ID: 1023317468

View in Genome Browser
Species Human (GRCh38)
Location 7:38954508-38954530
Sequence TCTAAAGGGGAATTTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023317461_1023317468 -6 Left 1023317461 7:38954491-38954513 CCCTAGCCAAAACTCTGTCTAAA No data
Right 1023317468 7:38954508-38954530 TCTAAAGGGGAATTTGAGGTTGG No data
1023317462_1023317468 -7 Left 1023317462 7:38954492-38954514 CCTAGCCAAAACTCTGTCTAAAG No data
Right 1023317468 7:38954508-38954530 TCTAAAGGGGAATTTGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023317468 Original CRISPR TCTAAAGGGGAATTTGAGGT TGG Intergenic
No off target data available for this crispr