ID: 1023320059

View in Genome Browser
Species Human (GRCh38)
Location 7:38986409-38986431
Sequence GGTTATTTCCTTCCAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 1, 2: 1, 3: 20, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1023320059 Original CRISPR GGTTATTTCCTTCCAAAAAC AGG Intronic
900846777 1:5110191-5110213 ATTTTTTTCCTTCTAAAAACTGG + Intergenic
901935921 1:12626784-12626806 GGGCTTTTCATTCCAAAAACAGG - Intergenic
905583381 1:39098986-39099008 GGTAATTTTCTTCCAAGAGCTGG + Intronic
908815292 1:68025943-68025965 AGTTAGTTCCTTCAAAGAACTGG + Intergenic
910692663 1:89980959-89980981 TGTTTTTTGCTTCCAGAAACTGG - Intergenic
912937375 1:114015385-114015407 GGTTAATTCTTTCCTAAACCAGG + Intergenic
915964561 1:160294930-160294952 GGTTAAATCCTTTCAAAAACAGG + Intronic
919720367 1:200826910-200826932 GGTTATTTACATCTTAAAACAGG + Intronic
922087191 1:222361974-222361996 GATTATTGCCTTCCATAATCAGG - Intergenic
923579774 1:235197937-235197959 ATTTACTTCCTTCCAAAATCGGG + Intronic
923824736 1:237488050-237488072 CGCTATTTACTTCCAAAATCTGG + Intronic
924211054 1:241767729-241767751 GATTATTTCCTTTCAAAAACTGG - Intronic
924564129 1:245181941-245181963 GATCATTCCCTTCCAAAAAGTGG + Intronic
1063686619 10:8242637-8242659 GGTAAATTCCTGCCAAAGACTGG + Intergenic
1067274871 10:44825048-44825070 ATTTATCTCCCTCCAAAAACTGG + Intergenic
1068461793 10:57338970-57338992 GGTTACTTCCTGCCAAAAAGGGG + Intergenic
1068817425 10:61333448-61333470 GGTTATTTTCTTACCAAAATTGG - Intergenic
1072220019 10:93318962-93318984 GGTGCTTTCATTCCAAAAAAGGG - Intronic
1073535907 10:104276300-104276322 TGTTATTTTCCTCAAAAAACAGG - Intronic
1075055258 10:119213672-119213694 TTTTATTACCATCCAAAAACTGG + Intronic
1075876646 10:125812952-125812974 GGTTCTTCCTTTCCAAAATCTGG + Intronic
1076022835 10:127088841-127088863 GGATATAACCTTCCAAATACAGG - Intronic
1076435673 10:130439692-130439714 TGTTATTTCCTTCCAAAATAGGG + Intergenic
1080027017 11:27625806-27625828 GGTTATCTCCTTCCTCAAAATGG + Intergenic
1083072099 11:59995166-59995188 GGTGATTTCCTACCAATACCCGG - Intergenic
1085014306 11:73162882-73162904 GGTTCTTTCCTTCCAACAAGTGG - Intergenic
1087894682 11:103574250-103574272 GGTTATCACCTTCAAAAAAAAGG + Intergenic
1090192228 11:124780856-124780878 AATTATTTCCTTCAAGAAACGGG - Intronic
1091283540 11:134395720-134395742 GGACATTTCCTTCCAAAAGTGGG - Intronic
1091524223 12:1281249-1281271 GGAAATTTCTTTCCAAAACCTGG + Intronic
1093300896 12:17452951-17452973 TTTTATTTCCTTTCAAAAACAGG - Intergenic
1094197337 12:27763173-27763195 GGTTAATTCCTTAGAATAACTGG + Exonic
1095318762 12:40799496-40799518 GGTTATGTTCTGCCAAAAAATGG - Intronic
1095555451 12:43498582-43498604 AGTTAGTGCCTTCTAAAAACTGG + Intronic
1100999246 12:100340280-100340302 GATTCTTTCCTTCCTAAAAATGG - Exonic
1104324672 12:127785085-127785107 GCATATTTCTCTCCAAAAACAGG - Intergenic
1104496320 12:129243612-129243634 GCTTATTTCCTTCCTAACACAGG + Intronic
1106638974 13:31562865-31562887 AATTATTTCCTTCAAAAAAAAGG - Intergenic
1106978792 13:35253086-35253108 GGTTGTTTCCTTCAAAGCACAGG - Intronic
1107075422 13:36317615-36317637 GGTTCTTACCTTCCAGAAAAGGG - Intronic
1107212354 13:37872183-37872205 TGTTATTTCTTTCCATAAAAAGG + Intergenic
1108158748 13:47616170-47616192 GGTCCTGTTCTTCCAAAAACTGG + Intergenic
1108562729 13:51662272-51662294 GGTTATATCATTTAAAAAACAGG - Intronic
1110152578 13:72273249-72273271 GGTTATGTCTTACAAAAAACAGG + Intergenic
1110396409 13:75034513-75034535 GGGTATTGCCCTCCAAAACCTGG + Intergenic
1110587754 13:77214545-77214567 GGCTATTACCTTTAAAAAACGGG + Intronic
1110951417 13:81497047-81497069 GGTTATCCCTTTCCAAATACGGG - Intergenic
1112766400 13:102749808-102749830 GGTTATTTCTGTCCAAGCACAGG - Exonic
1114345563 14:21790843-21790865 GTTGATTTGCTTCCAAAGACTGG - Intergenic
1114934269 14:27514192-27514214 TGTTTTTCCCTTCCAATAACTGG - Intergenic
1114943961 14:27654817-27654839 TCATATATCCTTCCAAAAACAGG + Intergenic
1117585383 14:57197195-57197217 GGTTATTTTATTTCAAAAAAAGG - Intergenic
1117784069 14:59264464-59264486 GTTTTTTTCCTTCAGAAAACAGG - Intronic
1119231405 14:72982757-72982779 TGTTACTTCCTTCCATAAACGGG + Intronic
1119255687 14:73194255-73194277 TGTTTTTTTCTTCCAAAGACAGG + Intronic
1119574803 14:75710066-75710088 GATTATGTCCTGCCAAAAATTGG + Intronic
1120015910 14:79473202-79473224 AGTGTTCTCCTTCCAAAAACTGG + Intronic
1120038666 14:79727826-79727848 TGGTATTTCCTTCTAAAAAGGGG - Intronic
1121155402 14:91679136-91679158 GGTCATTTCCAACTAAAAACGGG + Intronic
1123497617 15:20844342-20844364 GATTCTTTACTTACAAAAACAGG - Intronic
1127299761 15:57641547-57641569 GGTGATTTCTTTCCAACGACTGG - Intronic
1128447512 15:67776994-67777016 GTTTCTTTTCATCCAAAAACAGG + Intronic
1128714347 15:69896395-69896417 TGTTTTTACCTTCCAACAACTGG - Intergenic
1128889818 15:71321170-71321192 GGTTATTTCAGTCAAATAACTGG - Intronic
1131049967 15:89341186-89341208 GGCTATTTGCTTCCAGACACAGG - Intergenic
1131480046 15:92773030-92773052 GGTTATTCCATTTCTAAAACAGG - Intronic
1131663351 15:94542626-94542648 GGTTTCTTCCTTCCATGAACAGG - Intergenic
1202963194 15_KI270727v1_random:145179-145201 GATTCTTTACTTACAAAAACAGG - Intergenic
1133627260 16:7582488-7582510 TGTTCTTTCCTGCCAAACACCGG + Intronic
1134348234 16:13411845-13411867 GGTTATTTGCTACCAGAAAGAGG + Intergenic
1135716928 16:24779037-24779059 TGTTGTTTCCATCCAAAAACAGG - Intronic
1137966280 16:52936498-52936520 GGTTGTTTCCTTCCCAGCACAGG - Intergenic
1138224840 16:55284076-55284098 ACTGATTTCCTTCCAAAAACAGG + Intergenic
1139128175 16:64107534-64107556 GTTTGTTTCTTTCAAAAAACTGG + Intergenic
1139564246 16:67763407-67763429 GGTTATTTTCCTGCAAAAACCGG - Intronic
1147362455 17:39939903-39939925 GGTTATTTCCTTCTAAGACTAGG - Intergenic
1154455627 18:14520758-14520780 GATTCTTTACTTACAAAAACAGG - Intronic
1155232077 18:23783642-23783664 GTTTCTTTCCTTCTAAAAACTGG + Intronic
1156027652 18:32673842-32673864 TGTTATTTACTTCAAAAGACAGG - Exonic
1157866204 18:51187170-51187192 GGGTATTTCCTTACATAATCTGG + Intronic
1165195411 19:34098663-34098685 AGTGACTTCCTTCCAAAAATGGG + Intergenic
1165674811 19:37713006-37713028 GTTTATTTCGTTCCTAAATCTGG + Intronic
1166428322 19:42699548-42699570 TGTTATTTTCTTCAACAAACAGG - Intronic
927460100 2:23291533-23291555 GATAATTGCCTTCCAAAGACTGG - Intergenic
928111949 2:28517553-28517575 GTTTATTTGTTGCCAAAAACTGG - Intronic
930611005 2:53543512-53543534 CCATATTTCCTTCCAATAACGGG + Intronic
931461674 2:62455464-62455486 GGTAAATTACTTCTAAAAACTGG + Intergenic
934566611 2:95345191-95345213 GGTCATTTCCCACCAGAAACAGG + Intronic
936850508 2:116891995-116892017 GTTTATTTCCTTTAATAAACTGG + Intergenic
936983374 2:118285020-118285042 GGTTATTTCCTTCCACAAACTGG + Intergenic
938705492 2:133920978-133921000 TGCTATTTCCTCCCAAAATCAGG + Intergenic
939256228 2:139747593-139747615 GGGTATTCAATTCCAAAAACAGG - Intergenic
940251759 2:151685468-151685490 GGTTATCTCCTGTCAATAACAGG - Intronic
940575424 2:155497445-155497467 AGTTATTGCCCTCCAAAATCAGG + Intergenic
941153918 2:161952019-161952041 GCTTACTTTCTTCCTAAAACAGG - Intronic
942756806 2:179351108-179351130 TTTTTTTTCCTTCCAAAAAAGGG + Intergenic
943630992 2:190252229-190252251 GGTTACTTCCTTGCATTAACAGG - Exonic
946888830 2:224252641-224252663 GGTAGTTTCCTACCCAAAACTGG - Intergenic
1173026812 20:39315205-39315227 GGTTCTTTCCTTCCCAAACTTGG + Intergenic
1173705858 20:45110034-45110056 GGTTAATTCCTTCCCATAATAGG + Intronic
1175262460 20:57683281-57683303 TGATGTTTCCCTCCAAAAACTGG - Intronic
1175505029 20:59476350-59476372 GATTACTGCCTTTCAAAAACTGG + Intergenic
1176818540 21:13632561-13632583 GATTCTTTACTTACAAAAACAGG + Intronic
1178084390 21:29098201-29098223 GCTTATTTCATTCCAAAGAAAGG - Intronic
1178568682 21:33713785-33713807 GGTAATTTTCTTCCAACCACAGG - Intronic
1178910477 21:36669469-36669491 GTTCATTTCCTTCTACAAACTGG + Intergenic
952354122 3:32569428-32569450 GGTTATATCCATCTAAAAACAGG - Intronic
955796142 3:62639270-62639292 TGTTTTTTCCTTCCAGAAAAAGG - Intronic
956914933 3:73861012-73861034 AAGTATTTCCTTCCAGAAACAGG + Intergenic
957819159 3:85347434-85347456 CGTTACTTTCTTCCAAAAATTGG - Intronic
959141231 3:102488936-102488958 CGTCATTTACTTCCAAAAAATGG - Intergenic
960785026 3:121362970-121362992 GGTTCTTTCCTTCAAAGCACTGG + Intronic
960980120 3:123216002-123216024 GGTTATCTCCTTCCCCCAACTGG - Intronic
963278595 3:143358302-143358324 GGAGATTTCCTTCCCATAACTGG - Intronic
963607712 3:147424955-147424977 GGGTATTTGCTTCCTAAAGCTGG + Intronic
964979809 3:162665335-162665357 GGTTAGTTCCCCCCAAAAAAAGG - Intergenic
965860957 3:173149611-173149633 CATTATTTCCTTAAAAAAACTGG + Intergenic
967675255 3:192290876-192290898 AGTTATTTACTTCAAAAAAAAGG + Intronic
967693306 3:192502516-192502538 GGTTATTTCATTTTAAACACTGG - Intronic
968763217 4:2453209-2453231 TGTTATTTGCTTCGAAAGACGGG - Intronic
969095253 4:4728001-4728023 AGTTATTTCCTTTCCAAAACAGG - Intergenic
970289252 4:14553521-14553543 TGTCATTTCCTTCCAACCACAGG + Intergenic
972253009 4:37324806-37324828 GGTTATTTGCTTCTCAAAATAGG + Intronic
973242423 4:47970819-47970841 TTTTTTTTCCTTCCAAAAAGAGG - Intronic
975205531 4:71640461-71640483 GGTTATCATCTTCAAAAAACAGG + Intergenic
976972975 4:91130757-91130779 GGTTATTTCCTTCCTGATAGTGG - Intronic
977410301 4:96653669-96653691 GGTTAGCTCCTTCCCATAACTGG - Intergenic
978060251 4:104327965-104327987 TGTCTTTTCCTTCCAATAACAGG + Intergenic
978937715 4:114398585-114398607 GGTTAATTCCTTCCAGAAGAGGG + Intergenic
979567719 4:122174552-122174574 TGTTTTTTCCTTCCTATAACAGG + Exonic
981828027 4:148967166-148967188 GGTAAGTTCTTTCCAAAAACTGG - Intergenic
982590377 4:157301822-157301844 GGTCATTTCAATCCAAAAACTGG - Intronic
988869197 5:35370042-35370064 GCTTACTTCCTTCCTAAAACTGG - Intergenic
990230627 5:53709589-53709611 CGTTATTTTTTTCAAAAAACTGG + Intergenic
990457255 5:55999892-55999914 AGTTATGACCTTCCAATAACTGG - Intergenic
991156718 5:63445126-63445148 TGAAATTTCCTTCCACAAACAGG - Intergenic
993741130 5:91541111-91541133 GGTTATTTCCTTTCCAAACCAGG + Intergenic
994904501 5:105820595-105820617 GCTTAATTCCTGCCAAAAATGGG - Intergenic
995405124 5:111786079-111786101 GATCATTTGCTTCCAAAGACAGG + Intronic
995800399 5:115987918-115987940 AGTTACTCTCTTCCAAAAACAGG + Exonic
996285065 5:121780320-121780342 GGTTGATTCCTTACGAAAACTGG + Intergenic
996559793 5:124816565-124816587 TGTTCTTTCATTTCAAAAACTGG + Intergenic
996643961 5:125792834-125792856 GGCTATTTCCTTCCAGAGAGTGG - Intergenic
999614256 5:153405281-153405303 TGTTGCTTTCTTCCAAAAACTGG + Intergenic
1000651569 5:163824410-163824432 GGTGATTTCTTTCCCAAAAGAGG + Intergenic
1003834498 6:10055847-10055869 TTTTATTTCCTTCCTAAAATTGG + Intronic
1004323808 6:14655040-14655062 GGTGCTGTCCTCCCAAAAACTGG - Intergenic
1009543443 6:64995544-64995566 GGTGATATCCTTCCAAGAAATGG - Intronic
1011567699 6:88695506-88695528 TCTTTTTTCCTTGCAAAAACTGG - Intronic
1012184960 6:96201981-96202003 AGATGTTTCCTTCCAAAAAACGG - Intronic
1012361207 6:98382838-98382860 AGTTATTACCTTTAAAAAACAGG + Intergenic
1012699538 6:102436451-102436473 GGTTATTACATTCCACCAACTGG - Intergenic
1012888957 6:104877462-104877484 GCACATTTCCTTCCAGAAACAGG - Intergenic
1013621578 6:111895355-111895377 AGTTTTTCCATTCCAAAAACTGG - Intergenic
1015180763 6:130360115-130360137 GCTTATTTCCTTATATAAACAGG + Intronic
1015692025 6:135936086-135936108 GGTTATTTAATTCCAAGGACTGG + Intronic
1016999264 6:149984599-149984621 GGTTGTTTCCTTCCCAGCACAGG + Intergenic
1019855107 7:3597566-3597588 GGTTATTTTCCTCCTAAAATGGG - Intronic
1021270336 7:18577133-18577155 GTTTATTCCCTTACAAAATCTGG - Intronic
1021512150 7:21445330-21445352 TGTTATTTCCTTCAGAAAATGGG - Intronic
1023320059 7:38986409-38986431 GGTTATTTCCTTCCAAAAACAGG + Intronic
1023459707 7:40382475-40382497 GAGTATTTCCTTTCAAAAAAAGG - Intronic
1024894556 7:54242974-54242996 GGTTATTTCCCGCCAAACGCAGG - Intergenic
1028232976 7:88327829-88327851 GGTTAGTTCATTACAAAAACAGG + Intergenic
1031025650 7:116676857-116676879 AGGTATTTCCCTACAAAAACAGG - Intronic
1032451771 7:132037425-132037447 GGCTATTTCCTTCCATGAAGGGG + Intergenic
1033720581 7:144055171-144055193 GTTTATTGCCTTCCACAAAGTGG + Intergenic
1034910913 7:154997937-154997959 GTGTATTTCATTCCAAAAGCAGG - Intronic
1037077009 8:14732688-14732710 GGTCTTTTCCTTCCTAAAACGGG + Intronic
1039161125 8:34622336-34622358 GGTTATTTCCTTTAAAACATAGG + Intergenic
1044867453 8:96586286-96586308 GGTTATTTCCTTTCACCAAATGG + Intronic
1045095111 8:98789379-98789401 GGTTATTTCCTTTCTTATACTGG - Intronic
1045428194 8:102087738-102087760 AGTTTTTTCCTTCCCAAAAGAGG + Intronic
1046261855 8:111778999-111779021 GGTTATTTTCTTTAAAAAAAGGG + Intergenic
1046439901 8:114242809-114242831 GGTTCTTACCTTCCAGAAAAGGG - Intergenic
1047699193 8:127432910-127432932 GGTTCTTACCTTCCAGAAAAGGG - Intergenic
1050223329 9:3421876-3421898 GGCAATTTCATTCCAACAACAGG + Intronic
1050584761 9:7099185-7099207 TGTTTTTTTCTTCCACAAACAGG - Intergenic
1052480778 9:29022480-29022502 GGTGATTTTCTTCCAAAACAGGG + Intergenic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1055175143 9:73309414-73309436 GTTTATTTCCTTTCTAAATCAGG + Intergenic
1056869085 9:90259869-90259891 GTTTCCTTCCTGCCAAAAACAGG + Intergenic
1058572649 9:106364247-106364269 AGTTATATGCTTCCAAAAAATGG + Intergenic
1060681419 9:125568347-125568369 AGTTTTTTCCTTCCTAAAAGGGG + Intronic
1061467692 9:130795205-130795227 GAGTATTTCCTTCAAAAAACAGG + Intronic
1203528818 Un_GL000213v1:116946-116968 GATTCTTTACTTACAAAAACAGG - Intergenic
1188782446 X:34302391-34302413 AGTTATTTCCTTGTAACAACTGG + Intergenic
1189175211 X:38949875-38949897 GGTAATACCCTCCCAAAAACAGG + Intergenic
1193687032 X:84590154-84590176 GGTTTTTTTTTTCCAAAAATAGG + Intergenic
1193941334 X:87683061-87683083 GGTTCTTACCTTCCAGAAAAGGG - Intergenic
1195314912 X:103668099-103668121 GGTTATTTCCTTTGGAAACCTGG - Intergenic
1195762768 X:108264650-108264672 GGTTTTTTTCTTCTAAAAAAGGG + Intronic
1198587383 X:138137576-138137598 AGTTATATCCTTCCAGAACCAGG + Intergenic
1200353502 X:155524365-155524387 GGTTTGTTCCTTTCAAAAATAGG - Intronic
1200922101 Y:8622480-8622502 GGTTATTTCCATCCAGAAGAGGG - Intergenic
1201628044 Y:16036736-16036758 GCTTTTTTCTTTCCCAAAACTGG - Intergenic