ID: 1023315206

View in Genome Browser
Species Human (GRCh38)
Location 7:38929210-38929232
Sequence TTGTCAATGGGGACAGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 249}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023315206_1023315215 0 Left 1023315206 7:38929210-38929232 CCTCCCCCTGTCCCCATTGACAA 0: 1
1: 0
2: 1
3: 21
4: 249
Right 1023315215 7:38929233-38929255 AATCCAACAGAAGTGTGGCGCGG No data
1023315206_1023315216 1 Left 1023315206 7:38929210-38929232 CCTCCCCCTGTCCCCATTGACAA 0: 1
1: 0
2: 1
3: 21
4: 249
Right 1023315216 7:38929234-38929256 ATCCAACAGAAGTGTGGCGCGGG 0: 1
1: 0
2: 0
3: 2
4: 44
1023315206_1023315218 17 Left 1023315206 7:38929210-38929232 CCTCCCCCTGTCCCCATTGACAA 0: 1
1: 0
2: 1
3: 21
4: 249
Right 1023315218 7:38929250-38929272 GCGCGGGTCCCATCTGCTGCAGG 0: 1
1: 0
2: 0
3: 7
4: 97
1023315206_1023315214 -5 Left 1023315206 7:38929210-38929232 CCTCCCCCTGTCCCCATTGACAA 0: 1
1: 0
2: 1
3: 21
4: 249
Right 1023315214 7:38929228-38929250 GACAAAATCCAACAGAAGTGTGG No data
1023315206_1023315221 29 Left 1023315206 7:38929210-38929232 CCTCCCCCTGTCCCCATTGACAA 0: 1
1: 0
2: 1
3: 21
4: 249
Right 1023315221 7:38929262-38929284 TCTGCTGCAGGTGCTCTTCACGG No data
1023315206_1023315222 30 Left 1023315206 7:38929210-38929232 CCTCCCCCTGTCCCCATTGACAA 0: 1
1: 0
2: 1
3: 21
4: 249
Right 1023315222 7:38929263-38929285 CTGCTGCAGGTGCTCTTCACGGG 0: 1
1: 0
2: 2
3: 20
4: 228

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023315206 Original CRISPR TTGTCAATGGGGACAGGGGG AGG (reversed) Intronic
901901609 1:12368559-12368581 TTGTCAATTCGGAAAGGAGGAGG - Exonic
902063049 1:13661310-13661332 TTGTCAAGGGGACCAGGTGGAGG + Intergenic
902304239 1:15524702-15524724 TTGACCCTGGGGACAGGGCGAGG - Intronic
903460306 1:23516303-23516325 TTGTCCAGAGGGACAGGAGGTGG - Intronic
905806550 1:40881516-40881538 TTGTCACTGGGAGCAGGGAGAGG - Intergenic
906212432 1:44019642-44019664 CTGGCCATGGGGACAGGAGGCGG + Intronic
906703520 1:47877194-47877216 TTGGCAATGGGGCTGGGGGGTGG + Intronic
907152075 1:52298319-52298341 TTGTATATGGGGAGAGGTGGGGG + Intronic
907520590 1:55020954-55020976 GTGTCAGTGGGGACAGGGGATGG - Intergenic
908695209 1:66832133-66832155 TTCTCAATGTGGGCAGGGAGGGG - Intronic
909866603 1:80681168-80681190 TTGTCAATGGGAAGAGGAGGGGG - Intergenic
915288479 1:154867734-154867756 TTGTCATTTGGGGCAGGGGGTGG - Intronic
916206510 1:162320518-162320540 TTGGCAATGTGGGGAGGGGGTGG - Intronic
919919980 1:202161850-202161872 TTGGCAGTGGGGACAGGGGCTGG + Intergenic
920810924 1:209284848-209284870 TTGCCCATGGGTAGAGGGGGTGG + Intergenic
922362285 1:224834126-224834148 TTGTCCAGGGGCACAGGAGGAGG - Intergenic
922888608 1:229042108-229042130 GTGTCCATGGGGACAGGCTGAGG + Intergenic
923745443 1:236695565-236695587 TTTTCAATCTGGGCAGGGGGGGG - Intronic
923804982 1:237247867-237247889 TTGACAATAGGGAGAGGGTGAGG + Intronic
1064070908 10:12227268-12227290 TAGACCATGGGGAGAGGGGGAGG + Intronic
1066534973 10:36381368-36381390 TTGTCATCGGGGAAAGGAGGGGG + Intergenic
1066642700 10:37571882-37571904 TTGTCATCGGGGAAAGGAGGGGG + Intergenic
1070589552 10:77792036-77792058 TTGACAGAGGGGACAGGGGCTGG + Exonic
1071522693 10:86340946-86340968 CTGTCAAGGGGGACAGGGTTGGG - Intronic
1074955687 10:118386648-118386670 TAATCAATGGGGACAGAGGAAGG - Intergenic
1075714311 10:124547456-124547478 TGGACACTGGGGGCAGGGGGTGG - Intronic
1077916880 11:6617217-6617239 ATGCCATTGGGGACTGGGGGTGG - Intronic
1078369763 11:10735236-10735258 TGGACAATGGGGACTGGTGGGGG - Intergenic
1079007810 11:16804399-16804421 TTGTCAGTGTGGATTGGGGGTGG + Intronic
1079105800 11:17571568-17571590 TTGCCCATGGAGAAAGGGGGAGG + Intronic
1080204123 11:29709400-29709422 TTGTGTATGAGGACAGTGGGAGG - Intergenic
1080844542 11:36015315-36015337 CAGGCAATGGGGGCAGGGGGCGG - Intronic
1082636672 11:55603574-55603596 TTGTCCATGGGGAAAGTGGTCGG + Exonic
1082942842 11:58726406-58726428 GGTTCAAGGGGGACAGGGGGAGG + Intronic
1083172657 11:60932045-60932067 TTGTCACTGTGGACGGCGGGGGG + Exonic
1085826481 11:79853167-79853189 TTATCAGAGGAGACAGGGGGAGG + Intergenic
1087499148 11:98929194-98929216 TGCTCAATGGGGGCTGGGGGTGG - Intergenic
1088921239 11:114261059-114261081 TTATCAATGGGGACAGGCTCTGG + Intronic
1089984971 11:122804147-122804169 TTGTCACTGTGGGCAGGGGATGG + Intronic
1090202900 11:124868785-124868807 TTGACCCTGGGGACAGGGGGTGG - Exonic
1090506121 11:127317270-127317292 TTGGGAATGGAGACAGGGGTTGG + Intergenic
1091446777 12:548275-548297 TTGTGAAGAGGGACAGGGAGAGG - Exonic
1091472209 12:738886-738908 TTGACAATGGGGAAAAGGTGGGG - Intergenic
1092736156 12:11585023-11585045 TGGGCAATGGGGACAGAGGCAGG + Intergenic
1100210655 12:92395224-92395246 TGTTCAATAGGGACAGAGGGAGG - Intergenic
1100522214 12:95385953-95385975 TTATCAAAGAAGACAGGGGGAGG + Intergenic
1103926379 12:124425726-124425748 TTGTGAATGGGGCCAGGGAGGGG - Intronic
1104484141 12:129135018-129135040 TTGTTGCTGGGGACAGGTGGAGG + Intronic
1104536343 12:129621385-129621407 GTGGCAGTGGGGGCAGGGGGAGG - Intronic
1105804789 13:23946643-23946665 TTGACATTGGGGACAGAGAGGGG - Intergenic
1105899820 13:24744867-24744889 TTGTTAATGGGGACCAAGGGTGG + Intergenic
1106837815 13:33654913-33654935 TTGTCAATGGCCACAGGGCCAGG - Intergenic
1111860830 13:93703632-93703654 TTGTTAACGGGGGCGGGGGGTGG - Intronic
1113776932 13:112953285-112953307 TTGTCCATGGGGGCTGGAGGAGG - Intronic
1114191686 14:20443943-20443965 TTGGCAATGGGGAAAGGAGAAGG + Intergenic
1117905011 14:60575752-60575774 TGGTCAATGGGGAGAGGCAGAGG - Intergenic
1117988793 14:61414105-61414127 ATGTGAATGGGGACAGCGGCGGG - Intronic
1118678183 14:68211333-68211355 GTTTCAATGGGGAAAGCGGGTGG - Intronic
1119422901 14:74518113-74518135 TTGACTGTGGGGACAGGGGATGG - Intronic
1121010243 14:90516087-90516109 TTGTCAGTGGGGACGAGGTGGGG + Intergenic
1121793523 14:96717297-96717319 TTGTCAGTGGGGTTGGGGGGGGG - Intergenic
1121839053 14:97117705-97117727 TTGACAATGGGTACAGGGCTGGG - Intergenic
1121876685 14:97459174-97459196 TTGTGAAGGGGGAGAGGTGGGGG + Intergenic
1123825902 15:24081910-24081932 TTGTTTCTGGGGACAGGTGGTGG - Intergenic
1126815795 15:52452120-52452142 TTTTCAGTGGGGGGAGGGGGTGG - Intronic
1127354663 15:58186735-58186757 TTGTAAATGGGGGTAGGGGTGGG - Intronic
1129116552 15:73368263-73368285 TTGTCCATGGCGCCAGGGGCCGG + Exonic
1129168046 15:73790292-73790314 CTGTAAATGAGGACAAGGGGAGG + Intergenic
1129903650 15:79170875-79170897 TTGCCAGTGGGGAGAGGGGTTGG + Intergenic
1130985442 15:88841923-88841945 GTGTCAGTGGGGAGATGGGGAGG - Intronic
1132071670 15:98783104-98783126 TTTTTAATGGGGGCAGGGGGAGG - Intronic
1132236963 15:100229279-100229301 CTGTCAATGTGGGGAGGGGGTGG - Intronic
1132404790 15:101535748-101535770 TGGTCAATGGGGAGAGGAGGAGG + Intergenic
1134557147 16:15175084-15175106 TTGTTGTTGGGGACAGGGGCAGG - Intergenic
1134759340 16:16699784-16699806 TTGTCAATGTGGGCAGGGGAAGG + Intergenic
1134917725 16:18086795-18086817 TTGTTGTTGGGGACAGGGGCAGG - Intergenic
1134986734 16:18659413-18659435 TTGTCAATGTGGGCAGGGGAAGG - Intergenic
1135394443 16:22120604-22120626 TTGTCAATGTGGCCACAGGGTGG + Intronic
1136932608 16:34432688-34432710 TTCTCAATGGGAAGAGAGGGCGG - Intergenic
1136971964 16:34979126-34979148 TTCTCAATGGGAAGAGAGGGCGG + Intergenic
1138104524 16:54280691-54280713 TTATCAGTGGGGACAGAAGGTGG + Intergenic
1139349353 16:66325578-66325600 ATGTAAATGAGGACATGGGGTGG - Intergenic
1140280215 16:73546944-73546966 TTAACAATGGGGACAGGGGTAGG - Intergenic
1140377728 16:74458397-74458419 TTCTCAATCGGGACTGGGGGTGG + Intronic
1143305123 17:5940488-5940510 TTGTCAAAGGGGAGAGAGGATGG + Intronic
1144442458 17:15295639-15295661 TTGGCAGGGGGGACAGGAGGAGG + Intergenic
1146587014 17:34091164-34091186 TTGGCAATGTGGACAAGGGCTGG - Intronic
1146591049 17:34128272-34128294 TTCTCAATAGGGACAAGGTGTGG - Intronic
1147560604 17:41506662-41506684 TTGTCTATGGGGACAGAAGTTGG - Intergenic
1147781275 17:42944201-42944223 TTGTCAAAGGAGGCTGGGGGAGG - Intergenic
1147914863 17:43880139-43880161 GTGCCAATGGGGAGAGTGGGGGG - Intronic
1149513859 17:57265057-57265079 TTGGGAATTGGGACAGGGTGGGG + Intronic
1150646087 17:66978374-66978396 TGGTACATGGGGACAGGGGAGGG + Intronic
1151593061 17:75059363-75059385 TTGTAAAAGGGGATAGTGGGTGG + Intronic
1151664570 17:75538176-75538198 TAGTGAATGGGGCCAGGGTGGGG + Intronic
1152268248 17:79308742-79308764 TTGTCACTGGGGGTTGGGGGTGG - Intronic
1152467578 17:80474801-80474823 TTGTAAAAGGGGAGGGGGGGGGG - Intronic
1152645772 17:81467902-81467924 TGGTTAATGGGGGCGGGGGGAGG + Intergenic
1158572747 18:58610771-58610793 TTTTTAATAGGGACGGGGGGAGG - Intronic
1159877216 18:73826609-73826631 TTGTCCATGAGGACAGTGGAAGG + Intergenic
1161006404 19:1939298-1939320 ATGTCATTGGGGACAGCTGGTGG - Intergenic
1161089937 19:2354648-2354670 TTGTACATGGGGACGGGGTGGGG + Intronic
1161574599 19:5048588-5048610 TTGTAAGCGGGGAGAGGGGGGGG + Intronic
1162435079 19:10653509-10653531 CTGTCAATGGGGGAAGGGGAAGG + Intergenic
1162571678 19:11478118-11478140 TTGTCCAGGGTGACAGGAGGAGG + Intronic
1162577680 19:11508190-11508212 TTGCCAAATGGGACAGAGGGAGG - Intronic
1163578897 19:18126460-18126482 CTTTCAATGGGGACAGTGGCAGG - Intronic
1164454033 19:28392173-28392195 AAGTCAAGGGGAACAGGGGGTGG + Intergenic
1166047241 19:40236633-40236655 TTCACAATGGGGACGGTGGGTGG - Intronic
1166644132 19:44518736-44518758 GTGTCAATGGGGTCAGGATGGGG - Intronic
1166803800 19:45473240-45473262 GTGACTTTGGGGACAGGGGGTGG + Exonic
1166823123 19:45592608-45592630 ATTTCAATGGGGGCAGGGGAGGG + Exonic
1166855070 19:45779306-45779328 TGGTGAATGGGGACCGGCGGTGG - Exonic
1166904255 19:46094676-46094698 CTGTCAGTGGGGGCAGGGGAGGG - Intergenic
1166997645 19:46727411-46727433 ATGCCAATGGGGACAGTGTGGGG + Intronic
1167470266 19:49671870-49671892 TTGTCAATGGGGACCTGGGAAGG - Intronic
926745602 2:16154543-16154565 ATGGAAATGGGGACAGAGGGTGG - Intergenic
927740679 2:25566780-25566802 ATTTCAATGGAGACAGGGGGTGG + Intronic
928453856 2:31401770-31401792 TTCTCTGTGGGGAAAGGGGGAGG + Intronic
929123417 2:38501860-38501882 TTGTCTGTTGGGACAGGGGCTGG - Intergenic
930248771 2:49012090-49012112 TTGTCAGTGGGGCATGGGGGTGG + Intronic
930604557 2:53479979-53480001 TTGCCAAGGGGGCCAGGAGGAGG + Intergenic
931258831 2:60599117-60599139 TTGACAATTTGGACAGGGTGTGG - Intergenic
931288367 2:60851141-60851163 TTGCCAATGGGGATGTGGGGTGG - Intergenic
932606940 2:73171732-73171754 TTGGAAATGGGGACAGGAGCTGG + Intergenic
933925488 2:87088679-87088701 TTGGAAATGGGGACAGGAGCTGG - Intergenic
934503842 2:94877323-94877345 CTGTCATTGGGGACAGAGAGGGG - Intergenic
934636918 2:95998166-95998188 CTGTCAATGGGGTGAGGGGAGGG - Intergenic
934796733 2:97107255-97107277 CTGTCAATGGGGTGAGGGGAGGG + Intergenic
934836686 2:97596176-97596198 CTGTCAATGGGGTGAGGGGAGGG - Intergenic
935421357 2:102872245-102872267 TTGTCAGAAGGGACAGGGGAAGG - Intergenic
936997811 2:118433801-118433823 CTGGCAATGGGTGCAGGGGGTGG + Intergenic
937128572 2:119490000-119490022 TTGTCCTTGGGGACAGGAGGTGG + Intronic
937698321 2:124834570-124834592 ATGGCAATGGAGACAGGGGCTGG + Intronic
938689702 2:133776255-133776277 ATGTCAGTGGGGACAGGGCAAGG + Intergenic
938691554 2:133794617-133794639 TTGCCAGTGGGGAATGGGGGAGG - Intergenic
939385373 2:141489139-141489161 TTGTGAGTGGGGACTGGGTGGGG + Intronic
939529290 2:143337060-143337082 TGGTCAAGGAGGACAGAGGGAGG + Intronic
943697533 2:190952183-190952205 TTCTTAATGGGGAATGGGGGTGG - Intronic
943830644 2:192456417-192456439 TAGTTACTGGGGACAGGGGATGG + Intergenic
945871295 2:215229454-215229476 TTGCTAATGGGGACACAGGGAGG - Intergenic
946362517 2:219228030-219228052 TGGTCAAGGTGGACAGGGGGCGG - Exonic
947705195 2:232269193-232269215 TTGGCAATGGGGGCAGTGTGGGG - Intronic
948380142 2:237545035-237545057 TGGTGAGTGGGGACAGTGGGTGG + Intronic
1171773411 20:29344947-29344969 TTGCCAATGGGGGAAGGGGTGGG - Intergenic
1172052665 20:32130764-32130786 TTGTCCATGGGGACCTGGAGTGG + Intronic
1173293049 20:41731237-41731259 ATGGGATTGGGGACAGGGGGAGG - Intergenic
1173627274 20:44482393-44482415 TTTTCAGTAGAGACAGGGGGTGG - Intronic
1173663090 20:44747448-44747470 GTGTCCATGTGGACAGGAGGGGG - Intronic
1174488332 20:50874962-50874984 TGGTCAAGGAGGACAGAGGGAGG - Intronic
1174547602 20:51337464-51337486 TTGTCACTGGGGGTAGGGTGGGG - Intergenic
1174810687 20:53642951-53642973 ATGTCACTAGGGACAGGGAGGGG - Intergenic
1175034102 20:55983533-55983555 TAGTCACTGGGGGCAGGGCGTGG + Intergenic
1175378943 20:58549293-58549315 TTGTCCATGGGGACAAGTGAGGG - Intergenic
1175544672 20:59770731-59770753 TTCTCCATGGGGGCAGGGTGGGG - Intronic
1175672746 20:60920121-60920143 TTCTCAATGGGGACATGGTGGGG + Intergenic
1179396965 21:41049357-41049379 TTGTGAATGGGGATATGGGTTGG - Intergenic
1180011511 21:45054418-45054440 GTATCCATGGGGACATGGGGAGG + Intergenic
1180318899 22:11303075-11303097 TTGCCAATGGGGGAAGGGGTGGG - Intergenic
1182086538 22:27565014-27565036 CTGTCAATGGGCACAGGGCATGG - Intergenic
1182174974 22:28275833-28275855 TTGTCAATGGGCATGTGGGGTGG + Intronic
1183802392 22:40177843-40177865 TTGTCAATCAGGAAAGGGGAGGG - Intronic
1184332200 22:43834094-43834116 TTGCTAGTGGGGACAGGGTGGGG + Intronic
953749797 3:45600530-45600552 GAGGCAACGGGGACAGGGGGTGG - Intronic
953970454 3:47343370-47343392 TGGTGTATGGGGACAGGGAGAGG - Intronic
954445043 3:50541980-50542002 TTGTGAATGGGGACAAGATGGGG + Intergenic
954689472 3:52388111-52388133 TTCTCAAGGGTGACAGGGGAAGG - Intronic
954770078 3:52959120-52959142 CTGTCAAGGGGGACGGGGGAGGG + Intronic
955351506 3:58196759-58196781 CCTTCAATGGGGACAGAGGGGGG - Intronic
956056124 3:65300857-65300879 TTGCCACTGGGGTCTGGGGGAGG - Intergenic
956162784 3:66372524-66372546 CTGACAATGGGGACAGGGACAGG - Intronic
956773968 3:72549857-72549879 CTGGCACTGGGGACAGGGGCAGG - Intergenic
961227516 3:125265620-125265642 TTATCAATGGATAGAGGGGGAGG - Intronic
961720938 3:128895638-128895660 GAGGCAATGGGGACAGGAGGTGG - Intronic
963305973 3:143653394-143653416 TTGCCAAGGGGGAAAGAGGGAGG + Intronic
963904946 3:150765622-150765644 GTGTCAATGGGGCAAGGGTGAGG - Intergenic
964824040 3:160805987-160806009 ATGTCACAGGGGGCAGGGGGTGG - Intronic
965845766 3:172959436-172959458 TTCTCAGTGGGGAGAGAGGGAGG - Intronic
965943253 3:174210469-174210491 TTGGCAATGGTGGCAGGGGATGG + Intronic
966441927 3:179954892-179954914 TTGTAAGTGGGGTAAGGGGGAGG - Intronic
966835849 3:184048936-184048958 TTGTCAGTCAGAACAGGGGGTGG + Intergenic
967163476 3:186759746-186759768 TTGTGAATGGTGAGAAGGGGCGG - Intergenic
968317669 3:197737722-197737744 TTGACAATGTGGACAGGAGATGG + Intronic
969335819 4:6509648-6509670 TTGTGAATGGGCACAAGGGCAGG - Intronic
969920036 4:10529738-10529760 TTGTCAAAGGGGAGAGGAAGAGG + Intronic
970741544 4:19245074-19245096 TTGTGCATGGTGACAGGTGGAGG + Intergenic
973635962 4:52862253-52862275 TTGGCTGTGGGGAGAGGGGGCGG + Intergenic
973954486 4:56049330-56049352 CAGACAATGGGGACAGGGGCGGG + Intergenic
974758175 4:66240393-66240415 TTGTAAATGTGGACAGAGGCAGG - Intergenic
976517257 4:85982999-85983021 TTGTGAATGAGAACATGGGGTGG + Intronic
979303372 4:119113210-119113232 CTCTCAGTGGGGACAGTGGGGGG + Intergenic
979580879 4:122358386-122358408 ATTTCAATGGGAAAAGGGGGTGG + Intronic
980457814 4:133068836-133068858 TTGAGAATGGGGACACTGGGTGG + Intergenic
982087317 4:151848777-151848799 TTGAAAATGGGGTCAGGGTGGGG + Intergenic
983769955 4:171536822-171536844 CTGGCAAGGGGGAAAGGGGGAGG - Intergenic
986105331 5:4654596-4654618 TGGTCAATGGAGACAGAGAGAGG - Intergenic
990230411 5:53706911-53706933 TTGTCAATGGGGGCAGGAGGAGG - Intergenic
991005948 5:61828174-61828196 TTGCCAGAGGGGAAAGGGGGAGG - Intergenic
991407551 5:66316352-66316374 TTGTATATGGTGACAGGTGGGGG + Intergenic
993633645 5:90317943-90317965 CTGTCACTGGGGAAGGGGGGTGG + Intergenic
993849654 5:92990906-92990928 CTCTCAATGGGGACAAAGGGAGG + Intergenic
995693272 5:114851146-114851168 TTGTATATGGGGACAGATGGGGG - Intergenic
997420791 5:133765212-133765234 ATGCCAGTGGGGAGAGGGGGAGG + Intergenic
997752040 5:136356067-136356089 TTGTCAATGGGCTGAGGAGGAGG - Intronic
998191443 5:140028617-140028639 TTGGCCAGGGGGCCAGGGGGAGG + Intronic
998418854 5:141965415-141965437 GTGTCCCTGGGGACAGGGGGTGG + Intronic
998789686 5:145752704-145752726 TTGTAAATGGCGACAGGATGTGG - Intronic
999127020 5:149253262-149253284 TTGTGATGGGGGACAGGGGGAGG + Intronic
999363657 5:151006967-151006989 TAGCCCATGGGAACAGGGGGTGG + Intergenic
1000560106 5:162776782-162776804 TTGTCAAGGGAGACATCGGGTGG + Intergenic
1001435354 5:171695458-171695480 CTGTCAATGAGGGCAGGGGTGGG - Intergenic
1003476500 6:6488463-6488485 TTGTCATTGGGGCCTGGGGGTGG + Intergenic
1006140840 6:31928743-31928765 TTCTCAAAGGAGACAGGGGCTGG - Exonic
1006448597 6:34093058-34093080 TTGTCCAGGGAGACAGGGGTGGG + Intronic
1007152950 6:39712801-39712823 ATGTGGTTGGGGACAGGGGGAGG + Intronic
1008387422 6:50908215-50908237 TTTTCAATGGGCAGAGGTGGAGG - Intergenic
1010414901 6:75601935-75601957 CTGTCCATGTGGACAGGGGTGGG - Intronic
1010483694 6:76383423-76383445 TTGCCAGTGGGGATAGGGAGTGG + Intergenic
1012908081 6:105090574-105090596 TGCCCAATGGGGGCAGGGGGTGG + Intergenic
1015629353 6:135215823-135215845 TTGTCCATGGGAAGAGGGGATGG - Intronic
1018934935 6:168267799-168267821 CTGTCAGAGGGGACAGAGGGAGG - Intergenic
1019526588 7:1483183-1483205 CTGTCAGTGGGGGAAGGGGGCGG - Intronic
1020341367 7:7114681-7114703 TTGTTAGTGTGGAAAGGGGGAGG - Intergenic
1021206391 7:17786528-17786550 CTGTTAAGGGGGAGAGGGGGAGG - Intergenic
1023315206 7:38929210-38929232 TTGTCAATGGGGACAGGGGGAGG - Intronic
1023976893 7:45037161-45037183 TTGACAATGGCGGCGGGGGGTGG - Intronic
1026993741 7:74602666-74602688 CTGTCACTGGGGACAGGGTCAGG + Intergenic
1028612229 7:92724473-92724495 TTTTGACTGGGGGCAGGGGGTGG + Intronic
1029974037 7:104815890-104815912 TCTTCAAAGGGGAAAGGGGGAGG - Intronic
1030103252 7:105964971-105964993 TTGTCACTGGGGAAAGAGTGAGG + Intronic
1030747412 7:113184061-113184083 TTGTCAATGGGCAGAGTGAGTGG - Intergenic
1033796289 7:144849096-144849118 TTGTAAATGGTGAGAGGTGGGGG + Intergenic
1037929840 8:22872333-22872355 TTGGCAACGGGGACAGGGTCTGG - Intronic
1039857766 8:41431138-41431160 ATGTAATTGGGGACATGGGGTGG + Intergenic
1041171595 8:55147959-55147981 CTCTCAGTGGGGACAGGGGCTGG + Intronic
1042355477 8:67823249-67823271 ATGTCATTGGGGGTAGGGGGAGG - Intergenic
1043027823 8:75093138-75093160 CTGTCAAGGGGGACACAGGGAGG - Intergenic
1043254452 8:78116213-78116235 TTGTCATTGAGGACAGGAAGAGG + Intergenic
1044924085 8:97195132-97195154 TTGTTACTGGGGACAGGGGAGGG - Intergenic
1047247395 8:123157430-123157452 TTGACAAACGGGACAGGGGCAGG - Intergenic
1047766815 8:127996760-127996782 CTGGCCATGGGGACAGGGGTCGG + Intergenic
1049524328 8:143114105-143114127 TTCTCAATGGGAACAGGGTTAGG - Intergenic
1049744223 8:144256397-144256419 TGGCCAAGGGGGGCAGGGGGAGG - Intronic
1049815560 8:144597563-144597585 TTGAGGATGGGGGCAGGGGGCGG + Intronic
1050308760 9:4331914-4331936 TTGTCAACTGGTACAAGGGGTGG + Intronic
1050693334 9:8252817-8252839 GTGTCACTTGGGACAGGGGCAGG - Intergenic
1050902928 9:10967905-10967927 TAGCCAGGGGGGACAGGGGGTGG - Intergenic
1050968475 9:11838550-11838572 ATGTCACTGGAGGCAGGGGGCGG - Intergenic
1051120165 9:13744168-13744190 TTGCCAGGGGGGCCAGGGGGTGG + Intergenic
1053522337 9:38792685-38792707 TTCTCTGTGGGGACAGGAGGAGG + Intergenic
1054194564 9:62017105-62017127 TTCTCTGTGGGGACAGGAGGAGG + Intergenic
1054643844 9:67571585-67571607 TTCTCTGTGGGGACAGGAGGAGG - Intergenic
1054972624 9:71106304-71106326 TTGGAAATGGGGCCGGGGGGAGG + Intronic
1055249109 9:74281058-74281080 TTCTGAATGGGGGCAGGGTGAGG + Intergenic
1055611862 9:78031858-78031880 CTGGCAATCGGGGCAGGGGGTGG - Intergenic
1056214285 9:84393306-84393328 TTGTCAATCGGGGTAGGGGTGGG + Intergenic
1056658041 9:88524918-88524940 TTCTCAGAGGGGACAGGGGATGG + Intergenic
1057921852 9:99104669-99104691 CTGTGAATGGGGTCAGGGTGGGG + Intronic
1059189899 9:112315119-112315141 ATGTCAGTGGGGGCCGGGGGCGG - Intronic
1060900729 9:127255533-127255555 ATGTAAATGGGGTCAGGGAGAGG + Intronic
1062324290 9:136004917-136004939 TTGTCAGTTTGGACAGGAGGAGG - Intergenic
1203745382 Un_GL000218v1:38269-38291 CTGTCATTGGGGACAGAGAGGGG + Intergenic
1203564726 Un_KI270744v1:81215-81237 CTGTCATTGGGGACAGAGAGGGG - Intergenic
1185577002 X:1182469-1182491 TTGTCAATGACAACAGGGAGAGG - Intergenic
1186480745 X:9894860-9894882 CTGTCACTGCGGAGAGGGGGAGG - Exonic
1187677328 X:21729519-21729541 TTCTCAATGGGGGGAGGGTGTGG - Intronic
1188215579 X:27472539-27472561 CTGTCAGTGGGGAAAAGGGGAGG - Intergenic
1190380049 X:49830077-49830099 TTCTCAGTGGGGACCTGGGGAGG + Intronic
1190578616 X:51868494-51868516 GTGTCAATGGGGACAGTGTAAGG + Intronic
1190732386 X:53234407-53234429 GTGACAATGGTGACTGGGGGTGG + Exonic
1191078614 X:56485044-56485066 TTGTCAGTGGGGGCTGGGCGTGG + Intergenic
1193619394 X:83732693-83732715 TTGTCAGTGGTGGCAGTGGGTGG + Intergenic