ID: 1023311864

View in Genome Browser
Species Human (GRCh38)
Location 7:38895741-38895763
Sequence GCTTTTGGCAGAGATGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 599
Summary {0: 1, 1: 0, 2: 6, 3: 50, 4: 542}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023311864 Original CRISPR GCTTTTGGCAGAGATGGGGG AGG (reversed) Intronic
900255166 1:1694111-1694133 ATTTTTAGTAGAGATGGGGGGGG - Intronic
900593838 1:3471573-3471595 GCTGGGGGCAGAGCTGGGGGAGG - Intronic
900624762 1:3603143-3603165 GAGTTTGGCAGGGATGGGGCTGG - Intronic
901503187 1:9666668-9666690 GAATTTTGTAGAGATGGGGGAGG - Intronic
902205501 1:14865463-14865485 GCAGATGGCAGACATGGGGGAGG - Intronic
902393707 1:16120696-16120718 GGTTGGGGCAGGGATGGGGGAGG - Intergenic
902728749 1:18354620-18354642 GCTTGGGGGAGGGATGGGGGAGG - Intronic
903041304 1:20532802-20532824 ATTTTTAGTAGAGATGGGGGGGG - Intergenic
903125917 1:21247516-21247538 GCTTTTGTCAGAGATGCTGTAGG + Intronic
903168488 1:21537688-21537710 GCATGTGACTGAGATGGGGGTGG + Intronic
903220382 1:21865922-21865944 GGTTTGGGCAGGGAGGGGGGTGG - Intronic
903978168 1:27165556-27165578 GCATTTGGCAGTGCTGGGAGTGG - Intronic
904036821 1:27563546-27563568 GCTGGTGACAGTGATGGGGGAGG - Intronic
904200791 1:28817879-28817901 GTTTTTAGTAGAGATGGGCGGGG + Intronic
904267477 1:29326010-29326032 GCTTTTGGCAGGGATGAGTGAGG + Intronic
904326117 1:29727911-29727933 GCTGTAGGGAGAGATGGGTGAGG + Intergenic
905312892 1:37062726-37062748 GCTTTGGGGAGAGATGAGAGTGG - Intergenic
905998258 1:42401033-42401055 GATTTTTCCACAGATGGGGGTGG + Intronic
906890877 1:49712426-49712448 GCAGTTACCAGAGATGGGGGTGG + Intronic
907125687 1:52048678-52048700 ATTTTTGGTAGAGATGGGGTTGG - Intronic
907539650 1:55201886-55201908 GCAGTTGGCAGAGATAGGGTAGG - Intronic
908292947 1:62686946-62686968 TTTTTTTGCAGAGATGGGGTGGG + Intronic
908495704 1:64692362-64692384 GTGTTTGACAGAGATGGGGAGGG + Exonic
909643497 1:77891904-77891926 ATTTTTTGTAGAGATGGGGGTGG - Intronic
911426375 1:97719149-97719171 TTTTTTGGCAGGGTTGGGGGTGG - Intronic
911852443 1:102836424-102836446 GCTTGTGGCAGGGTGGGGGGAGG + Intergenic
912399537 1:109378058-109378080 ACTTTTTGTAGCGATGGGGGCGG - Intronic
912855597 1:113166290-113166312 GCCTATGCCAGGGATGGGGGAGG - Intergenic
915423729 1:155806458-155806480 ATTTTTTGTAGAGATGGGGGTGG + Intronic
918371652 1:183867324-183867346 GCTTTGGGGAAGGATGGGGGAGG + Intronic
919418426 1:197340742-197340764 AGTTTTGGCAGGGATGGGGGTGG + Intronic
920747559 1:208643412-208643434 GCTCTGAGGAGAGATGGGGGAGG + Intergenic
921316247 1:213894128-213894150 GTTTTTGGCAGGGTTGAGGGGGG - Intergenic
921869854 1:220128228-220128250 GATTTTGGTACATATGGGGGTGG + Intronic
922228667 1:223667152-223667174 TTTTTTGGGAGGGATGGGGGTGG - Intergenic
922293188 1:224225964-224225986 TCTTTTTGTAGAGATGTGGGGGG + Intergenic
922505796 1:226124816-226124838 CCTTTAGGGAGGGATGGGGGTGG - Intergenic
922561573 1:226573317-226573339 GCTTTTGTAACAGATGGTGGCGG + Intronic
922578602 1:226680358-226680380 CCTTTTGGCAGAGAGGGGGGAGG + Intronic
922932670 1:229402609-229402631 ATTTTTTGTAGAGATGGGGGGGG + Intergenic
923721846 1:236473605-236473627 TTTTTTGGTAGAAATGGGGGAGG - Intronic
923883655 1:238131252-238131274 TTTTTTTGTAGAGATGGGGGGGG + Intergenic
924240351 1:242034068-242034090 TGTTTTTGTAGAGATGGGGGGGG - Intergenic
924575683 1:245278772-245278794 GCGTGTGGCAGAGCTGGGGCTGG - Intronic
1062875727 10:941488-941510 ATTTTTGGTAGAGATGGGCGGGG + Intergenic
1063632588 10:7748030-7748052 ATTTTTAGTAGAGATGGGGGGGG - Intronic
1063646222 10:7886098-7886120 GTTTTTTGTAGAGATGTGGGGGG + Intronic
1065091511 10:22239210-22239232 GTTTTTAGTAGAGATGGGGTTGG + Intergenic
1065780466 10:29162062-29162084 GCGCCTGGCAGAGAAGGGGGAGG - Intergenic
1065850796 10:29785835-29785857 TCTTGTGGCAGAGAAAGGGGAGG - Intergenic
1066501002 10:35994633-35994655 TTTTTTGGTAGAGATGGGGTGGG + Intergenic
1067719991 10:48721101-48721123 GCGTTTGGTAGAGATGCAGGTGG + Intronic
1068346149 10:55781181-55781203 GCTTTTGGCAAAAATTGTGGTGG + Intergenic
1068410319 10:56646103-56646125 GCTTTTGTCGGGGGTGGGGGTGG + Intergenic
1069441691 10:68434473-68434495 ATTTTTTGTAGAGATGGGGGGGG - Intronic
1069608787 10:69758304-69758326 GCTTGTGGGAGAGCAGGGGGAGG + Intergenic
1069686438 10:70322112-70322134 GCTTTTGCCAGATAAGGGAGCGG - Intronic
1070012393 10:72489110-72489132 TCTTTTAGTAGAGATGGGGTTGG - Intronic
1070764140 10:79046970-79046992 GCTTTTGTCAGAGGAGGAGGTGG + Intergenic
1071974150 10:90938265-90938287 CCTTGTGGGAGAGATGGGGTAGG - Intergenic
1072750614 10:97975769-97975791 GCTCTTGGCACAGAGGGCGGAGG - Intronic
1073249997 10:102115277-102115299 GCCACTGGCAGAGATGGAGGAGG + Intronic
1073768266 10:106707365-106707387 TCTTTTAGTAGAGATGGTGGGGG + Intronic
1074284029 10:112081010-112081032 GTTTTTTGTAGAGACGGGGGTGG - Intergenic
1074562088 10:114543895-114543917 GCATTTGGGAGAGAAGGGTGTGG - Intronic
1075093752 10:119457862-119457884 ATTTTTTGTAGAGATGGGGGGGG + Intronic
1075290409 10:121225162-121225184 TTTTTTTGTAGAGATGGGGGGGG + Intergenic
1075711514 10:124533335-124533357 ACTTTGTGCAGAGTTGGGGGCGG + Intronic
1075946383 10:126436834-126436856 GTTTTTTGTAGAGATGGGGGTGG + Intronic
1076006383 10:126950935-126950957 GCTGTTGGCGGTGATGGTGGTGG + Intronic
1076285055 10:129287187-129287209 GACTTGGGCAGGGATGGGGGTGG + Intergenic
1077015066 11:395717-395739 GCTCTGGGCAGAGTTGTGGGAGG + Intronic
1077030776 11:465756-465778 ATTTTTAGTAGAGATGGGGGGGG - Intronic
1077112154 11:866639-866661 CCTTTTGGCAGAGAAGCGGGCGG - Exonic
1077342213 11:2031175-2031197 GCTCTTGGCAGATAGGTGGGCGG + Intergenic
1078149132 11:8743917-8743939 TTTTTTTGTAGAGATGGGGGCGG + Intronic
1078778084 11:14411901-14411923 AAATTTGGCAGGGATGGGGGTGG - Intergenic
1079324283 11:19478195-19478217 CCTTTTGGCAGGCATGGTGGAGG + Intronic
1080892836 11:36424444-36424466 GCTTAGGGCATTGATGGGGGAGG + Intronic
1081848635 11:46259695-46259717 ATTTTTAGTAGAGATGGGGGAGG - Intergenic
1081952733 11:47059350-47059372 TTTTTTGGCAGAGAGGGGGTGGG - Intronic
1082770094 11:57201195-57201217 GAGTTAGGCAGAGATGAGGGTGG - Intergenic
1083033428 11:59615247-59615269 ACTGTTGGCAGATATGGGGGAGG + Intronic
1083160364 11:60850525-60850547 GGACCTGGCAGAGATGGGGGCGG + Exonic
1083237161 11:61358547-61358569 ATTTTTAGTAGAGATGGGGGCGG - Intronic
1083779247 11:64909617-64909639 GCTTCTGGGAGAGATGGGCTTGG - Intronic
1084289025 11:68149973-68149995 ATTTTTAGTAGAGATGGGGGTGG - Intergenic
1084302069 11:68258498-68258520 GCTTTCGGCAGGGACGGGTGTGG + Intergenic
1084787282 11:71449746-71449768 TTTTTTGGTAGAGATGGGTGGGG + Intronic
1085017970 11:73187812-73187834 GTTTTTTGTAGAGATGGGGTGGG + Intergenic
1085120460 11:73964324-73964346 GCTGTCAGCTGAGATGGGGGAGG - Intronic
1085896465 11:80645610-80645632 GCTTTCAACAGAGATGGGTGGGG - Intergenic
1087847416 11:102989344-102989366 TCTTTAGCCAGGGATGGGGGAGG - Intergenic
1091027669 11:132156444-132156466 GCTCCTGGCAGAGGTGGGAGTGG - Intronic
1202825199 11_KI270721v1_random:86364-86386 GCTCTTGGCAGATAGGTGGGCGG + Intergenic
1091751384 12:3023205-3023227 TCTATTGGCAGAGATGGGAAAGG + Intronic
1091823341 12:3492078-3492100 GCTTTGTGCAGAGCTGGGGTGGG + Intronic
1091994663 12:4983755-4983777 GTGCTTGGGAGAGATGGGGGAGG + Intergenic
1091999580 12:5021239-5021261 GCTTTGGGCAGACAGAGGGGAGG - Intergenic
1092504757 12:9086087-9086109 GCTTTTGGCAGAGTTTGAGAAGG - Intronic
1092861707 12:12724801-12724823 CCTTTTGGCTGAGAGGGGGTGGG - Intergenic
1092988549 12:13871994-13872016 TATTTTGGCAGAGGTGGGGTGGG - Intronic
1093470453 12:19495714-19495736 ATTTTTGGAAGAGATGGTGGGGG + Intronic
1093949404 12:25147477-25147499 ATTTTTTGTAGAGATGGGGGTGG - Intronic
1094012247 12:25821570-25821592 CCTTTTGTCAGAGTTGGGAGGGG - Intergenic
1095463795 12:42469401-42469423 GCTTGTGGCAGTGATGTGGATGG - Intronic
1096537890 12:52287048-52287070 GCTTGTGCCAGGGATGGGGAAGG + Intronic
1096593668 12:52679966-52679988 GGTTTTGGCAGTGGTGGTGGTGG - Exonic
1101759421 12:107646600-107646622 GCTTGTCGCAGAGATGGTGGTGG - Intronic
1102182131 12:110920643-110920665 GCTTTTGGCAGTCATAGGTGAGG + Intronic
1102539056 12:113605326-113605348 TCTTTTTGCAGAGATGGGGCGGG + Intergenic
1102837526 12:116079391-116079413 ACCTTTTGCAGAGATGGGGGAGG + Intronic
1102863389 12:116355567-116355589 GCTGTGAGCAGTGATGGGGGAGG - Intergenic
1103172661 12:118834961-118834983 TTTTTTTGTAGAGATGGGGGGGG - Intergenic
1104009888 12:124922713-124922735 ATTTTTAGTAGAGATGGGGGGGG + Intergenic
1104017611 12:124971238-124971260 GCCTCTGACAGAGCTGGGGGGGG + Intronic
1104207376 12:126652501-126652523 GCTATAGGGAGAGATGGTGGTGG + Intergenic
1104846645 12:131850396-131850418 GCGTTTGGCAGGGCTGGGGCCGG - Intronic
1105236231 13:18555902-18555924 TCTTGAGGCAGAGATTGGGGGGG - Intergenic
1105449009 13:20482032-20482054 TCTTTTGGTAGAGATGGGTGTGG - Intronic
1106156065 13:27157757-27157779 GCTTTTGGGAGTGGTGGGGAGGG - Intronic
1106168417 13:27269327-27269349 GCTGTTGGCTGTGATGAGGGAGG - Intergenic
1108037081 13:46301954-46301976 TTTTTTGGTAGAGATGGGGTTGG + Intergenic
1108263784 13:48684098-48684120 ACTTTTTGTAGAGATCGGGGGGG + Intronic
1109124175 13:58499089-58499111 GTTTTTGACTGAGATGGGAGAGG + Intergenic
1110236150 13:73220102-73220124 TTTTTTGGTAGAGATGGCGGGGG + Intergenic
1111777237 13:92679896-92679918 GCTCTTGAAAGAGAAGGGGGTGG - Intronic
1111843552 13:93479610-93479632 ATTTTTAGTAGAGATGGGGGGGG - Intronic
1112385317 13:98934071-98934093 AATTTTTGGAGAGATGGGGGCGG + Intronic
1114178196 14:20342902-20342924 TTTTTTAGTAGAGATGGGGGGGG + Intergenic
1116372445 14:44153456-44153478 GCTATTTGCACAGATGGTGGAGG - Intergenic
1117353266 14:54901617-54901639 GCTTTTTGCGGGGTTGGGGGTGG + Intronic
1118398595 14:65358620-65358642 GGTTTTGGTAGAGATGGATGGGG + Intergenic
1119263327 14:73250885-73250907 CCTGTGGGCAGAGATGCGGGAGG - Exonic
1119380020 14:74222517-74222539 GGTTCTGCCAGGGATGGGGGAGG - Intergenic
1119527554 14:75334193-75334215 GCACTTGGCTGAGATGGGAGTGG - Intergenic
1120464571 14:84840179-84840201 TCTTTGGGCAGAGATGGAGGAGG - Intergenic
1120488523 14:85146627-85146649 GCTTTTGGTAGTGATGGGGAGGG + Intergenic
1120898957 14:89559201-89559223 ATTTTTTGCAGAGATGGGGTTGG - Intronic
1121013997 14:90537359-90537381 TTTTTTTGTAGAGATGGGGGGGG + Exonic
1121123628 14:91392278-91392300 TGTTTTGGCAGGGTTGGGGGTGG - Intronic
1121613221 14:95295063-95295085 GCTGTTTACAGAGATGGGGCAGG - Intronic
1121712846 14:96052304-96052326 GCTGGTGCCAGAGGTGGGGGTGG + Intronic
1122007431 14:98717003-98717025 GCACTTGGCAGAGAGGGAGGCGG + Intronic
1122087805 14:99319341-99319363 ACTTTTTGCAGAGGTGGGAGCGG - Intergenic
1122137623 14:99644142-99644164 GCTCCTGGCAGAGCTGGGGGTGG - Intergenic
1122302141 14:100737178-100737200 GCGGTTGTCAGAGATTGGGGTGG - Exonic
1122930966 14:104932948-104932970 GCGTTTGGCAGGGCTGAGGGGGG + Exonic
1124401427 15:29351819-29351841 TTTTTTGGTAGAGATGGGGTAGG + Intronic
1125440696 15:39700213-39700235 TCATTTGGTATAGATGGGGGTGG - Intronic
1125555556 15:40581842-40581864 GCTTTTGGAGGGGGTGGGGGTGG + Intergenic
1125749465 15:42018900-42018922 ACTTTTGGCAGGGGTGAGGGTGG + Intronic
1126160875 15:45612278-45612300 TTTTTTGGCAGAGATGGGGGGGG - Intronic
1126195789 15:45929259-45929281 ACTTCTGACAAAGATGGGGGCGG + Intergenic
1126588567 15:50315900-50315922 TTTTTTAGCAGAGATGGGCGGGG - Intronic
1127386459 15:58471314-58471336 ATTTTTAGTAGAGATGGGGGGGG + Intronic
1128936984 15:71755102-71755124 GTTTTAGGCAGAAATGGGGAAGG + Intronic
1130655428 15:85789203-85789225 CCTCCTGGCAGAGATGGGTGGGG + Intronic
1132627610 16:899184-899206 GTTTTTGGCAGAGCTGGGGCAGG - Intronic
1132818544 16:1848463-1848485 GCTTATGCCAGACATGCGGGAGG - Intronic
1133126203 16:3647831-3647853 TTTTTTGGTAGAGATGGGGTGGG - Intronic
1133879585 16:9768224-9768246 GTTTTTAGTAGAGAAGGGGGGGG + Intronic
1134133666 16:11666351-11666373 GATTTGGGCAGATGTGGGGGCGG + Intergenic
1134286638 16:12867687-12867709 ATTTTTTGCAGAGATGGGGGGGG + Intergenic
1134570225 16:15284367-15284389 GCATTGGGCAGAGAGGGGAGTGG + Intergenic
1134732150 16:16471686-16471708 GCATTGGGCAGAGAGGGGAGTGG - Intergenic
1134819208 16:17232580-17232602 GGTGTTGGCAGTGATGGTGGTGG + Intronic
1134935287 16:18240277-18240299 GCATTGGGCAGAGAGGGGAGTGG + Intergenic
1135132153 16:19861961-19861983 GCTGTTCGGAGAGCTGGGGGAGG + Exonic
1135135304 16:19882810-19882832 GCTGTAGGCAGATTTGGGGGTGG - Intronic
1135260984 16:20980548-20980570 ACTTTTAGTAGAGATGGTGGGGG + Intronic
1135355030 16:21761946-21761968 GTTTTTGGTGGAGATGGTGGTGG + Intergenic
1135453514 16:22578088-22578110 GTTTTTGGTGGAGATGGTGGTGG + Intergenic
1135530520 16:23249113-23249135 TTTTTTGATAGAGATGGGGGTGG - Intergenic
1135793682 16:25421886-25421908 GCTTTTGGTGGTGATGGTGGTGG - Intergenic
1136138718 16:28275152-28275174 ATTTTTTGTAGAGATGGGGGAGG - Intergenic
1136159650 16:28410773-28410795 GTTTTTTGTAGAGACGGGGGGGG + Intergenic
1136203438 16:28704521-28704543 GTTTTTTGTAGAGACGGGGGGGG - Intronic
1136580629 16:31149032-31149054 GCTTTTGGCGGAGAGGGGCCAGG + Intronic
1136673848 16:31881306-31881328 GATTTGGGCAGAGCTGGGGCAGG - Intronic
1137032660 16:35538439-35538461 ATTTTTAGTAGAGATGGGGGTGG - Intergenic
1138248875 16:55487499-55487521 TCTTTTGGTAGAGAGGGGAGTGG + Intronic
1138434015 16:56986996-56987018 ATTTTTAGTAGAGATGGGGGGGG - Intergenic
1138446746 16:57069422-57069444 ATTTTTTGTAGAGATGGGGGTGG - Intronic
1138488846 16:57364353-57364375 CCTTTTGGCAGGGAGAGGGGAGG - Exonic
1138526637 16:57612067-57612089 TTTTTTGGTAGAGATTGGGGTGG + Intronic
1139056461 16:63191203-63191225 GCTTTTGGAAGAGATATGGTTGG + Intergenic
1139215323 16:65121385-65121407 GCTTTCGGCAGGGATCCGGGAGG + Intronic
1139349190 16:66324803-66324825 GCTTTAGGAAGAGGTGGAGGTGG + Intergenic
1139427498 16:66891855-66891877 TATTTTTGTAGAGATGGGGGGGG - Intronic
1140307421 16:73816615-73816637 GATTTTAAAAGAGATGGGGGGGG + Intergenic
1140774708 16:78239276-78239298 GATGCTGGCAGAGATGGGGAAGG + Intronic
1142178763 16:88657116-88657138 ATTTTTTGTAGAGATGGGGGGGG + Intronic
1142508673 17:381163-381185 GCTTCTGGGAGGGATGTGGGGGG - Intronic
1142508746 17:381343-381365 GCTTCTGGGAGGGATGTGGGGGG - Intronic
1142636279 17:1259764-1259786 TATTTTTGTAGAGATGGGGGTGG - Intergenic
1143122202 17:4615496-4615518 ACTTTTTATAGAGATGGGGGGGG - Intergenic
1143188869 17:5026916-5026938 ATTTTTTGTAGAGATGGGGGGGG - Exonic
1143252587 17:5534191-5534213 ATTTTTGGCAGAGATGAGGTGGG - Intronic
1143602208 17:7955084-7955106 ATTTTTGGTAGAGATGGGGTGGG - Intergenic
1143731201 17:8883930-8883952 GCGTTTGGCAGTGAAGGAGGTGG - Intronic
1143978458 17:10847236-10847258 GGTATTGGCAGAGGTGGGTGTGG + Intergenic
1144383825 17:14730278-14730300 GCTTTTGGGAGAGAGGGTGGAGG - Intergenic
1145014713 17:19388628-19388650 TTTTTTTGTAGAGATGGGGGGGG + Intergenic
1145366764 17:22271796-22271818 GCTTTTAGCAGAGAAGGGAGTGG + Intergenic
1146595935 17:34168633-34168655 CCTTTTCCCTGAGATGGGGGGGG + Intronic
1147948179 17:44092232-44092254 GCTGTTGGGAGAGCTGGGGCCGG + Exonic
1148133349 17:45275573-45275595 GCGTTTGGCAGATTTGAGGGCGG - Intronic
1148226306 17:45900135-45900157 TCTTTTGGCAAAGATGGGCCTGG + Intronic
1148708839 17:49661437-49661459 TCCATTGGCAGAGATGGGGAAGG - Intronic
1148813132 17:50307544-50307566 ATTTTTGGTAGAGATGGGGGGGG + Intergenic
1149765223 17:59270368-59270390 GTTTTTAGTAGAGACGGGGGGGG + Intronic
1149786559 17:59440466-59440488 TCTTTTTGTAGAGATGGGGAGGG - Intergenic
1149920184 17:60650696-60650718 TATTTAGGGAGAGATGGGGGAGG + Intronic
1150691313 17:67369536-67369558 ATTTTTGGCAGAGATGGGGGAGG + Intergenic
1150694776 17:67395314-67395336 TCTTTTTGTAGAGATGGGCGGGG + Intronic
1150811641 17:68361539-68361561 GTTTTTTGTAGAGATGGGGGTGG - Intronic
1150946649 17:69753692-69753714 GCTTTTTGAAGTGGTGGGGGTGG + Intergenic
1151114285 17:71716397-71716419 GCTTTTAATAGAGATGGGGTAGG + Intergenic
1151392756 17:73798694-73798716 GCTTTTGGCCGGGGGGGGGGGGG + Intergenic
1151865557 17:76799756-76799778 GCTTTGGGCAAGGTTGGGGGTGG - Intergenic
1152097559 17:78280778-78280800 GCTTTGGGAAGACATGGGGCTGG + Intergenic
1152303839 17:79510081-79510103 GCTGTTGGCAGAGTTGCGTGAGG - Intronic
1152645694 17:81467638-81467660 ACTTTTGGCTGAGATGGGGGTGG - Intergenic
1153141592 18:1978773-1978795 TCATTTGGCAGAGGTGGGAGTGG + Intergenic
1153475649 18:5495757-5495779 GCATATGGCAGAGTTGGGCGCGG - Intronic
1153823855 18:8856705-8856727 GCCTTTGTCAGAAATGGAGGAGG + Intergenic
1154513307 18:15134096-15134118 TCTTGAGGCAGAGATTGGGGGGG + Intergenic
1155007131 18:21739735-21739757 ATTTTTGGCAGAGATGAGCGGGG - Intronic
1155518607 18:26647334-26647356 ATTTTTAGTAGAGATGGGGGGGG - Intronic
1157278590 18:46330478-46330500 GATTTTGGCAGGGATTGAGGGGG + Intronic
1160174838 18:76584678-76584700 CTTCTTGGCAGAGCTGGGGGTGG - Intergenic
1161362723 19:3860209-3860231 TTTTTTTTCAGAGATGGGGGGGG + Intronic
1161374080 19:3930073-3930095 TTTTTTGGTAGAGATGGTGGGGG + Intergenic
1161803705 19:6430208-6430230 GCTTGGGGCAGGGATGGGGACGG - Intronic
1162325075 19:9994031-9994053 ATTTTTGGTAGAGATGGTGGGGG + Intronic
1162913022 19:13860031-13860053 TTTTTTTGGAGAGATGGGGGTGG - Intergenic
1163100453 19:15092821-15092843 AATTTTTGTAGAGATGGGGGAGG - Intergenic
1163482267 19:17564061-17564083 AGTTTTTGTAGAGATGGGGGGGG - Intronic
1163489303 19:17607437-17607459 GTTTTTAGTACAGATGGGGGTGG + Intronic
1163535787 19:17875595-17875617 TTTTTTTGTAGAGATGGGGGCGG - Intronic
1163575468 19:18108827-18108849 GCTTTTGCCTGAGTTGGGGGTGG + Intronic
1163623004 19:18371942-18371964 ATTTTTTGTAGAGATGGGGGGGG - Intergenic
1164975368 19:32569028-32569050 TTTTTTTGCAGAGACGGGGGGGG + Intergenic
1165481643 19:36068014-36068036 GCTGATGGCAGAGAGGGAGGTGG - Intronic
1165726515 19:38116675-38116697 ATTTTTGGTAGAGATGGGGATGG - Intronic
1165876525 19:39011673-39011695 ATTTTTCGCAGAGATGGCGGCGG + Intronic
1166684232 19:44785964-44785986 ATATTTGGTAGAGATGGGGGTGG + Intronic
1166802860 19:45468930-45468952 GCTTTGGGGCGAGGTGGGGGTGG + Intronic
1166879201 19:45916860-45916882 ATTTTTAGTAGAGATGGGGGTGG - Intergenic
1167075657 19:47247234-47247256 TTTTTTTGTAGAGATGGGGGGGG + Intergenic
1167462666 19:49634427-49634449 ATTTTTGGTAGAGATGGGGGCGG + Intergenic
1167585190 19:50370647-50370669 ATTTTTTGTAGAGATGGGGGTGG + Intronic
1167784826 19:51628091-51628113 GCTTTGGGGAGAGAAGGGTGGGG + Exonic
1167988024 19:53334729-53334751 TTTTTTGACAGAGATGGGGGGGG - Intronic
1168527592 19:57101189-57101211 ACTTTTTGTAGAGATGTGGGGGG - Intergenic
925406715 2:3610516-3610538 GATTGTGGCTGAGATGAGGGCGG - Intronic
925713648 2:6765755-6765777 GCTTTTAACAGAGCTGGTGGGGG - Intergenic
925842277 2:8003655-8003677 GGATATGGCAGGGATGGGGGAGG + Intergenic
925911558 2:8576883-8576905 TACTTTGGCAGGGATGGGGGAGG - Intergenic
925965004 2:9056601-9056623 ATTTTTGGTAGAGATGGGGTTGG - Intergenic
926368903 2:12160996-12161018 ACTATTGACAGAGTTGGGGGTGG + Intergenic
926701045 2:15803803-15803825 GCTTTTGAGAGGGACGGGGGAGG - Intergenic
927602406 2:24455493-24455515 ATTTTTAGTAGAGATGGGGGGGG + Intergenic
927915115 2:26930648-26930670 AGTTTTTGCAGAGATGGAGGGGG - Intronic
927942795 2:27116038-27116060 GTTTTTTTTAGAGATGGGGGGGG - Intronic
928323190 2:30300159-30300181 GTTTTTGGCAGAGCTGGGCTGGG - Intronic
928394745 2:30934837-30934859 GCTTGGGGCAGAGTTGGGGCTGG - Intronic
928996031 2:37292186-37292208 GCTCTTTACAGAAATGGGGGTGG + Intronic
929591112 2:43146894-43146916 ATTTTTTGTAGAGATGGGGGGGG + Intergenic
929648555 2:43654711-43654733 TTTTTTGGTAGAGATGCGGGGGG - Intronic
930688918 2:54338976-54338998 ATTTTTAGTAGAGATGGGGGGGG - Intronic
931342941 2:61419556-61419578 GTTATTGGTAGAGATGGGGTGGG - Intronic
932005856 2:67926276-67926298 GCTCTTGGCAGAAATGGGACAGG - Intergenic
932247486 2:70207729-70207751 ATTTTTAGTAGAGATGGGGGGGG + Intronic
932645638 2:73498540-73498562 GGTTTGGGGAGAGATGGGGATGG - Intronic
932861014 2:75291256-75291278 TATTTTGGCAGGGGTGGGGGGGG + Intergenic
933652402 2:84859935-84859957 ATTTTTTGGAGAGATGGGGGGGG + Intronic
934515020 2:94981073-94981095 CCTTATGGCCGAGATGGGGAAGG - Intergenic
934612966 2:95754353-95754375 GTTTTTAGTAGAGATGGGGTTGG - Intergenic
934647936 2:96070069-96070091 GTTTTTAGTAGAGATGGGGTTGG + Intergenic
934841308 2:97625890-97625912 GTTTTTAGTAGAGATGGGGTTGG + Intergenic
935594567 2:104868708-104868730 GGTTTGGGCAGAGGAGGGGGAGG + Intergenic
935838566 2:107081950-107081972 GCTTATGGCAGATTTGGGGACGG + Intergenic
936474850 2:112831196-112831218 GCTTTTCCTAGGGATGGGGGCGG + Intronic
937962818 2:127474680-127474702 ATTTTTAGTAGAGATGGGGGGGG - Intronic
938513555 2:131978707-131978729 TCTTGAGGCAGAGATTGGGGGGG + Intergenic
938538027 2:132261110-132261132 GCTATTGGCGGGGAGGGGGGTGG + Intergenic
939454804 2:142420409-142420431 ATTTTTAGTAGAGATGGGGGTGG + Intergenic
940039469 2:149345103-149345125 TCTTTTTTCAGAGATGGGGTCGG - Intronic
940453533 2:153870809-153870831 GTTTTTGGCAGAATTGGGGGAGG - Intergenic
942098410 2:172555681-172555703 CCTTTTGGCTGAGATTGGGAGGG + Intronic
942116291 2:172732689-172732711 AATTTTTGTAGAGATGGGGGGGG + Intergenic
942261704 2:174171898-174171920 GCTGTTGGCAGCGCTGAGGGCGG - Intronic
943651761 2:190464900-190464922 GCTTTTGGTGGGGGTGGGGGAGG + Intronic
944012087 2:194984400-194984422 GCTTCTGGTAGAGAGGGGGATGG - Intergenic
944581030 2:201133032-201133054 GCTGATGGCAGAGATTGGTGAGG + Exonic
944679440 2:202063631-202063653 TTTTTTGGTAGATATGGGGGTGG + Intergenic
944984794 2:205163745-205163767 GATACCGGCAGAGATGGGGGTGG - Intronic
945438233 2:209844768-209844790 ATTTTTTGTAGAGATGGGGGTGG + Intronic
946272098 2:218602978-218603000 ATTTTTGGTAGAGATGGAGGGGG + Intergenic
946411245 2:219516277-219516299 GCGGTTGGGATAGATGGGGGTGG - Intronic
946853855 2:223933783-223933805 TTTTTTTGTAGAGATGGGGGGGG - Intronic
947148547 2:227090574-227090596 TGATTTTGCAGAGATGGGGGGGG - Intronic
947617288 2:231566368-231566390 GCATTTGGCTGGGATGGTGGGGG + Intergenic
948049933 2:234972455-234972477 TTTTTTGGTAGAGATGGAGGAGG + Intronic
948258071 2:236583073-236583095 GGTCTTGGCAGAGGTGGAGGTGG - Intergenic
948433396 2:237935173-237935195 GTTTTTTGCAGAGATGGGAGGGG - Intergenic
948494711 2:238339964-238339986 ACTTTTTGCAGAGATTGGGATGG + Intronic
948705807 2:239791903-239791925 GCTGTTGACAGGGATGGGTGTGG + Intronic
1169266463 20:4170169-4170191 GCTTCTGGCGCAGTTGGGGGTGG + Intronic
1170733820 20:18996374-18996396 GAATTTGGAAGAGAAGGGGGAGG + Intergenic
1171102102 20:22394033-22394055 GCTTTGGCCAGAAATGGGGGTGG - Intergenic
1171996859 20:31738224-31738246 ATTTTTAGTAGAGATGGGGGGGG + Intergenic
1172065895 20:32220300-32220322 TTTTTTGGTAGAGATGGGTGGGG + Intronic
1172068866 20:32241621-32241643 ACTTTTGGTAGAGATGGAGGGGG - Intergenic
1172071450 20:32260322-32260344 ATTTTTAGCAGAGATGGGGTTGG + Intergenic
1172401070 20:34651929-34651951 TTTTTTTGTAGAGATGGGGGGGG - Intronic
1173170551 20:40720123-40720145 GCTAGGGGCAGAGATGGGGAAGG - Intergenic
1173729734 20:45319874-45319896 TTTTTTTGTAGAGATGGGGGAGG - Intergenic
1173839161 20:46145894-46145916 GGTTTGGGCACAGCTGGGGGTGG + Intergenic
1174045244 20:47728476-47728498 GAGTGTGGAAGAGATGGGGGTGG + Intronic
1174045580 20:47730282-47730304 GACTTTCGCAGAGATGGTGGCGG - Intronic
1174346177 20:49931855-49931877 ATTTTTTGTAGAGATGGGGGAGG + Intergenic
1174415475 20:50363563-50363585 GCTGCTGGCAGAGAAGGTGGGGG - Intergenic
1174699862 20:52597434-52597456 ACCTTTGGCTGAGGTGGGGGTGG + Intergenic
1175383835 20:58581592-58581614 GCTCATGGGAGAGATGGGGTGGG + Intergenic
1175855735 20:62119994-62120016 GCTTCTGGCTGTGTTGGGGGTGG - Intergenic
1175868981 20:62198485-62198507 GCTGTTGGCAGAGGTGAGTGGGG + Intronic
1176337502 21:5612570-5612592 GGTTCAGGCAGAAATGGGGGGGG - Intergenic
1176471164 21:7107796-7107818 GGTTCAGGCAGAAATGGGGGGGG - Intergenic
1176494725 21:7489574-7489596 GGTTCAGGCAGAAATGGGGGGGG - Intergenic
1176505917 21:7648809-7648831 GGTTCAGGCAGAAATGGGGGGGG + Intergenic
1176780227 21:13184187-13184209 TCTTGAGGCAGAGATTGGGGGGG - Intergenic
1176883417 21:14225754-14225776 TCTTTTGGTAGAGATGGGGTAGG + Intronic
1177425050 21:20911912-20911934 ACATTTGGCAGAGATGGTGAGGG + Intergenic
1178974836 21:37212692-37212714 ATTTTTGGTAGAGATGGGGTTGG + Intergenic
1179081115 21:38171566-38171588 TCTTTTGGCGAAGGTGGGGGAGG - Intronic
1179175560 21:39005429-39005451 GCTAGAGGCAGAGATGAGGGCGG - Intergenic
1181149848 22:20875435-20875457 TCTGTTGGAAGATATGGGGGAGG + Intronic
1181685244 22:24523489-24523511 GCATTTGGCAGACACTGGGGAGG + Intronic
1182729232 22:32474304-32474326 ATTTTTTGTAGAGATGGGGGGGG + Intergenic
1182857185 22:33528115-33528137 GGTTCTGGCAGAGGTCGGGGGGG + Intronic
1183469106 22:37996362-37996384 TCTCTCGCCAGAGATGGGGGCGG - Intronic
1183941981 22:41301245-41301267 ACTTTTGACACAGATGGGGAAGG + Intergenic
1184513339 22:44945702-44945724 ACTGTTGGCAGAATTGGGGGGGG + Intronic
1184590208 22:45476973-45476995 TCTGTGGGCAGAGATGGGAGGGG - Intergenic
949916714 3:8970412-8970434 TCTTTTGGTAGAGACTGGGGTGG - Intergenic
950191516 3:10979965-10979987 ACATTTTGCAGAGATGGGGTGGG + Intergenic
950477452 3:13223069-13223091 GGTTTGGGCAGGGTTGGGGGAGG + Intergenic
950552574 3:13675570-13675592 GCTGCTGGCAGAGCTGGAGGTGG - Intergenic
950655209 3:14432329-14432351 GGTTTTGCCGGAAATGGGGGCGG - Intronic
950663649 3:14482121-14482143 GGTGTTGGCAGAGTTGGGGTGGG + Intronic
952926455 3:38323747-38323769 GTTTTTAGCAGAGACGGGGGGGG + Intergenic
953399044 3:42596553-42596575 ACTCTTGGAAGAGATGGAGGAGG + Intronic
954593956 3:51809577-51809599 GCACTTGGCAGAGGTGTGGGTGG - Intergenic
954615079 3:51965390-51965412 GATTTTGACAGAGAGTGGGGAGG - Intronic
954636379 3:52073110-52073132 GCTGAGGGCAGAGCTGGGGGTGG - Intergenic
955190014 3:56752749-56752771 GTTTTAGGCAGAGCTGGAGGAGG - Intronic
955788157 3:62561436-62561458 TTTTTTGGTAGAGATGGTGGGGG + Intronic
956465196 3:69513495-69513517 GTTTTTGGAAGAGTTTGGGGAGG - Intronic
959531014 3:107433539-107433561 TCTTTTTGCAGAGATAGGGTGGG - Intergenic
959848758 3:111063913-111063935 AATTTTTGTAGAGATGGGGGGGG - Intergenic
960801258 3:121542778-121542800 ATTTTTTGTAGAGATGGGGGTGG - Intronic
961378630 3:126482999-126483021 GCTTCTGGCGGAGCTGGGGATGG - Intronic
961422243 3:126815649-126815671 GCTGTGGACACAGATGGGGGGGG - Intronic
961735479 3:128999714-128999736 ATTTTTAGTAGAGATGGGGGTGG + Intronic
962578396 3:136775322-136775344 ATTTTTAGTAGAGATGGGGGGGG + Intergenic
962705395 3:138038650-138038672 ACAGATGGCAGAGATGGGGGAGG + Intergenic
964172663 3:153789571-153789593 GCTTTTGGCAGTGTTAGGGTAGG - Intergenic
964201195 3:154121306-154121328 GCTTCTGGCTGCGATGGAGGCGG + Intronic
965583826 3:170297626-170297648 ATTTTTAGTAGAGATGGGGGGGG + Intronic
968281990 3:197484336-197484358 GCTTTTGGAGGAGATGAGGCTGG - Intergenic
968312471 3:197695421-197695443 TTTTTTTGTAGAGATGGGGGAGG - Intronic
968868376 4:3227884-3227906 GCTTTTGGGAAAGAGGGGTGGGG + Intronic
969290967 4:6239809-6239831 GCCTTTGGGAGGGATGGGAGTGG - Intergenic
969532344 4:7736895-7736917 GCTTTGAGCAGAGATGGGGCAGG + Intronic
970559999 4:17273313-17273335 GTTTTGGGCAGAGCTGGGTGGGG + Intergenic
970845274 4:20530393-20530415 GCTTCTTGGGGAGATGGGGGTGG - Intronic
970863338 4:20730224-20730246 GCTTTTGGCATAGGTGGTTGAGG - Intronic
971041670 4:22760186-22760208 GCTATGTGCAGAGATGGGGGAGG + Intergenic
971453096 4:26818403-26818425 ATTTTTTGTAGAGATGGGGGTGG + Intergenic
971937804 4:33175460-33175482 ATTTTTTGTAGAGATGGGGGGGG - Intergenic
972569232 4:40295444-40295466 GCTGGAGGCAGAGATGGAGGTGG - Intergenic
972648429 4:40992347-40992369 ATTTTTGGTAGAGATGGGGGGGG + Intronic
973543675 4:51959371-51959393 GCTTGTGGCAGAGATGGAACAGG + Intergenic
973950671 4:56010184-56010206 ATTTTTAGTAGAGATGGGGGTGG - Intronic
975433359 4:74321092-74321114 GATCTTGGCAGAGGTGAGGGAGG - Intergenic
976065268 4:81179954-81179976 GTTTTTAGTAGAGATGGGGTTGG - Intronic
976201575 4:82584771-82584793 GGTGTTGGCAGAGGTGGTGGAGG - Intergenic
978510847 4:109515871-109515893 GTATTTGGTAGAGATGGGGGTGG - Intronic
980134292 4:128845367-128845389 GTTTTTGGCAGAGTGGGGAGAGG + Intronic
981602703 4:146508631-146508653 GCTTTCAGCAGTGATGGGTGAGG - Intronic
982720624 4:158855785-158855807 CCTTTTGGCAGATATGTGGTTGG + Intronic
983772098 4:171563639-171563661 GCTTTAGCCTGAGGTGGGGGCGG - Intergenic
984069853 4:175096512-175096534 TTTTTTAGTAGAGATGGGGGTGG - Intergenic
984764062 4:183386022-183386044 ATTTTTGGTAGAGATGGCGGGGG - Intergenic
985639883 5:1058649-1058671 GAGATTGGCACAGATGGGGGAGG + Intronic
986333069 5:6732124-6732146 CCTTGGGGCTGAGATGGGGGAGG + Intronic
986347700 5:6850134-6850156 GTGTTTGGCAAGGATGGGGGAGG + Intergenic
986692235 5:10322467-10322489 ATTTTTTGCAGAGATGGGTGGGG + Intergenic
986962515 5:13232461-13232483 CCTTTTTGCATAGATGAGGGGGG + Intergenic
988703809 5:33703387-33703409 GCTTTTACCACAAATGGGGGCGG - Intronic
990251339 5:53918362-53918384 ATTTTTAGTAGAGATGGGGGGGG + Intronic
990533520 5:56697410-56697432 ATTTTTAGTAGAGATGGGGGGGG - Intergenic
990555889 5:56935215-56935237 GCCTTGGGCAGGGTTGGGGGTGG + Intronic
990734410 5:58844471-58844493 GCTTTAGGAAGAGAAGTGGGAGG - Intronic
991665191 5:68992865-68992887 GCTTCTAGGAGAGATTGGGGTGG - Intergenic
995014590 5:107295560-107295582 GATTTTGGCAGGGTTGGGGGTGG - Intergenic
997727892 5:136137274-136137296 GCTATAGGAAGAGATGCGGGGGG - Intronic
997849370 5:137317125-137317147 TCTTTTGGCAGAGGTGAGTGCGG + Intronic
998013557 5:138714618-138714640 ATTTTTTGAAGAGATGGGGGGGG + Intronic
998091980 5:139376645-139376667 GCTTTTTGCAAAGATCGTGGAGG - Intronic
998517372 5:142768886-142768908 ATTTTTTGTAGAGATGGGGGGGG + Intergenic
998889894 5:146734922-146734944 GCTATTGGCAGAGAAAGGGGCGG - Intronic
1001268142 5:170290122-170290144 GCTTTTGGAAAAGGTGGAGGAGG - Intronic
1001644795 5:173272018-173272040 TTTTTTTGTAGAGATGGGGGTGG + Intergenic
1001933129 5:175687129-175687151 GGCTTTGGCAGAGAAGGGTGGGG + Intergenic
1002425505 5:179172316-179172338 ACTTTTGGCAGAGTTGGGAATGG - Intronic
1003332450 6:5141177-5141199 GCAGATGGGAGAGATGGGGGTGG + Intronic
1004866358 6:19857083-19857105 GCTTAGGGCAGAGTTGGGGCAGG - Intergenic
1005580335 6:27228198-27228220 ATTTTTAGTAGAGATGGGGGGGG - Intergenic
1006680002 6:35790101-35790123 GATTTTTGTAGAGATGGGGAGGG + Intronic
1006856200 6:37134918-37134940 GCTCTATGCAGGGATGGGGGTGG + Intergenic
1007092557 6:39193332-39193354 GCAGTTGGCTGAGTTGGGGGAGG - Intronic
1010190069 6:73186050-73186072 ATTTTTTGCAGAGATAGGGGGGG - Intronic
1010804007 6:80213603-80213625 GCTTTGGGCAGAGAGTGAGGGGG - Intronic
1010928211 6:81769189-81769211 ACTTTGGGCAGAGCTGAGGGAGG - Intergenic
1011939384 6:92824067-92824089 ATTTTTAGTAGAGATGGGGGGGG + Intergenic
1012673269 6:102083855-102083877 TCTTTTAGTAGAGATGGCGGGGG + Intergenic
1013604228 6:111732962-111732984 TCTTTGGGAGGAGATGGGGGAGG + Intronic
1014513617 6:122355465-122355487 TCCTTTGGCAGAGGTGGGGATGG - Intergenic
1014734717 6:125078878-125078900 GCTATTTGTGGAGATGGGGGAGG - Intronic
1015008109 6:128309366-128309388 GCTGATGGCAGAGAGGGGTGGGG + Intronic
1015146792 6:129996018-129996040 ATTTTTAGTAGAGATGGGGGGGG + Intergenic
1015499638 6:133919099-133919121 TTTTTTGGTAGAGACGGGGGTGG - Intergenic
1016009853 6:139128028-139128050 ATTTTTGGTAGAGATGGCGGGGG + Intergenic
1017607500 6:156149393-156149415 ACCTTTAGTAGAGATGGGGGTGG - Intergenic
1018464954 6:164035476-164035498 ATTTTTTGCAGAGATGGGGGAGG + Intergenic
1018897054 6:168027082-168027104 GCAGGAGGCAGAGATGGGGGAGG + Intronic
1019058482 6:169239500-169239522 GGTTTTGGCAGAGAAGAGTGAGG - Intronic
1019180757 6:170186261-170186283 GTCTTTGTCAGAGATGGGGGTGG - Intergenic
1019723412 7:2587187-2587209 GCTATTTCCTGAGATGGGGGAGG + Intronic
1019883646 7:3885038-3885060 GCTATTGGCAGAGATGGGGCGGG - Intronic
1020066038 7:5189438-5189460 GTTTTTTGTAGAGATGGGGTGGG - Intergenic
1020290920 7:6721736-6721758 ACTTTTAGTAGAGATGGGGTTGG + Intergenic
1021714574 7:23449733-23449755 GTTTTTAGTAGAGACGGGGGTGG + Intronic
1021843367 7:24741190-24741212 GCTAGTGGCAGAGGTGGGGTGGG + Intronic
1022355088 7:29607022-29607044 GCTGCTGGCACAGATGGGTGGGG + Intergenic
1022380114 7:29851666-29851688 GCTGTTGGCACAGATGGTGAGGG + Intronic
1023311864 7:38895741-38895763 GCTTTTGGCAGAGATGGGGGAGG - Intronic
1024244016 7:47455842-47455864 GCCTGTGGCAGAGGTGGGGCAGG + Intronic
1024313904 7:47995354-47995376 GGTTTTGATGGAGATGGGGGTGG + Intronic
1024632852 7:51263400-51263422 GCTTTTGGCAGCAATATGGGGGG + Intronic
1025099064 7:56120766-56120788 ATTTTTGGTAGAGATGGGGGCGG - Intergenic
1025255080 7:57379204-57379226 GCTGCTGGCAGAGAAGGTGGGGG + Intergenic
1025839932 7:65136671-65136693 GCTTTTAGCAGAGATGGGATAGG - Intergenic
1025883134 7:65559294-65559316 GCTTTTAGCAGAGATGGGATAGG + Intergenic
1025890312 7:65643312-65643334 GCTTTTAGCAGAGATGGGATAGG - Intergenic
1025905044 7:65776737-65776759 ATTTTTGGCATAGACGGGGGCGG + Intergenic
1026083591 7:67243586-67243608 ATTTTTGGTAGAGATGGCGGGGG + Intergenic
1026191608 7:68133581-68133603 TTTTTTTGTAGAGATGGGGGGGG - Intergenic
1026328023 7:69327750-69327772 ATTTTTTGTAGAGATGGGGGGGG - Intergenic
1026442654 7:70457637-70457659 GCATTGGACAGAGGTGGGGGTGG + Intronic
1026775262 7:73227230-73227252 GCTTCAGGAAGTGATGGGGGCGG - Intergenic
1026867458 7:73832376-73832398 GGTTTGGGCAGTGGTGGGGGAGG + Exonic
1027016119 7:74780601-74780623 GCTTCAGGAAGTGATGGGGGCGG - Intronic
1027071909 7:75165336-75165358 GCTTCAGGAAGTGATGGGGGCGG + Intergenic
1027137990 7:75638536-75638558 GCCCTTGGCAGAGACGGGGAAGG - Intronic
1027212629 7:76163552-76163574 ATTTTTGGTAGAGATGGGGGTGG - Intergenic
1028123542 7:87085055-87085077 TCTTGTGGCAGAAATGGGGGAGG - Intergenic
1028348952 7:89819535-89819557 GCTATTGGGAGAGATGGAGCTGG - Intergenic
1028815719 7:95141529-95141551 GCCTATGGCAGAGAAGGGAGAGG - Intronic
1028968775 7:96832807-96832829 GTATTTGGCAGAGAGGTGGGAGG + Intergenic
1029140086 7:98403010-98403032 ATTTTTTGCAGAGATGGGGGTGG - Intergenic
1029416758 7:100448010-100448032 ATTTTTGGAAGAGATGGGGCTGG - Intergenic
1029448605 7:100628172-100628194 GCATTGGGGAGAGGTGGGGGTGG - Intronic
1029478244 7:100797946-100797968 TGTTTTTGTAGAGATGGGGGCGG + Intergenic
1029544865 7:101205322-101205344 ATTTTTTGTAGAGATGGGGGGGG + Intergenic
1030105493 7:105983624-105983646 GTTTTTCACAGTGATGGGGGAGG - Intronic
1030722892 7:112890363-112890385 GTTTTTTTCAGAGGTGGGGGGGG - Intronic
1031046090 7:116889550-116889572 TTTTTTGGTAGAGATGGGGAGGG - Intronic
1031852168 7:126878696-126878718 GCTTTTAGCAGAGATGGGATAGG + Intronic
1031958520 7:127967332-127967354 GTTCGTGGCAGGGATGGGGGTGG + Intronic
1032019712 7:128400539-128400561 TCTGCGGGCAGAGATGGGGGAGG + Exonic
1032888601 7:136168877-136168899 GCTTTTGGAAGAGATAGTGAAGG + Intergenic
1032970098 7:137151215-137151237 GCTTCTCGAAGAAATGGGGGAGG - Intergenic
1033008254 7:137590867-137590889 ATTTTTTGTAGAGATGGGGGCGG + Intronic
1033386105 7:140877279-140877301 GTTTTTTTAAGAGATGGGGGGGG + Intronic
1034285323 7:149880070-149880092 GCTTTTGGCTGCAGTGGGGGTGG + Exonic
1034440592 7:151083709-151083731 GCTGTTGGCAGGGGAGGGGGCGG - Intergenic
1034708555 7:153170545-153170567 GCTTTGTGTAGAGATGGGGAGGG + Intergenic
1035381018 7:158440987-158441009 GGTGATGGCAGTGATGGGGGTGG + Intronic
1035461887 7:159044940-159044962 ACTTTTAGTAGAGATGGGGTGGG + Intronic
1035517456 8:248300-248322 GTTTGTGGCACAGATGGTGGTGG - Intergenic
1036932103 8:12966151-12966173 ACTTTCTGTAGAGATGGGGGGGG - Intronic
1037939740 8:22942507-22942529 TCTTTTTGTAGAGATGGTGGGGG - Intronic
1038292111 8:26259318-26259340 GTTCTTGGCAGGGATGTGGGTGG + Intergenic
1038642582 8:29339833-29339855 GTTTTTGGTAGAGATGGGGGGGG - Intronic
1038670317 8:29577814-29577836 GGTGTGGGCACAGATGGGGGTGG - Intergenic
1039055360 8:33532091-33532113 ACTTTTTGTAGAGATGGTGGGGG - Intergenic
1039438999 8:37581662-37581684 ACTTGTGGCGGGGATGGGGGAGG + Intergenic
1039469026 8:37802327-37802349 GCTGGTGGAAGAGAAGGGGGTGG - Intronic
1039744704 8:40413906-40413928 AATTTTGTCAGAGGTGGGGGAGG + Intergenic
1039880692 8:41623719-41623741 GCTTTAGGCAGCCATGGGGCTGG + Exonic
1040553042 8:48453426-48453448 GCTGTGGGCAGGGGTGGGGGGGG + Intergenic
1040805873 8:51395879-51395901 TCTGCTGGCAGAGTTGGGGGTGG - Intronic
1040871183 8:52101207-52101229 GCTCCAGGCAGAGATGGGGCTGG + Intergenic
1041803892 8:61829004-61829026 GTTTTTTGTAGAGATGGGGAAGG + Intergenic
1042619578 8:70690516-70690538 GTATTTAGTAGAGATGGGGGTGG + Intronic
1043007974 8:74844386-74844408 GCTTTTTCCTGAGATGGAGGGGG - Intronic
1043409529 8:79978690-79978712 TGTTTTTGTAGAGATGGGGGTGG - Intronic
1043609682 8:82046527-82046549 GCTGAAGGAAGAGATGGGGGAGG + Intergenic
1043955763 8:86358255-86358277 GATTAGGGCAGAGATGGGAGAGG + Intronic
1044163133 8:88945834-88945856 GCCTTTGGCAGAAAAGGGGCAGG - Intergenic
1045463623 8:102448557-102448579 GCTAGTGGTAGAGATTGGGGAGG + Intergenic
1045873995 8:106957972-106957994 GGTTTTGGCAAAGATGTGGTAGG - Intergenic
1046121904 8:109857579-109857601 TCTTTAGGCAGAAAAGGGGGAGG + Intergenic
1047076016 8:121403904-121403926 GGTTGTGGCAGAGAAGGAGGTGG + Intergenic
1048162029 8:132030144-132030166 GTATTTGGCAGGGATGGGTGGGG + Intronic
1048277090 8:133074819-133074841 GTATGTGGCAGAGATGGGGTGGG - Intronic
1048538605 8:135321571-135321593 GCTTTTGGCAGAAATGAATGAGG - Intergenic
1049081179 8:140444686-140444708 ATTTTTAGTAGAGATGGGGGGGG - Intronic
1049376389 8:142291357-142291379 GATTTTGTCAGAGATGACGGTGG - Intronic
1049579843 8:143406345-143406367 GCTGTGGGTAGAGGTGGGGGTGG - Intergenic
1050179357 9:2903628-2903650 TGTTTTGGTAGAGATGGGGTTGG + Intergenic
1050220414 9:3382434-3382456 GCTTTTCTTAGAGATTGGGGTGG + Intronic
1050256107 9:3793791-3793813 GGTTTTGGCAGAGGTAGGGCAGG - Intergenic
1052847278 9:33348174-33348196 TATTTTAGTAGAGATGGGGGGGG - Intronic
1053142382 9:35689992-35690014 GGTTTGGGCCGAGGTGGGGGAGG - Exonic
1053575950 9:39357628-39357650 GCTTTGGACACAGATGGGTGGGG + Intronic
1053840466 9:42185565-42185587 GCTTTGGACACAGATGGGTGGGG + Intronic
1054097520 9:60916319-60916341 GCTTTGGACACAGATGGGTGGGG + Intergenic
1054118922 9:61191949-61191971 GCTTTGGACACAGATGGGTGGGG + Intronic
1054407250 9:64773450-64773472 GCTTTTGGCGGCGGGGGGGGGGG + Intergenic
1054588829 9:66990613-66990635 GCTTTGGACACAGATGGGTGGGG - Intergenic
1056762363 9:89424680-89424702 ACATTGGGCAGAGGTGGGGGAGG - Intronic
1057059735 9:91992917-91992939 GGTATTGGCTGAGATGGCGGTGG - Intergenic
1057711342 9:97448236-97448258 CCTTCTGGCAGAGATGGCTGTGG + Intronic
1057972164 9:99568649-99568671 TCTTCTGACAGAGATGGTGGTGG - Intergenic
1058578200 9:106425860-106425882 CATTTTGGTAGAGCTGGGGGAGG + Intergenic
1058592841 9:106583811-106583833 GCTGCTGGCAGAGATGGGAGTGG - Intergenic
1058872142 9:109211890-109211912 ACTTATAGTAGAGATGGGGGGGG + Intronic
1059204377 9:112450257-112450279 TCTATTGGTAGAGATGGGGGGGG - Intronic
1059422493 9:114200990-114201012 GCTTTGGGCAGGGAGGGGAGGGG - Intronic
1060199958 9:121646518-121646540 GCTCTGGGCAGGGGTGGGGGTGG - Intronic
1060362903 9:122977527-122977549 ATTTTTGGTAGAGATGGGGTGGG - Intronic
1060464528 9:123891175-123891197 GCTTCTGGGAGACATGGGGAAGG - Intronic
1060700422 9:125746378-125746400 GCTTTTGGCAGTCATGGGAGCGG - Intergenic
1060761679 9:126257253-126257275 ATTTTTTGCAGAGATGAGGGGGG - Intergenic
1060838922 9:126779132-126779154 TTTTTTAGTAGAGATGGGGGAGG + Intergenic
1061010776 9:127953481-127953503 GCTTGTGGCAGAAAAGGGGCTGG + Intronic
1061044745 9:128159211-128159233 GCTTTCTGTAGAGACGGGGGTGG + Intergenic
1061297169 9:129682929-129682951 ATTTTTAGTAGAGATGGGGGGGG - Intronic
1061553093 9:131349229-131349251 ATTTTTTGTAGAGATGGGGGTGG - Intergenic
1061692432 9:132344386-132344408 CTTTTTTGTAGAGATGGGGGAGG + Intronic
1062015331 9:134288334-134288356 GGTCTTGGCAGAGATGATGGTGG + Intergenic
1062411517 9:136427782-136427804 ATTTTTAGTAGAGATGGGGGGGG + Intergenic
1062609262 9:137366662-137366684 GGTTTTGGCTGAGGTGGCGGAGG - Intronic
1185789013 X:2914404-2914426 ATTTTTTGTAGAGATGGGGGGGG + Intronic
1185790937 X:2928264-2928286 GCTTGTGGTGGAGATGGGGACGG + Intronic
1186422862 X:9440114-9440136 GCTTTTGGCGGGGCGGGGGGAGG - Intergenic
1186975884 X:14904508-14904530 GTTTGTGTCAGAAATGGGGGTGG - Intronic
1187134655 X:16535267-16535289 ATTTTTTGTAGAGATGGGGGTGG + Intergenic
1187668281 X:21640463-21640485 TCTTTTTGCAGAAATGGGGGTGG - Intronic
1187859271 X:23666133-23666155 CTTTTTGGGAGAGATGGGCGTGG + Intronic
1188659766 X:32744343-32744365 GGTTGTGGCAGAGAGGTGGGAGG - Intronic
1189343138 X:40219777-40219799 ATTTTTTGTAGAGATGGGGGAGG + Intergenic
1189908505 X:45786009-45786031 TTTTTTGGTAGAGATGGTGGTGG + Intergenic
1190025147 X:46915135-46915157 TATTTTGGAAGAGGTGGGGGAGG + Intronic
1190112911 X:47606550-47606572 GTTTTTTGTAGAGATGGGGGGGG - Intronic
1190227134 X:48554939-48554961 GCTGTTGGGAGAGATTGGAGAGG + Intronic
1190994376 X:55592135-55592157 GTTTGAGGTAGAGATGGGGGAGG - Intergenic
1191883249 X:65863271-65863293 GAATTGGGCAGGGATGGGGGAGG - Intergenic
1192447800 X:71223592-71223614 GCTCTTGGAAGAGTTGAGGGGGG + Intronic
1192482011 X:71493817-71493839 ATTTTTTGCAGAGATGGGGGTGG - Intronic
1192726059 X:73753169-73753191 GCTGCTGCCAGGGATGGGGGAGG + Intergenic
1192859823 X:75055537-75055559 TTTTTTGGTAGAGATGGGCGGGG - Intronic
1192924531 X:75741513-75741535 GCTTCAGGCTGAGAGGGGGGTGG + Intergenic
1193082817 X:77422604-77422626 GGTGTGGGCAGAGGTGGGGGTGG - Intergenic
1193086306 X:77450030-77450052 GCTTTTGGCACAGAAAGAGGTGG + Intronic
1193414206 X:81202088-81202110 GCGGTTGGCAGAGAAGGGTGGGG - Exonic
1194971486 X:100348931-100348953 CTTTTTGGTAGAGATGGTGGGGG + Intronic
1195235274 X:102890584-102890606 GCTGTGTGCAGAGGTGGGGGTGG + Intergenic
1195345572 X:103947383-103947405 GCTTATGGCAGGGAGGGGAGAGG + Intronic
1196041130 X:111205394-111205416 CCTTTTGGCAGAGTTGGGGAAGG - Intronic
1196084028 X:111664704-111664726 TTTTTTTGTAGAGATGGGGGGGG - Intergenic
1196150744 X:112370585-112370607 GCTTTTTGCAAGGAAGGGGGAGG + Intergenic
1196351042 X:114730254-114730276 GCTATTGCCAGAGATGGATGTGG - Intronic
1196756074 X:119158438-119158460 CCTTTTGGGCAAGATGGGGGAGG + Intergenic
1198625638 X:138569909-138569931 TCCTGTGGGAGAGATGGGGGAGG - Intergenic
1199452338 X:147990818-147990840 GGTCTTGGGAGAGATGAGGGAGG - Intronic
1199728145 X:150605027-150605049 GCAAATGGCAGAGATGGGGTGGG - Intronic
1200126712 X:153818745-153818767 GCTTTTTGCAGAGAAGGAGCAGG + Intronic
1200886948 Y:8280227-8280249 CATTGTGGCAGAGATGGAGGTGG + Intergenic
1200993124 Y:9361181-9361203 GCTTTTGGCAGAGATGACTAAGG + Intronic
1200998442 Y:9401803-9401825 GCTTTTGGCAGAGATGACTAAGG + Intergenic
1201000952 Y:9470333-9470355 GCTTTTGGCAGAGATGACTAAGG + Intronic
1201006275 Y:9510943-9510965 GCTTTTGGCAGAGATGACTAAGG + Intergenic