTTTTTTTGG - Intergenic
1027553070 7:79623430-79623452 ATAGAATCCATATTTTTTCTTGG - Intergenic
1031609903 7:123813426-123813448 ATACAATCCAGTTTCTTTATAGG + Intergenic
1032147830 7:129400105-129400127 ATCCATTCCTTTGTCTTTGTTGG - Intronic
1034587979 7:152112810-152112832 ATACAATGCATATTCTTTTTTGG - Intronic
1034787564 7:153939031-153939053 ATAAAATGCATTTTTTTTCTGGG + Intronic
1036758807 8:11492453-11492475 AGACCATGTATTTTCTTTGTAGG + Intergenic
1037772088 8:21808153-21808175 AGACATTCCATTTTCTCTGGGGG + Intronic
1038724087 8:30064150-30064172 ATAGAATGCATTCTCTTTTTTGG - Intronic
1039212249 8:35230789-35230811 ATACAATAGATTTTCAATGTAGG - Intergenic
1040678774 8:49784117-49784139 ATACAACCCATGTTCATTTTGGG - Intergenic
1040817400 8:51522918-51522940 ATAAAATACTTTATCTTTGTGGG + Intronic
1043007778 8:74842091-74842113 ATGCAATCCATTATCCTTGAGGG + Intronic
1043294562 8:78646927-78646949 AGAAATTCCATTTTCTCTGTGGG + Intergenic
1043466262 8:80510466-80510488 ATACAATCCATTTTTGTTATAGG + Intronic
1043498790 8:80832622-80832644 AAACAACCCATTTGCTTTCTGGG + Intronic
1043629042 8:82304721-82304743 ATATAATTCATTTTCTTACTTGG - Intergenic
1044732752 8:95244078-95244100 ATGCAATCTTTTTTCTTTTTTGG + Intergenic
1045684425 8:104697267-104697289 ATAAATTACATTTTCTATGTGGG - Intronic
1046655641 8:116891223-116891245 TTACAGTTCATTTTGTTTGTGGG + Intergenic
1046960332 8:120104928-120104950 ATGCAATCAATTTTCTATATAGG + Intronic
1047846222 8:128808295-128808317 ATAAAAGACATTTTCTTTGTCGG + Intergenic
1051001580 9:12289251-12289273 CTACTATTTATTTTCTTTGTAGG - Intergenic
1051227027 9:14910153-14910175 ACACACTCCACTTTCTTTGCTGG + Exonic
1051286871 9:15506573-15506595 AAACTACCCATTTTCTTTTTTGG - Exonic
1051933104 9:22410661-22410683 AGGCATTTCATTTTCTTTGTGGG - Intergenic
1052768881 9:32669247-32669269 ATAGAAAACATTTGCTTTGTAGG + Intergenic
1055157725 9:73084804-73084826 ATACTATATATTTTCTTTATTGG + Intergenic
1055208817 9:73764425-73764447 ATAAAATTCATATTCTGTGTTGG - Intergenic
1055582257 9:77718894-77718916 ATACAATTCATATTCTTATTTGG - Exonic
1055661092 9:78504898-78504920 ATACAATCACTCTTCTTGGTGGG + Intergenic
1055686180 9:78777527-78777549 AAACAATCCATTTTATTTTTAGG - Intergenic
1056517920 9:87372447-87372469 AAACAAAACATTTTCTCTGTGGG - Intergenic
1057940204 9:99275270-99275292 TTAAAATCCAATCTCTTTGTTGG - Intergenic
1060983101 9:127804614-127804636 AGACAATCCCTTTTCTTTCAAGG + Exonic
1185633627 X:1535747-1535769 ACACAAACCCTTTTCTTTTTGGG + Intronic
1187649066 X:21380193-21380215 ATTCAATACACATTCTTTGTGGG - Intronic
1188471243 X:30542155-30542177 ATAAAATCCTTTTTCGTTGCAGG - Intergenic
1189685225 X:43556759-43556781 AGACAATCCACTTTGTTTGGAGG + Intergenic
1193332884 X:80255731-80255753 GTAAAATCCATTTTCTTGGGAGG + Intergenic
1193731848 X:85111836-85111858 ATACAATCCCCTTTTTCTGTAGG + Intergenic
1194374533 X:93115240-93115262 ATACTATACCTTTTCTTTGCGGG + Intergenic
1194479149 X:94398964-94398986 ATACAGTTGATTTTCTTTGGTGG + Intergenic
1194556013 X:95361046-95361068 ATACATTCAATTTTACTTGTAGG - Intergenic
1194737831 X:97535118-97535140 ATACTATCCTTTTTCTGTTTCGG - Intronic
1195114701 X:101685451-101685473 ATAAAATTCTTTATCTTTGTCGG + Intergenic
1195495388 X:105526041-105526063 ATACAATCCATTTCAACTGTGGG - Intronic
1195708679 X:107757119-107757141 ATACAAGCCACTTCCCTTGTTGG - Intronic
1196065599 X:111460842-111460864 ATACAATCATCTTTCTTTCTAGG - Intergenic
1196110404 X:111941015-111941037 ATACAACCCATGTTCATTTTAGG - Intronic
1197051796 X:122067988-122068010 ATACAGTCTGTTTTCTTTTTTGG + Intergenic
1198042042 X:132862871-132862893 ATCCTTTCCATTTTCCTTGTAGG - Intronic
1198283004 X:135161215-135161237 ATACAAACCTTTTCCCTTGTTGG + Intronic
1198285327 X:135184449-135184471 ATACAAACCTTTTTCCTTATTGG + Intergenic
1198287951 X:135211277-135211299 ATACAAACCTTTTTCCTTATTGG - Intergenic
1198864015 X:141101602-141101624 AATCAATACATTTTCTTTGCAGG - Intergenic
1198898674 X:141485813-141485835 AATCAATACATTTTCTTTGCAGG + Intergenic
1200682556 Y:6229294-6229316 ATACTATACCTTTTCTTTGCGGG + Intergenic