ID: 1023319719

View in Genome Browser
Species Human (GRCh38)
Location 7:38981116-38981138
Sequence CATCCTACCTTCAAGGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1023319719_1023319724 -8 Left 1023319719 7:38981116-38981138 CCTAACCCCTTGAAGGTAGGATG 0: 1
1: 0
2: 1
3: 15
4: 127
Right 1023319724 7:38981131-38981153 GTAGGATGGATTGTTATTCATGG 0: 1
1: 0
2: 0
3: 7
4: 101
1023319719_1023319725 -7 Left 1023319719 7:38981116-38981138 CCTAACCCCTTGAAGGTAGGATG 0: 1
1: 0
2: 1
3: 15
4: 127
Right 1023319725 7:38981132-38981154 TAGGATGGATTGTTATTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023319719 Original CRISPR CATCCTACCTTCAAGGGGTT AGG (reversed) Intronic
900034703 1:397358-397380 CATCCTGCCTTCAAGGAATCTGG - Intergenic
900055534 1:627240-627262 CATCCTGCCTTCAAGGAATCTGG - Intergenic
903456445 1:23490504-23490526 AATCAAACCATCAAGGGGTTGGG + Intergenic
905899610 1:41572570-41572592 CATCCTGCCCTCAAGGTGCTTGG - Intronic
907023021 1:51087063-51087085 TATCCTACCTTCCAGGGATATGG - Intergenic
907386824 1:54131194-54131216 ATTCCTACCTGCAAGGCGTTTGG - Intergenic
912693265 1:111820677-111820699 CTTCTTAGCTTCTAGGGGTTAGG - Intronic
912997882 1:114549837-114549859 CATCTTGACTTCAAGTGGTTTGG - Intergenic
919031144 1:192244356-192244378 CTTCCTACATTCAAGGGGGGAGG - Intergenic
922257227 1:223902916-223902938 CATCCTTCCTTCAAGGAATTTGG - Intergenic
922280829 1:224122355-224122377 CATCTTACTTTCAAATGGTTTGG - Intronic
924338426 1:243005724-243005746 CATCCTGCCTTCAAGGAATTTGG - Intergenic
1065817449 10:29495084-29495106 CGACTTACCTTCCAGGGGTTTGG + Exonic
1065955409 10:30689314-30689336 CGACTTACCTTCCAGGGGTTTGG - Intergenic
1068726830 10:60312463-60312485 GTTCCTACCTTAAAGGGGTTTGG + Intronic
1068918065 10:62454441-62454463 CATACTACCATTAAGGTGTTTGG + Intronic
1073858737 10:107710916-107710938 CACTCTACCTTCAAATGGTTTGG - Intergenic
1075607579 10:123824743-123824765 AATCCTAACTTCAAGGGATGTGG + Intronic
1075724827 10:124605886-124605908 CCTCCTGCCTTCAAGGGGCCCGG + Intronic
1077563469 11:3281031-3281053 CATCCTAGCTTCAAATGTTTGGG - Intergenic
1077569361 11:3326846-3326868 CATCCTAGCTTCAAATGTTTGGG - Intergenic
1077954764 11:7004497-7004519 CAGCCTATATTCAAGGGGTGGGG - Intronic
1079620021 11:22542656-22542678 CATCCCACATTCAAGGGGCAGGG + Intergenic
1081764042 11:45596956-45596978 CATCCTAGCTTCGAGGGGTGGGG + Intergenic
1082726630 11:56744596-56744618 CATCCAAGACTCAAGGGGTTAGG - Intergenic
1084234799 11:67780337-67780359 CATTCTATCTAGAAGGGGTTTGG - Intergenic
1089589884 11:119533446-119533468 CATCCTCCCTGCCAGGGGTGGGG - Intergenic
1089897617 11:121947542-121947564 CAGCCTACCTTCAAGGGGAGGGG - Intergenic
1091007592 11:131967505-131967527 CATCCCACCTTCATGTGGCTCGG - Intronic
1091597502 12:1888052-1888074 CTTCCCACCTTCAAGGCTTTGGG - Intronic
1091651760 12:2315640-2315662 CATCCTCCCTTGAAGGGCTTGGG + Intronic
1092705072 12:11273911-11273933 CATCCTCTCTTGAAGGGGTGAGG + Intergenic
1092708983 12:11314520-11314542 CATCCTTTCTTGAAGGGGTGAGG + Intergenic
1093194184 12:16110838-16110860 CATCCTCCCTTCCAGGGATATGG + Intergenic
1100595112 12:96064971-96064993 CATCCTTCCTTCAAGGCAATGGG - Intergenic
1103122614 12:118393558-118393580 CATCCCAACTTCAATGTGTTAGG + Intronic
1103173523 12:118843091-118843113 CATCCTCCTTTCCAGGGGATGGG + Intergenic
1104010293 12:124925481-124925503 CATCGTACCTTGAAGGGATATGG - Intergenic
1118355957 14:65014024-65014046 CAGCCTACCTTCCAGGTGGTGGG + Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1123808693 15:23901260-23901282 CATCTTACCTTCAGTGGGTAAGG + Intergenic
1124583248 15:30981253-30981275 CAGCCCACATTCAAGGGATTGGG - Intronic
1125487879 15:40124958-40124980 CATCACGGCTTCAAGGGGTTAGG + Intergenic
1125491948 15:40155122-40155144 CATCACGGCTTCAAGGGGTTAGG + Intergenic
1131600002 15:93837593-93837615 CATCCAAACTCCAAGGGATTAGG + Intergenic
1133489321 16:6251570-6251592 CCCCCTACCTCCAAGGGGTAGGG - Intronic
1133837265 16:9378253-9378275 CAGCTTCCCTTCAAGGGGTAGGG - Intergenic
1133947259 16:10359263-10359285 CATCCCACATTCAAAGGGTTGGG - Intronic
1135358663 16:21792300-21792322 CAGCCTAGATTCAAGGGGTGAGG + Intergenic
1135457219 16:22608736-22608758 CAGCCTAGATTCAAGGGGTGAGG + Intergenic
1143978962 17:10851453-10851475 ATTCCTAGCTTCAATGGGTTGGG + Intergenic
1148781285 17:50123518-50123540 CATCTTACCTTGGAGGGGCTGGG + Intronic
1149537318 17:57442948-57442970 AAACCCACCTTGAAGGGGTTAGG + Intronic
1153470302 18:5437161-5437183 AATCCTACCCTCAAGGTGATGGG + Intronic
1155687386 18:28572141-28572163 CAACCTACATTCAATGGGTGGGG + Intergenic
1157659902 18:49431920-49431942 CATCCTTCCTGCAAGGGGACAGG + Intronic
1157878323 18:51294369-51294391 CATACCACCTCCAAGGGGTTTGG + Intergenic
1158263346 18:55633508-55633530 CAGCCTATATTCAAGGGGATGGG + Intronic
1162913715 19:13863603-13863625 AATCATACCTCCATGGGGTTGGG - Intronic
1163645917 19:18489004-18489026 CATCCCACCTGCAGGGGGTGTGG + Intronic
1168240608 19:55087098-55087120 CATCCTGCTTTCAAAGGGTACGG - Intronic
1168461476 19:56562611-56562633 TAGCCTACCTTCAAGGGGAGGGG + Intergenic
925907502 2:8548026-8548048 CATCCTCCCTCCCAGGGTTTAGG + Intergenic
927073725 2:19555713-19555735 CCTCCCAGATTCAAGGGGTTGGG - Intergenic
928786070 2:34887750-34887772 AGTCCTGCCTTCAAGGCGTTGGG + Intergenic
929983604 2:46703832-46703854 TATCCTACTTTCAAGGGGAGTGG + Intronic
931237544 2:60424143-60424165 CAGCCTACATTCAAGGGGAGGGG - Intergenic
932139251 2:69261109-69261131 CTTCATACCTTCTATGGGTTGGG - Intergenic
936478703 2:112865101-112865123 CGTCCTACCTTCAAGGAATCAGG - Intergenic
936986319 2:118314244-118314266 CATCCTTCCTTCACTGGTTTAGG - Intergenic
939529364 2:143337786-143337808 CATTCTACCTTCCAGTGTTTTGG - Intronic
942757691 2:179361786-179361808 CAGCCTAGATTCAAGGGGTGAGG + Intergenic
942825157 2:180167038-180167060 CATCCTCCCTTGAATGGGCTTGG + Intergenic
1169167807 20:3439570-3439592 CAGCCTACCCTCAAAGGGGTTGG - Intergenic
1172069262 20:32244539-32244561 CCTCCCACCTCCAAGGGGTTAGG + Intergenic
1173174501 20:40754301-40754323 CTTCCTTCCTTCAAGGCATTGGG + Intergenic
1173722100 20:45268548-45268570 GACCCTACCTTCAGGGGGTCTGG - Intergenic
1174812702 20:53660683-53660705 CATCCTTTCTTAAAGGGATTTGG + Intergenic
1181983027 22:26779744-26779766 CATCCCAGCATCAAGGGGTGGGG - Intergenic
1182542686 22:31053288-31053310 CAGCCTACTTTCAAGGGGAAGGG + Intergenic
1184064765 22:42111956-42111978 TATCCTGCCCTCTAGGGGTTTGG + Intergenic
1184358050 22:43995826-43995848 CATCCTTCCTTCCTGGGGTCAGG + Intronic
949142224 3:648493-648515 CATTCTACCTTACTGGGGTTAGG + Intergenic
956708433 3:72019490-72019512 AATCCTACCTTCTAGTGCTTGGG + Intergenic
958178807 3:90031000-90031022 CACCCAACATTCAAGGGGTGGGG - Intergenic
958777834 3:98506878-98506900 CAGCCTAGATTCAAGGGGATGGG + Intronic
959668073 3:108943568-108943590 CATCCAAACCTCAAGGTGTTGGG - Intronic
961600769 3:128059964-128059986 GATACTACCTCCAAGGGGCTCGG - Intronic
961884429 3:130086872-130086894 CATTCTATCTAGAAGGGGTTTGG - Intronic
962750678 3:138432933-138432955 GATCCTGTCTCCAAGGGGTTTGG + Intergenic
964223070 3:154368352-154368374 CATGGTACCTTCCAGGGTTTAGG + Intronic
965447475 3:168793444-168793466 CTTCCTCCCTTTAAGGGGATAGG - Intergenic
966817410 3:183900534-183900556 CATCCTATCCTCAAGGGGAGGGG - Intergenic
969027958 4:4189576-4189598 CATCCCACACTCAAGGGGTGGGG - Intronic
969820347 4:9715411-9715433 CATTCTATCTAGAAGGGGTTTGG + Intergenic
971128836 4:23783399-23783421 AATCCTTCTTTCCAGGGGTTTGG - Intronic
972572302 4:40321488-40321510 AATACTACCTTGTAGGGGTTTGG + Intergenic
974195545 4:58569976-58569998 CATGCTTCCTTCAAGGGGTGGGG + Intergenic
975721772 4:77255162-77255184 CATTTTACCTTCAGGAGGTTGGG + Intronic
976097932 4:81528558-81528580 CCTCCAACCTGGAAGGGGTTAGG + Intronic
977082877 4:92555535-92555557 CATCATATCTTCTAGGGGTCTGG + Intronic
977316135 4:95450218-95450240 GATCCCATCTTCAAGGGGGTTGG - Intronic
977999237 4:103536697-103536719 CAGCCCATATTCAAGGGGTTTGG + Intergenic
979238695 4:118429544-118429566 CATCCTTCCTTCAAGGAATTTGG + Intergenic
995111048 5:108428872-108428894 CATCCCTCCTCCAAGGAGTTCGG + Intergenic
999696039 5:154189929-154189951 CATTCTAACTCCAAGGGGGTTGG + Intronic
1000235653 5:159357444-159357466 CATACTACTCTCCAGGGGTTGGG + Intergenic
1001240275 5:170063642-170063664 CATTCTTCCTGCAAGGAGTTTGG + Intronic
1002739116 5:181421513-181421535 CATCCTGCCTTCAAGGAATCTGG + Intergenic
1002878837 6:1234578-1234600 CATCAGACCTTCAAGGAGGTGGG - Intergenic
1003053041 6:2797080-2797102 CATCCAGCCTTCAAGAGCTTTGG - Intergenic
1005693252 6:28327758-28327780 CAGCCCACATTCAGGGGGTTGGG - Intronic
1006101871 6:31690531-31690553 CGTCCTACCTTCCAGGGGCGTGG + Exonic
1006802240 6:36766586-36766608 CAACCCACCTTCAGGGGCTTAGG - Intronic
1006913440 6:37579040-37579062 CATCCTACCTCCCTGGGGTGAGG + Intergenic
1008138334 6:47802662-47802684 CATCCCCACTTCAAGGGCTTTGG + Intronic
1010931928 6:81814252-81814274 GATCCTACCCTCAAGGGGTCTGG - Intergenic
1015419768 6:132993634-132993656 GTACTTACCTTCAAGGGGTTCGG - Intergenic
1018833980 6:167469802-167469824 CATCCCACCTGCAAGGGCCTAGG - Intergenic
1019244226 6:170697065-170697087 CATCCTGCCTTCAAGGAATCTGG + Intergenic
1023319719 7:38981116-38981138 CATCCTACCTTCAAGGGGTTAGG - Intronic
1024447726 7:49501064-49501086 AATTCTACCTGCAAGGGATTTGG + Intergenic
1024564612 7:50671180-50671202 CCTCCTACCTTCAAGGAGAGGGG + Intronic
1027402781 7:77825499-77825521 TAGCCTACCTTCATGGGCTTTGG - Intronic
1029179057 7:98686127-98686149 CAGCCTACCCTCAAGATGTTTGG + Intergenic
1029365098 7:100111690-100111712 CATCCTCCCTTCCAGGGACTAGG - Intronic
1033677725 7:143560096-143560118 CATCATACCTTCAATGGCTGGGG + Intergenic
1033694111 7:143769344-143769366 CATCATACCTTCAATGGCTGGGG - Intergenic
1035245543 7:157560216-157560238 TCTCCCACCTTCAAGGGGTCAGG - Intronic
1041751014 8:61260966-61260988 AATCCAAATTTCAAGGGGTTAGG - Intronic
1042981570 8:74535227-74535249 TATCTTCCCTTCAAGAGGTTTGG - Intergenic
1044598291 8:93979609-93979631 CATCTAAGCTCCAAGGGGTTTGG + Intergenic
1045686273 8:104715617-104715639 CAGCCCACATTCAAGGGGATGGG - Intronic
1056106196 9:83349117-83349139 CAGCGTACCTTCTGGGGGTTTGG - Intronic
1057183320 9:93041305-93041327 CCTCCTGCCATCAAGGGGTGGGG - Intergenic
1058598157 9:106638376-106638398 GATCCTACCATCTAGGGGTTAGG + Intergenic
1186721912 X:12313500-12313522 CAATCAACTTTCAAGGGGTTAGG + Intronic
1188546653 X:31314851-31314873 CCTCCTTCCTTCCAGGGGATAGG - Intronic
1197096345 X:122600440-122600462 CAGCCTTCATTCAAGGGGTCAGG - Intergenic
1197685409 X:129434556-129434578 CTTCATACATTGAAGGGGTTAGG + Intergenic
1198496774 X:137201235-137201257 TACCCTACCTTCAAGGAGATGGG - Intergenic
1199498824 X:148486561-148486583 CATTGTACATTCAATGGGTTTGG - Intergenic
1202386470 Y:24331335-24331357 CATCCTTCCTTCAAGGAATTTGG + Intergenic
1202484316 Y:25338793-25338815 CATCCTTCCTTCAAGGAATTTGG - Intergenic