ID: 1023317469

View in Genome Browser
Species Human (GRCh38)
Location 7:38954517-38954539
Sequence GAATTTGAGGTTGGTGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023317461_1023317469 3 Left 1023317461 7:38954491-38954513 CCCTAGCCAAAACTCTGTCTAAA No data
Right 1023317469 7:38954517-38954539 GAATTTGAGGTTGGTGTTATTGG No data
1023317466_1023317469 -3 Left 1023317466 7:38954497-38954519 CCAAAACTCTGTCTAAAGGGGAA No data
Right 1023317469 7:38954517-38954539 GAATTTGAGGTTGGTGTTATTGG No data
1023317462_1023317469 2 Left 1023317462 7:38954492-38954514 CCTAGCCAAAACTCTGTCTAAAG No data
Right 1023317469 7:38954517-38954539 GAATTTGAGGTTGGTGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023317469 Original CRISPR GAATTTGAGGTTGGTGTTAT TGG Intergenic
No off target data available for this crispr