ID: 1023317461

View in Genome Browser
Species Human (GRCh38)
Location 7:38954491-38954513
Sequence TTTAGACAGAGTTTTGGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023317461_1023317469 3 Left 1023317461 7:38954491-38954513 CCCTAGCCAAAACTCTGTCTAAA No data
Right 1023317469 7:38954517-38954539 GAATTTGAGGTTGGTGTTATTGG No data
1023317461_1023317468 -6 Left 1023317461 7:38954491-38954513 CCCTAGCCAAAACTCTGTCTAAA No data
Right 1023317468 7:38954508-38954530 TCTAAAGGGGAATTTGAGGTTGG No data
1023317461_1023317467 -10 Left 1023317461 7:38954491-38954513 CCCTAGCCAAAACTCTGTCTAAA No data
Right 1023317467 7:38954504-38954526 TCTGTCTAAAGGGGAATTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023317461 Original CRISPR TTTAGACAGAGTTTTGGCTA GGG (reversed) Intergenic
No off target data available for this crispr