ID: 1023308112

View in Genome Browser
Species Human (GRCh38)
Location 7:38852849-38852871
Sequence CCAGAAGGATGATGGTAAAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 158}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023308112 Original CRISPR CCAGAAGGATGATGGTAAAT CGG (reversed) Intronic
900843297 1:5074796-5074818 CCAGAAGGTTGAAAGAAAATTGG - Intergenic
901115492 1:6840594-6840616 CCAGAGTGATGATGTTGAATAGG + Intronic
901826137 1:11862776-11862798 CAAGAAGGAAGATGGAAGATGGG + Intergenic
902192006 1:14770327-14770349 CAAGAAGGAGGATGGTAGCTTGG + Intronic
903684442 1:25120510-25120532 GCAGAAGGAGGAGGGGAAATTGG - Intergenic
903852737 1:26318038-26318060 CCAGGAGGCTGATGGTGAGTAGG - Exonic
905243738 1:36597892-36597914 CCAGTAGTGTGCTGGTAAATCGG - Intergenic
905958065 1:42015851-42015873 GCTGAAGGATGATGGAGAATTGG - Intronic
906134539 1:43487606-43487628 CCAGAAGGAGGAGGGTGAAATGG + Intergenic
909408438 1:75319642-75319664 CCAGAATGATGATAGTAGAAAGG - Intronic
909572070 1:77125540-77125562 CAAGAAGTGTGATGCTAAATTGG + Intronic
913532450 1:119742656-119742678 CCAGAAGGGAGAGGGCAAATGGG - Intronic
913737766 1:121805034-121805056 CCAAAAGGTTGTTGGAAAATGGG + Intergenic
914832228 1:151178787-151178809 CCAGAGGGATGGTGGTGAACTGG - Intronic
915816292 1:158969629-158969651 CCTGAAGTAAGATGGCAAATAGG - Intronic
918546660 1:185692151-185692173 ACAGGAGCATGATGGTACATTGG - Intergenic
920296665 1:204961600-204961622 GCAGGAGGTTGGTGGTAAATGGG - Intronic
921294097 1:213685891-213685913 AGAGCAGGTTGATGGTAAATTGG + Intergenic
922496463 1:226062124-226062146 CCAGCAGGAAGCTGGCAAATAGG - Intronic
923657480 1:235930688-235930710 CCAAAGGGAGGAGGGTAAATGGG + Intergenic
924379120 1:243445521-243445543 CCAGAAGTTGGATGGTTAATTGG + Intronic
1064727123 10:18291549-18291571 CCAGAAGGAAGATGGGCTATGGG + Intronic
1065277590 10:24100519-24100541 CCACAAGGTTGACTGTAAATAGG + Intronic
1072289810 10:93953441-93953463 CCAGAAGGATTATAGAAATTTGG - Intronic
1074274760 10:111990670-111990692 CCAGAAGGATTAATGTCAATAGG - Intergenic
1074473809 10:113751371-113751393 ACAGACGGTTGAGGGTAAATTGG + Intergenic
1075624825 10:123954854-123954876 CCAGAAAGATGAGAGAAAATTGG + Intergenic
1080526178 11:33122050-33122072 GCAGTAGGATGATGGGATATGGG - Intronic
1090259762 11:125310814-125310836 CCAGAAAGATGATTTTAAAAGGG - Intronic
1090606641 11:128428808-128428830 CCTGGAGAATGATGGGAAATGGG + Intergenic
1091950313 12:4587341-4587363 CCAGGAGGATGGTGGTAGAGGGG - Intronic
1093829103 12:23733838-23733860 CCAGATGGATGATGTCACATGGG + Intronic
1098594343 12:72254682-72254704 CCAGTAGGAAGATGGTTAAGTGG - Intronic
1098934334 12:76461053-76461075 CCAGAAGAATGAGATTAAATGGG - Intronic
1101647782 12:106647095-106647117 CCAGAAGGAAGATGGGAGCTAGG - Intronic
1101934290 12:109044864-109044886 ACATAATGATGATGGTATATGGG - Intronic
1103782521 12:123408684-123408706 CCAGCAGGATGAGGGGGAATGGG - Exonic
1103798754 12:123523486-123523508 CCAGAAGCATGAAGGTAAGTGGG - Exonic
1104744888 12:131204431-131204453 CCAGTGGGATGGTGGGAAATGGG - Intergenic
1105217798 13:18299706-18299728 CCAGCAGGATGAGGGGGAATGGG - Intergenic
1106456154 13:29929179-29929201 CCAGAAGCACAATGGGAAATGGG + Intergenic
1114648315 14:24267932-24267954 TCAGCAGGATGATGGTAAGCAGG + Exonic
1114922146 14:27344977-27344999 CCATAAGGATGATGGAATGTTGG - Intergenic
1118003076 14:61541442-61541464 CCAGAGCGATGATCCTAAATGGG - Intronic
1120625168 14:86816701-86816723 CCTGAAGAAGGATGATAAATGGG - Intergenic
1120750749 14:88195733-88195755 TCGGAAGGATGATGAAAAATGGG - Intronic
1121164765 14:91782428-91782450 CCAGAAGGTTGAAGTTTAATTGG - Exonic
1121224353 14:92310357-92310379 CCAGATGGTTGATGCAAAATGGG - Intergenic
1121665111 14:95666233-95666255 CCAGGAGGATGCAGGGAAATGGG + Intergenic
1124465661 15:29936951-29936973 CCATAGGTATGATGGGAAATTGG - Intronic
1128583823 15:68829833-68829855 CCAGAAGGATAAAGGTAGTTTGG - Intronic
1128759606 15:70207110-70207132 CCAGAAGGAGAATGGGAATTTGG - Intergenic
1129560940 15:76567688-76567710 CCAGTAGGATAATGGTCAAGAGG - Intronic
1131815510 15:96217407-96217429 CCAGAGGGTTGATGGAAAATGGG - Intergenic
1133535811 16:6701356-6701378 TCAGTAAGATGATGGTAAACAGG - Intronic
1133750732 16:8723291-8723313 GGAGAAGGATGATGGCAAGTTGG + Intronic
1134197546 16:12170532-12170554 GCAGAAGGAGGAGGGTAGATGGG + Intronic
1139266168 16:65640420-65640442 AAAGAAGGTTGATGGTAAAGGGG - Intergenic
1139706448 16:68744182-68744204 CCTTAAGGTTGATTGTAAATGGG + Intronic
1143337121 17:6179676-6179698 CCAGAAAGAGGATGGCACATGGG + Intergenic
1143525380 17:7468866-7468888 GAAGAAGGAAGATGGTAAACAGG + Intronic
1143589491 17:7873387-7873409 CCAGGAGGTTGTTGGTAATTTGG + Intronic
1147258566 17:39196176-39196198 CAAGAAAGAGGATGGAAAATGGG + Intronic
1147520130 17:41163264-41163286 CTAGAAGGATAAAGATAAATTGG + Intergenic
1155734907 18:29209633-29209655 CCAGAAGGATCAGAGAAAATTGG - Intergenic
1155884489 18:31190821-31190843 CTAGAAGGATGAGAATAAATAGG + Intergenic
1156435882 18:37128868-37128890 TCAGAAGCATTATGCTAAATGGG + Intronic
1159152842 18:64542436-64542458 CATTAAGGATGATGTTAAATGGG + Intergenic
1159475580 18:68916816-68916838 TCAGAAGGATGAAAGGAAATCGG + Intronic
1159507597 18:69357025-69357047 GCATAAGGATGCTGGTAACTGGG - Intergenic
1160368672 18:78351911-78351933 CAAGAATCATGAGGGTAAATGGG + Intergenic
925072357 2:980123-980145 CTATAAGGAGGATGGTAATTTGG - Intronic
925507101 2:4579346-4579368 CAACAAGGATGAAGATAAATTGG - Intergenic
926092764 2:10061330-10061352 CCAGGAGGATGGTGGGAAACAGG - Intronic
926644942 2:15280354-15280376 CAAGAAGGAAGAAGGTGAATGGG + Intronic
926850197 2:17188209-17188231 CCCAAATGTTGATGGTAAATGGG + Intergenic
928422499 2:31149596-31149618 TCAGAACGATGAAGGTAAAGAGG + Intronic
929706674 2:44220057-44220079 CTAAAAGGATGGTGGTAATTTGG + Intronic
931125718 2:59274238-59274260 CCAGCAGAATGATGGGAAGTAGG - Intergenic
931976477 2:67649392-67649414 CCAGAAGGAAGATCGCAGATAGG + Intergenic
933074826 2:77909962-77909984 CAAGAAGTATGATGTTAAATTGG - Intergenic
933875670 2:86619169-86619191 CTAGCAGTATGATTGTAAATAGG - Intronic
934962415 2:98688352-98688374 CCAGAAGGACGAGGGTCACTGGG - Intronic
935836164 2:107056668-107056690 CCAGGAGGAAGATTTTAAATAGG + Intergenic
937708733 2:124952587-124952609 CCAGAAGGATGCTGGCATTTTGG + Intergenic
940637258 2:156313336-156313358 CCAGAACGATGTTGACAAATTGG - Intergenic
941294639 2:163721140-163721162 CCAGAAGGGTAAAGGAAAATGGG + Intronic
942755933 2:179341701-179341723 CCAGAAAGTTGACAGTAAATTGG - Intergenic
943203640 2:184861440-184861462 TCAGCAAGATGATGGAAAATAGG - Intronic
943214861 2:185018138-185018160 GCAGAATAATCATGGTAAATAGG - Intergenic
944851497 2:203724234-203724256 GAAGCAGGGTGATGGTAAATGGG + Intronic
946310777 2:218881322-218881344 CCAGGAGCATGATGGCAACTAGG + Intronic
947479347 2:230483645-230483667 TCGGAAGGGTGATGGTGAATTGG + Intronic
1170489492 20:16858137-16858159 CCAGAAGGAAAATGGGATATAGG + Intergenic
1171062143 20:21975770-21975792 GAAGAATGATGATGGTAGATGGG + Intergenic
1171357404 20:24559309-24559331 CAGGGAGGATGATGATAAATTGG + Intronic
1178699305 21:34819847-34819869 CCAGAAGCAGGATGGCAAACAGG - Intronic
1179415920 21:41198789-41198811 CTAGAAGGGTGATGGTTATTCGG - Intronic
1182070208 22:27458237-27458259 CCAGTGGGATGATGGTGAATGGG - Intergenic
950324820 3:12096937-12096959 CCAGAAGGAGAAAGGAAAATAGG + Intronic
950633484 3:14299288-14299310 TGAGAAGGATGATGGGAATTGGG + Intergenic
951922478 3:27871656-27871678 CAAGAAGGATGATGGAGAACTGG + Intergenic
956193361 3:66628297-66628319 CCAGAAGGATGATGTTATAATGG + Intergenic
959897620 3:111622234-111622256 CCAGAAAGACCAAGGTAAATGGG + Intronic
960739132 3:120813671-120813693 CCAGAAGGATGATGAAAAGAAGG + Intergenic
966001500 3:174954093-174954115 CCAGAAGGAATATTGCAAATAGG - Intronic
966747029 3:183286906-183286928 ACAGAAGGATGATTGTAACATGG + Intronic
970082595 4:12304582-12304604 GAAGATGGATGGTGGTAAATTGG + Intergenic
970478389 4:16448853-16448875 TCAGAACGATGAAGGGAAATGGG - Intergenic
971092659 4:23362853-23362875 CCAGAAGGATGATGATATTCAGG - Intergenic
971300937 4:25441998-25442020 CCACAATGATGATGGCATATCGG - Intergenic
971676430 4:29635362-29635384 CCAGAAGGATGAGGGTAGGGTGG + Intergenic
972364318 4:38360069-38360091 CCAGAAGGATCATTGAAATTGGG + Intergenic
977228904 4:94428133-94428155 CCAGAAGAATGCAGGAAAATAGG + Intergenic
980045558 4:127984350-127984372 TCAGAAAGATGATTGGAAATCGG + Exonic
980113496 4:128657441-128657463 CAAGAAGGATGGTGGTGACTAGG - Intergenic
981653434 4:147085087-147085109 CCAGAAGTATGCTTGGAAATCGG - Intergenic
983539564 4:168894722-168894744 CCATAAGGAAGATGGAAAAGGGG - Intronic
983610732 4:169642228-169642250 CAAGAAGTATACTGGTAAATCGG - Intronic
985096377 4:186416758-186416780 ACAGCAGGAGGATGGGAAATGGG + Intergenic
986653547 5:9988721-9988743 CCATATGGATGCTGGAAAATTGG + Intergenic
991917254 5:71617216-71617238 CCAGGAGGATGAGGGGAAAGAGG - Intronic
995469690 5:112488018-112488040 CCAGAGGGATGTTGGTAATGGGG - Intergenic
995648436 5:114339895-114339917 ACAGAAGGATGGTGCTGAATTGG + Intergenic
996492298 5:124111935-124111957 CCAGAAGGAAGAAGGAAAAAAGG - Intergenic
998823389 5:146077045-146077067 CTAAAAGGATGATGGGAAATTGG - Intronic
1000803693 5:165760881-165760903 TCCAAAGGAAGATGGTAAATAGG + Intergenic
1001837323 5:174843370-174843392 CCAGAAGGCAGATGGCAAACAGG - Intergenic
1004042556 6:11994983-11995005 CCCCAAGGATGATGGTGAAAGGG + Intergenic
1004986978 6:21093470-21093492 TCTCCAGGATGATGGTAAATGGG + Intronic
1005899902 6:30208220-30208242 CCAGCAAGATGGTAGTAAATTGG + Intronic
1006142328 6:31937431-31937453 TCAGAAGGATGATGGCATGTCGG - Exonic
1007247160 6:40471000-40471022 TGAGAAGGATGTTGGTACATCGG + Intronic
1008274334 6:49526023-49526045 CCGGAAAGGTGTTGGTAAATCGG + Intronic
1008535258 6:52502519-52502541 CCAGAAGGATGGTGTGAACTCGG - Exonic
1008651537 6:53568812-53568834 TCAGAAATAAGATGGTAAATGGG - Intronic
1009187891 6:60595698-60595720 ACAGAAGGCTGAGCGTAAATTGG - Intergenic
1010831924 6:80541512-80541534 CAAGAAGGAAGATGGTGAGTGGG - Intergenic
1012527010 6:100189984-100190006 CCATAAGTATGATGGAAGATTGG - Intergenic
1013084441 6:106844049-106844071 CCAGGACAATGATGCTAAATTGG - Intergenic
1015194900 6:130515068-130515090 CAGGAAGGATGATGGAAAAGAGG + Intergenic
1022678574 7:32523204-32523226 CCAGAAGGATGATAGAAATTTGG + Intronic
1023308112 7:38852849-38852871 CCAGAAGGATGATGGTAAATCGG - Intronic
1023514345 7:40985802-40985824 ACAGAAGGATTAGGGCAAATAGG + Intergenic
1028640624 7:93038842-93038864 CCATAATGATGATAGTAAATTGG + Intergenic
1030045136 7:105488343-105488365 CCAGAATAAAGGTGGTAAATTGG + Intronic
1030647691 7:112081773-112081795 CAAAAAGAAAGATGGTAAATTGG + Intronic
1036059149 8:5295524-5295546 CCACAAAGATGATGGTCATTAGG + Intergenic
1040606366 8:48936098-48936120 CCACAAAAATAATGGTAAATAGG - Intergenic
1041967089 8:63691100-63691122 CAAGAAGGATGGTGGTGAATAGG + Intergenic
1043436936 8:80244247-80244269 CCAGAAAGATGATTTTAAAAAGG + Intergenic
1043863077 8:85343874-85343896 AAAGAAGGATAAAGGTAAATGGG - Intronic
1045324539 8:101108625-101108647 CCAGAAAGATCATTTTAAATAGG - Intergenic
1047117481 8:121860556-121860578 CTAGAAGGATGATGATAAAGTGG - Intergenic
1050415070 9:5408210-5408232 ACAGAAGGATGACGGAAAGTTGG + Intronic
1052527505 9:29637327-29637349 CCAAAAGCATGATCGTAAAGAGG + Intergenic
1057904677 9:98974666-98974688 CCAGTAGGATGAGGGTATGTAGG - Intronic
1059857544 9:118416596-118416618 CCATAAGGATGATGGCAGAAGGG + Intergenic
1060077486 9:120605444-120605466 TCAAAATGATGATGTTAAATTGG + Exonic
1186433629 X:9525056-9525078 CCAGAGGGATGATGGTTCCTTGG + Intronic
1188857179 X:35210495-35210517 CCAGAATGCTGATGGTAATATGG - Intergenic
1191694351 X:63974166-63974188 GCAGAATGAGGATGGTTAATGGG + Intergenic
1196035214 X:111136497-111136519 CCAGAAGGAAGCTGAGAAATTGG + Intronic
1196376043 X:115033734-115033756 TAAGAAGGATGATGATAAACAGG - Intergenic
1196851865 X:119945642-119945664 GCAGAAGGATGAAGAGAAATAGG - Intergenic
1198517087 X:137420527-137420549 CCAGATGGATGGTGGTACCTAGG - Intergenic
1198661755 X:138976541-138976563 TCAGAAGGGGGATGGTAAAAGGG + Intronic
1201356880 Y:13106476-13106498 TGAAAAGGATGATGATAAATTGG + Intergenic
1201889088 Y:18921801-18921823 CCAGAATGATGACTTTAAATGGG - Intergenic