ID: 1023315910

View in Genome Browser
Species Human (GRCh38)
Location 7:38936190-38936212
Sequence CAGGATCTAGCTGGGTGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023315910_1023315916 17 Left 1023315910 7:38936190-38936212 CCACTGCACCCAGCTAGATCCTG No data
Right 1023315916 7:38936230-38936252 TATGCACCCAGAAGTGAAATTGG No data
1023315910_1023315913 -7 Left 1023315910 7:38936190-38936212 CCACTGCACCCAGCTAGATCCTG No data
Right 1023315913 7:38936206-38936228 GATCCTGCTCTCAATTCTTTTGG No data
1023315910_1023315914 -6 Left 1023315910 7:38936190-38936212 CCACTGCACCCAGCTAGATCCTG No data
Right 1023315914 7:38936207-38936229 ATCCTGCTCTCAATTCTTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023315910 Original CRISPR CAGGATCTAGCTGGGTGCAG TGG (reversed) Intergenic
No off target data available for this crispr