ID: 1023314398

View in Genome Browser
Species Human (GRCh38)
Location 7:38920457-38920479
Sequence ACTTATCTGCACAGAATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 167}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023314398_1023314401 -8 Left 1023314398 7:38920457-38920479 CCTGTCATTCTGTGCAGATAAGT 0: 1
1: 0
2: 1
3: 6
4: 167
Right 1023314401 7:38920472-38920494 AGATAAGTGAAAAGAAGGATGGG No data
1023314398_1023314402 -7 Left 1023314398 7:38920457-38920479 CCTGTCATTCTGTGCAGATAAGT 0: 1
1: 0
2: 1
3: 6
4: 167
Right 1023314402 7:38920473-38920495 GATAAGTGAAAAGAAGGATGGGG No data
1023314398_1023314405 16 Left 1023314398 7:38920457-38920479 CCTGTCATTCTGTGCAGATAAGT 0: 1
1: 0
2: 1
3: 6
4: 167
Right 1023314405 7:38920496-38920518 AAAGGCTTTTTGATAAGATTGGG 0: 1
1: 0
2: 2
3: 38
4: 386
1023314398_1023314403 -2 Left 1023314398 7:38920457-38920479 CCTGTCATTCTGTGCAGATAAGT 0: 1
1: 0
2: 1
3: 6
4: 167
Right 1023314403 7:38920478-38920500 GTGAAAAGAAGGATGGGGAAAGG No data
1023314398_1023314400 -9 Left 1023314398 7:38920457-38920479 CCTGTCATTCTGTGCAGATAAGT 0: 1
1: 0
2: 1
3: 6
4: 167
Right 1023314400 7:38920471-38920493 CAGATAAGTGAAAAGAAGGATGG 0: 1
1: 0
2: 5
3: 85
4: 827
1023314398_1023314406 21 Left 1023314398 7:38920457-38920479 CCTGTCATTCTGTGCAGATAAGT 0: 1
1: 0
2: 1
3: 6
4: 167
Right 1023314406 7:38920501-38920523 CTTTTTGATAAGATTGGGCATGG 0: 1
1: 0
2: 0
3: 16
4: 187
1023314398_1023314404 15 Left 1023314398 7:38920457-38920479 CCTGTCATTCTGTGCAGATAAGT 0: 1
1: 0
2: 1
3: 6
4: 167
Right 1023314404 7:38920495-38920517 GAAAGGCTTTTTGATAAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023314398 Original CRISPR ACTTATCTGCACAGAATGAC AGG (reversed) Intronic
903226733 1:21898118-21898140 AGTCATCTTCACAGAGTGACTGG - Intronic
904421284 1:30395927-30395949 ACTTATCTGCAAAGAATGCTGGG + Intergenic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
908658619 1:66414538-66414560 ACTTTTGTTCTCAGAATGACCGG + Intergenic
910017792 1:82548511-82548533 AGTTAGCTGCACAGCATGAAGGG + Intergenic
911366114 1:96939545-96939567 TTTTATCTGCACAAAATGAATGG + Intergenic
911981900 1:104579264-104579286 AGTTATCTGCAAAGTATGGCAGG + Intergenic
912468542 1:109890779-109890801 AATTATCTACACAGAGTGGCTGG - Intergenic
913038174 1:114995197-114995219 AATTATCTGAATACAATGACAGG - Exonic
913931930 1:124980468-124980490 AATTATCTTCACAGAAAAACTGG + Intergenic
915906914 1:159885571-159885593 CCTTTTCTGCACAAAATGAAGGG + Intronic
918548681 1:185714711-185714733 ACTTATTTTCACAGATTCACTGG + Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
1063248233 10:4246225-4246247 ACTTATCTGCAGATATTGATGGG - Intergenic
1063823119 10:9860709-9860731 AAAGATCTGCACAGGATGACTGG - Intergenic
1063958663 10:11288084-11288106 ACTTATCTCTACAGCATGGCAGG + Intronic
1065217253 10:23460959-23460981 ACTTATCTGCATAATAAGACAGG - Intergenic
1067534821 10:47101323-47101345 ACTTACCCTCACAAAATGACTGG - Intergenic
1069245911 10:66205794-66205816 ACTCAGCTACACATAATGACAGG - Intronic
1074767537 10:116710684-116710706 ACTGATCTGCACAGAAGGTATGG + Intronic
1076621459 10:131791613-131791635 AATTATCTGCAAAGACTGAACGG + Intergenic
1080262487 11:30364653-30364675 ACTTGTTTGCACAGAGGGACAGG + Intergenic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1090911297 11:131121918-131121940 TCTAATCTTCACAGAATAACAGG + Intergenic
1095844994 12:46734966-46734988 AATTCTCTGCACAGGATGAGAGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099821351 12:87715107-87715129 AGTCATCTGCAAAGAATGGCAGG + Intergenic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101816015 12:108146756-108146778 CCCTTTCTGCACAGACTGACAGG + Intronic
1105033330 12:132900520-132900542 AATTATCTGCAGACAATGTCAGG + Intronic
1105614710 13:22001264-22001286 ACTCATCTGGGCAGAATGGCAGG - Intergenic
1106320319 13:28631645-28631667 ACTTCTCGGCACAAAATGATGGG - Intergenic
1107093429 13:36509148-36509170 ACTTCTCTGCACCGTAAGACTGG + Intergenic
1107839393 13:44440237-44440259 CCTTATCTCCACAGAAAGGCTGG + Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108279401 13:48846353-48846375 ACTCATCTGCACAGATTTCCCGG + Intergenic
1110356326 13:74571929-74571951 AATTTTCTGCAGAGAATGCCAGG - Intergenic
1111122727 13:83876283-83876305 AGTTATCTCCACTGAATGAAGGG + Intergenic
1112371067 13:98793898-98793920 ACATATATGTACAGAATGCCAGG + Exonic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1118149359 14:63173119-63173141 ACTTCTCTGCACAAACTGGCTGG + Intergenic
1119758760 14:77137050-77137072 TCTCATCTGCACAGGAGGACAGG - Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120252202 14:82071496-82071518 ACAGATCTGCAGAGAATGACAGG - Intergenic
1120601472 14:86515503-86515525 ACTTAGCTGTAAAGAATGATTGG + Intergenic
1127886794 15:63208624-63208646 ACTGCTCTGCCCAGAATGGCAGG + Intronic
1129019639 15:72504602-72504624 CTTTATCTGCACAGGATGAGGGG + Intronic
1131747195 15:95461628-95461650 ACATTTCTACACAGAATGAGAGG - Intergenic
1134182926 16:12062033-12062055 ACTTTTCTGCACAGGGTGGCAGG - Intronic
1134800845 16:17083181-17083203 CCTGATCAGCACAGAAAGACAGG - Intergenic
1139331630 16:66196852-66196874 GCTTATCTCCCCAGATTGACAGG + Intergenic
1141782269 16:86170851-86170873 ACTTCTCAGCACACCATGACAGG - Intergenic
1144204738 17:12972140-12972162 ACGTATCTGCACAGAGAGATAGG - Intronic
1147466139 17:40612743-40612765 ACTCACTTGCACAGAATGAGGGG - Intergenic
1155669885 18:28357192-28357214 AGTTATCTATACAGAAAGACAGG - Intergenic
1157027794 18:43867340-43867362 ACTTATCTGCATAGAATACTAGG - Intergenic
1157774789 18:50384229-50384251 ACTTAACTACACATAATAACAGG + Intronic
1158980407 18:62755192-62755214 ACGTATCTGCACAGAATGAAAGG - Intronic
1159375425 18:67586302-67586324 ACTTATCTGGTGAGAATGGCTGG - Intergenic
1163522855 19:17802209-17802231 ACTTATCTTGACTGAATCACGGG + Intronic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
925633922 2:5924041-5924063 ACTTATCTCAACAAACTGACTGG - Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
928092124 2:28381420-28381442 ACTTACCTGCACAAGAAGACAGG - Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933273525 2:80259331-80259353 ACGGAACTGCACAGAATAACTGG + Intronic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
942321943 2:174743517-174743539 ACTTATCTGCAGATGATGGCAGG - Intergenic
944899892 2:204203479-204203501 AGTCATGTGGACAGAATGACAGG + Intergenic
945567079 2:211414044-211414066 CCTTATCTGCACAAAATATCTGG + Intronic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
946739773 2:222790124-222790146 ACTGATCTCCACAGAGGGACTGG - Intergenic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1172794438 20:37527396-37527418 ACTGATGGGGACAGAATGACAGG + Intronic
952156683 3:30650845-30650867 TTTTAGCTGCACAGAATTACTGG - Intronic
953321489 3:41976365-41976387 AATTATCCGCAGAGAATGAGGGG + Intergenic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
955126890 3:56121577-56121599 ATTTAACTGCACAGAATGCCTGG - Intronic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
961392826 3:126565815-126565837 CCATATCTGCACAAAATGAATGG - Intergenic
961491840 3:127261868-127261890 ACTTGTATGCACAGAATAATAGG - Intergenic
964021344 3:152016076-152016098 TATTATCTGCAAATAATGACAGG + Intergenic
964363156 3:155919775-155919797 AATTCTCTGCACAGAATAAGTGG - Intronic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965762253 3:172092171-172092193 ACAGAGCAGCACAGAATGACAGG + Intronic
967763111 3:193247273-193247295 CCTTATCTGCACAAAATATCTGG - Intronic
970338219 4:15075253-15075275 ACATATCTGGCCAGAATGATTGG + Intergenic
970711458 4:18868459-18868481 TCTTATTTGCAAAGAATGTCTGG + Intergenic
970941614 4:21640944-21640966 AGTTATCTGCAGAGAGTGGCAGG - Intronic
971416492 4:26436591-26436613 GCTCACCTGCACTGAATGACAGG - Intergenic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
972727723 4:41760115-41760137 CCCTATGTGCACAGAGTGACTGG + Intergenic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
981115815 4:140989950-140989972 ACTTACCTGCATAAAAAGACTGG + Intronic
982354484 4:154451268-154451290 AGTTGTCTGCAGAGAATGGCAGG - Intronic
983339033 4:166434439-166434461 AGTTATCTGCAGAGAATGGAAGG - Intergenic
986453832 5:7894736-7894758 ACATATATCCACAGAATGATGGG - Intronic
988278907 5:29119046-29119068 ACTTATGTACACAGAATCAAAGG - Intergenic
988992795 5:36688003-36688025 ACTTTTATGCACAGAATGCTTGG - Exonic
989453711 5:41617176-41617198 ACCTCTGTGCTCAGAATGACTGG + Intergenic
990817245 5:59799265-59799287 AGTTAACTGCAGAGAATGACTGG + Intronic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
994316298 5:98337435-98337457 ACTTATCACCACAGAATGATAGG + Intergenic
995328621 5:110920730-110920752 AATTATCTGGACTGAATGAATGG - Intergenic
996616999 5:125453946-125453968 AATTATTTGCGTAGAATGACTGG - Intergenic
1000565172 5:162837488-162837510 AATTATCTACACACAATGAGGGG + Intergenic
1000621622 5:163492964-163492986 AGTTATCTGCATAGGATAACAGG + Intergenic
1007302343 6:40876716-40876738 ACATACCTGCACAGAAAGAATGG - Intergenic
1008050754 6:46898378-46898400 ACTTTTCTGCACTCTATGACAGG - Intronic
1008792391 6:55252566-55252588 ACTTATTTGCAGAGAAGGAATGG + Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011161712 6:84398037-84398059 AATAACCTGCACAGAATGTCTGG + Intergenic
1012181345 6:96156649-96156671 CCTTATCTGCACAAAATATCTGG + Intronic
1015558071 6:134483227-134483249 ACTTATCTGGCCAGGAAGACGGG - Intergenic
1021003564 7:15364360-15364382 ACTTATGTGCACTGTATGGCAGG + Intronic
1021289100 7:18821647-18821669 AATTATCTGCAGACACTGACTGG + Intronic
1023314398 7:38920457-38920479 ACTTATCTGCACAGAATGACAGG - Intronic
1027673385 7:81129655-81129677 ACTTATCTGCACAGGAAGATGGG + Intergenic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028216499 7:88139867-88139889 ACTAATATACACTGAATGACAGG - Intronic
1028759295 7:94477292-94477314 ACTTATCTACACAGACAGAATGG + Intergenic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1033235128 7:139632082-139632104 ACTAATCTTCAGAGAATGCCTGG + Intronic
1033362506 7:140647764-140647786 ACTTCTGTGCACAGGATGAAAGG + Intronic
1035410758 7:158638635-158638657 ACTTATATGCACCTAATAACAGG + Intronic
1040586260 8:48745293-48745315 ACTGATCTGTAAAAAATGACAGG - Intergenic
1040609660 8:48970782-48970804 ACTTCTCTCCACAGAAAGGCTGG + Intergenic
1040748794 8:50680182-50680204 AGCTATCTGCACTGCATGACTGG - Intronic
1040857289 8:51961303-51961325 AGTTCCCTGCACAGAGTGACAGG + Intergenic
1041691333 8:60690864-60690886 ACTGAGCTGCAGAAAATGACAGG - Intronic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1046643766 8:116762624-116762646 ACCTAACTGCACAGAATGCTGGG + Intronic
1048861274 8:138725977-138725999 ACTGATCTCCATAGAATCACGGG - Intronic
1050548124 9:6726420-6726442 ACTTAGCTGGCCAGAAGGACAGG - Intronic
1050598991 9:7231718-7231740 GCTTACCTGCACAGAGTGGCGGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1053660775 9:40275965-40275987 CCTTATCTGCACATAACGTCTGG + Intronic
1053715923 9:40886729-40886751 ACTTATCTTCACATAAAAACTGG + Intergenic
1054076619 9:60544060-60544082 ACTTATCTTCACATAAAAACTGG - Intergenic
1054372897 9:64422181-64422203 CCTTATCTGCACATAACGTCTGG + Intergenic
1054523835 9:66100319-66100341 CCTTATCTGCACATAACGTCTGG - Intergenic
1054680527 9:67911958-67911980 CCTTATCTGCACATAACGTCTGG + Intergenic
1057004945 9:91548846-91548868 AATTATCTGCAGAGGATGAGAGG + Intergenic
1059893366 9:118831640-118831662 AGTTATCTGTGCAGGATGACAGG - Intergenic
1187726744 X:22211190-22211212 ACTCATCTGCACTCAATGTCAGG + Intronic
1188960051 X:36479888-36479910 ACATTTCTACACTGAATGACAGG + Intergenic
1190255269 X:48757773-48757795 AGTTATCTGCAGAGAATAGCAGG - Intergenic
1191275346 X:58539222-58539244 CTTTATCTTCACAGAAAGACGGG - Intergenic
1191411165 X:60405449-60405471 CTTTATCTTCACAGAAAGACGGG + Intergenic
1191631292 X:63324848-63324870 ATTTATCTTCAGATAATGACAGG - Intergenic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1192563948 X:72147104-72147126 ACAGATCTGCTCAGACTGACAGG - Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1194155338 X:90380963-90380985 AGTCATCTTCAGAGAATGACAGG + Intergenic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1194521079 X:94919407-94919429 AGTTATCTGCAAAAGATGACAGG - Intergenic
1195700795 X:107704192-107704214 ACTTATTTAGACAGAGTGACGGG + Intergenic
1196692318 X:118573633-118573655 GCTTATCTGCACAGAAGAAAGGG - Intronic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197477361 X:126941361-126941383 AGTTATCTGCATAAGATGACAGG + Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198945371 X:142006590-142006612 ACTTAGCTGAGCAGAAGGACAGG + Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1201595313 Y:15661550-15661572 ACTTATCTGCACCAAATGGTTGG - Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1201888317 Y:18912234-18912256 AGTCATCTCTACAGAATGACAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic